Technique of Overlap Extension by Polymerase Chain Reaction for Splicing Cauliflower Mosaic Virus (CaMV) 35S Promoter and DhPEX11-Like

  38 Overlap Extension by PCR for Splicing CaMV 35S Promoter & DhPEX11-Like (Ikawati and Yen)

  

Technique of Overlap Extension by Polymerase Chain Reaction for Splicing

Cauliflower Mosaic Virus (CaMV) 35S Promoter and DhPEX11-Like

1,2*

  2 ₁ Silvi Ikawati , Yung-fu Yen ₂ Faculty of Agriculture, University of Brawijaya, Malang, Indonesia

Department of Bioagricultural Science, National Chiayi University, Chiayi, Taiwan

Abstract

The promoter plays an important role in the regulation of gene expression. The problem is some of binary vector that

absence from promoter at cloning site. The cauliflower mosaic virus (CaMV) 35S promoter is a strong and constitutive

promoter that widely used to produce transgenic organisms. In this experiment the cauliflower mosaic virus (CaMV) 35S

promoter was spliced at upstream of DhPEX11-like for driving downstream transgenes DhPEX11-like expression used

the technique of Overlap Extension by The Polymerase Chain Reaction. In gene splicing, internal primers are used to

amplify some overlapping regions of both genes and then these internal primers are combined with the external

primers in PCR process which allows amplification of the entire region. In the experiment, the recombinant PCR

successfully spliced the 35S-DhPEX11 gene. This method is simple, rapid and reduced reagents used because it does not

. need many vector constructions Keywords:

   DhPEX11-Like, Gene splicing, Oligonucleotide, PCR, Promoter 

  

INTRODUCTION longer desired and therefore can be a useful tool

  Promoters are one of the essential constitute for genome engineering in plants [6]. The ability to fuse two DNA fragments by overlap extension of gene, as they are required to drive expression can be exploited further to splice two or more of both the selectable marker gene and the gene of interest in transgenes [1]. The problem is some DNA fragments from different genes [7]. Overlap of binary vector is absence from promoter at extension-PCR also can be used as a means for cloning site. Combining genes or regulatory site directed mutagenesis, introducing desired mutations to the final hybrid gene [2]. Under PCR elements to make hybrid genes is a widely used conditions, the common sequence allows strands methodology throughout the biological sciences

  [2]. One of the techniques for synthesis of arti- from two different fragments to hybridize to one ficial genes is called gene splicing, in which seg- another, forming an overlap [4]. Initial PCRs generate overlapping gene segments that are ments of DNA are joined together to create a then used as template DNA for another PCR to new genetic combination [3]. Gene splicing by create a full-length product [8]. overlap extension is a technique for combining the DNA molecule from two genes on the short Overlap extension by recombinant PCR nucleotide sequences that have been recom- proved to be an effective technique for providing adequate amounts of spliced DNA for cloning bined in precise junctions without using re- purposes, having established the appropriate striction endonucleases or ligase [4]. The conditions [9]. Technique overlapping gene seg- polymerase chain reaction (PCR) has greatly en- hanced the field of molecular biology by making ments by recombinant PCR is a simple, versatile numerous regions of the genome (coding and technique for gene splicing [8]. This powerful and technically simple approach offers many advan- noncoding), in both extant and extinct taxa, tages over conventional approaches for manipu- accessible for detailed analysis [5]. Previous lating gene sequences [4]. Splicing by overlap research demonstrated that the PCR recom- binant can be used to remove selectable markers extension by the polymerase chain reaction (SOE or other introduced transgenes that are no by PCR) can used to splice promoter and interest gene [10]. In this paper, we describe the use of gene splicing technique for splice the cauliflower

   Correspondence author:

  mosaic virus (CaMV) 35S promoter and DhPEX11-

  Silvi Ikawati like.

  Email : silviikawati@ub.ac.id Address : Department of Plant Protection, Faculty of Agriculture, University of Brawijaya, Jl. Veteran Malang, 65145

  J.Exp. Life Sci. Vol. 5 No. 1, 2015

ISSN. 2087-2852

  39 Overlap Extension by PCR for Splice CaMV 35S Promoter & DhPEX11-Like (Ikawati and Yen)

MATERIALS AND METHODS

  Directly after PCR amplification the reaction (50 µL) was heated at 95°C for 20 minutes. Fifteen µL of dATP (from a mM stock) and 5 units of Taq DNA Polymerase were added. The reaction was incubated at 70°C for 15 minutes. Following electrophoresis, the DNA band of interest quickly was located by illuminating the gel on UV transilluminator for purification of PCR

  PCR recombinant [16]

  For preparing 1% gel, 0.25 g of agarose powder (Seakem, Marine Colloids, Inc.) dissolved in 25 ml 0.5X Tris acetate EDTA buffers (20 mM Tris acetate, 0.5 mM EDTA). The mixture was heated in a microwave oven for about 1-2 min to dissolve agarose. The solution was cooled for 4 min and poured into electrophoresis apparatus. After gel has solidified, 0.5X TAE buffer was poured into gel box, and comb was removed after solidified. A dye solution was added at DNA samples prior to electrophoresis. DNA molecular weight marker was used in each size marker lane of the electrophoresis gel. Electrophoresis was performed at 100 V for 35 minutes or until the dye neared the bottom of the gel. The gel was then placed in a solution of ethidium bromide in water and stained for 2 minutes. About 10 minutes the gel was rinsed in water. The gel is illuminated with UV transilluminator then photo- graphed.

  Gel agarose preparation

  μM each). PCR amplification was performed initialized at 94°C for 3 min, followed by 28 cycles (94°C for 45 s, 60°C for 30 s, and 72°C for 30 s), with a final extension of 5 min at 72°C.

  of 5X Phusion HF reaction buffer and 1 μl primer mix (10

  Taq Phusion High-Fidelity DNA Polymerase, 5 μl

  μl 10 mM Deoxy- ribonucleotide triphosphate (dNTP), 0.25 μl of

  volumes with 1 μl of template DNA. The PCR reaction mix contained 0.5

  J.Exp. Life Sci. Vol. 5 No. 1, 2015

  The PCR were performed in 25

  PCR amplification

  Gene splicing by overlap extension consists of three times PCRs process. In the first stage reactions produced the two DNA fragments, and the first products to be used as template in the second stage [4,8,9,15]. Four primers is needed consisting of two flanking and hybrid primers to one construct [9]. SOE by PCR (Fig. 1) was used to combine 35S Promoter and DhPEX11-like into expression cassette.

  Gene splicing

  100 μl of Elution Solution. The spin column was centrifuged at 14,000 rpm for 1 min to elute plasmid DNA. The yield of plasmid DNA was around 2-30 µg in 1-3 ml of cells culture which had the purity of ratio of 1.8-2.0 of 260/280 nm (ND-1000 spectrophotometer, NanoDrop, USA).

  The supernatant was decanted and the pellet was resuspended in 200 μl Solution I by pipetting or vortexing. And 200 μl Solution II was added into the tube and the mixture was inverted 5 times. Next, 200 μl Solution III was also added and the tube was inverted again (5 times) to lyse cells. The lysate was centrifuged at 14,000 rpm for 5 min and the supernatant was transferred into a spin column combined with collection tube. The flow-through in the collection tube was discarded. The spin c olumn was added 700 μl Wash Solution and centrifuged at 14,000 rpm for 1 min. The washing step was repeated for one more time. The spin column was centrifuged for 5-10 min at top speed to remove residual trace of ethanol. After ethanol removed completely, the spin column was then transferred into a new 1.5 mL Eppendorf tube and was added 30-

  To get the promoter and the gene for splice process, first was needed to extract plasmid that contained the genes from E. coli. The trans- formed white single colony E. coli was picked out from a petri dish and was transferred to small volume of LB-medium 5 mL containing the am- picillin antibiotic (0.2 mg/ml) and shaken at 37°C and 200 rpm for 16-24 h. Plasmid Miniprep Purification Kit (GeneMark) was used to extract the plasmid from E. coli culture, according to the manufacturer’s manual. Cell pellet was collected in a 1.5 mL Eppendorf tube (1-3 ml of cells) by centrifugation of E. coli culture at 14,000 rpm for 1 min.

  Plasmid preparation

  The 35S promoter and DhPEX11-like gene were used in this research. The promoters that have been most commonly used in the trans- formed plants so far, include the CaMV 35S, ubiquitin 1 and actin promoters [11]. Cauliflower Mosaic Virus (CaMV) and the closely related Figwort Mosaic Virus are circular duplex DNA viruses which replicate via transcription of a full- length (35S) genomic RNA intermediate [12]. The cauliflower mosaic virus (CaMV) 35S promoter is a strong and constitutive promoter that widely used for production purposes [13, 14].

  35S promoter and DhPEX11-like gene

  μl reaction

ISSN. 2087-2852

• –(2) in Fig. 1. However, since the hybrid oligonucleotides have the splice regions, pro- ducts in the first stage will splice at the short sequences derived from the other (2) in Fig. 1. Therefore when the two products are combined they can partially anneal and used two external primers in the second stage PCR to get the final result (3 –4) in Fig. 1 [9].

  Confirmation of DNA fragments

  

Figure 1. Gene splicing by overlap extension by polymerase chain reaction [9]

Promoter and gene illustrated in the form of bars. Promoter illustrated in the form of solid shading bars, while gene illustrated

with lightly stippled. Oligonucleotides shown by the label a lower case letter (a,b,c,d). If shown above the promoter and gene,

their orientation is 5′ to 3′ (left to right), and 3’ to 5’ (right to left) if shown below it.

  This technique uses 2 steps PCR, first step is to get two kind of template that the promoter and gene sequence are joined use internal Oligonucleotides. Second step used two kind of template with external Oligonucleotides (Table 1). The oligonucleotides design (Table 1) were based on the full-lengthed nucleotide sequence of 35S promoter in NCBI (http://www.ncbi.- nlm.nih.gov) and DhPEX11-like [17].

  In the first stage PCRs produces two DNA fragment with the sequence 5′ and 3′to the splice point (1)

  RESULT AND DISCUSSION First Stage PCR

  After PCR and enzyme digestion the transformed strains of plasmids were delivered to Mission Biotech Company (Taipei, Taiwan) for sequencing. DNA sequence data were analyzed using the National Centre of Biotechnology (NCBI) web site (http://www.ncbi.nlm.nih.gov) for alignment by the program nucleotide blast (BLASTn).

  DNA Sequencing

  μl of 10X buffer, 0.2 μl of 100x BSA, 0.5 μl of restriction enzyme, and sterile water to 20 μl. The reaction was incubated for 1 h at the temperature specific for the enzyme used. Digested products were electrophorated on 1 % agarose gels.

  Confirming DNA fragments of CaMV35S promoter, DhPEX11-like and 35S/DhPEX11 we did PCR, enzyme digestion and sequence analysis. For the digestion reaction includes 1.5 μg of plasmid DNA, 2

  Nuclease-Free Water was added to the minicolumn and centrifuged at 14,000 rpm for 1 min. For further confirmation these PCR products were sequenced.

  J.Exp. Life Sci. Vol. 5 No. 1, 2015

  μl

  and centrifuged at 14,000 rpm for 5 minutes. The column was recentrifuged for 1 min with the microcentrifuge lid open (or off) to allow evaporation of any residual ethanol. Fifty

  μl Membrane Wash Solution

  Solution (ethanol added) then centrifuged at 14,000 rpm for 1 minute. The washing step was repeated with 500

  μl Membrane Wash

  Dissolved gel mixture was transferred to the Minicolumn assembly and then centrifuged at 14,000 rpm for 1 min. Following centrifugation flow-through was discarded and the minicolumn was washed with 700

  μl Membrane Binding Solution was added per 10 mg of gel slice. The gel was incubated at 50-65°C until gel slice is completely dissolved.

  fragments. The gel was sliced using a clean razor blade and was excised with the Wizard DNA Clean-Up system kit (Promega). Gel slice was transferred in a 1.5-ml microcentrifuge tube (Eppendorf) and 10

  40 Overlap Extension by PCR for Splicing CaMV 35S Promoter & DhPEX11-Like (Ikawati and Yen)

ISSN. 2087-2852

  J.Exp. Life Sci. Vol. 5 No. 1, 2015

  35S/DhPEX11 gene, using outprimer pair of 35S-F and PEX11-R. The hybrid oligonucleotides are designed from the known nucleotide sequences to generate fragments that will have overlapping sequence [9]. They had 20 bp overlap which sequences were u nderlay at 5’end of 35S promoter and 3’end of PEX11-like gene (Fig. 2).

  R: 35S/PEX11 recombinant.

  PEX11-like: PEX11-like gene.

  (B) PCR analysis of PEX11-like gene. the expected size for PEX11-like was 519 bp. (C) PCR analysis of 35S/PEX11 recombinant, the 1051 bp band was shown. M: 1-kb DNA markers. 35S: 35S promoter.

  

Figure 2. Recombinant PCR for 35S/PEX11

(A) PCR analysis of 35S promoter. The figure showed the expected size of 35S promoter was 573 bp.

  The first PCR cloned the 35S promoter and the second PCR cloned the DhPEX11-like gene, their sizes were confirmed by analysis on 1% gel electrophoresis with expected with expected DNA fragments of 573 bp (Fig. 2A) and 579 bp (Fig. 2B), respectively. The size of the recom- bination had expected band and sequenced being 1051 bp. (Fig. 2C).

  The availability of thermostable DNA polyme- rases with a much lower tendency to add a non- templated nucleotide to DNA fragments [18] may decrease the rate of mutation further and the need to blunt end intermediate products [9].

  DhPEX11-like to become to the recombinant of

  41 Overlap Extension by PCR for Splice CaMV 35S Promoter & DhPEX11-Like (Ikawati and Yen)

  The extracted plasmid DNA from pCAMBIA 1302 was used as template in PCR with prime pair of 35S-F and 35S-R for cloning CaMV 35S Promoter, as well as the DhPEX11-like fragment was cloned from the transformed pMETB Plasmid using the prime pair of PEX11-F and PEX11-R [17]. The secondary PCR spliced the two DNA fragmented of CaMV 35S promoter and

  

35S-F GGGAATTCCATGGAGTCAAAGATTCAAATAGAGGACCTAACAG

PEX-R CCGGATCCTCATAATCATTAGGAGGAGGAGCAGCTGCTTC

  35S-R GCTATTTCATCCTGGGTCATGGTCAAGAGTCCCCCGTGTT DhPEX11 PEX11-F AACACGGGGGACTCTTGACCATGACCCAGGATGAAATAGC PEX11-R CCGGATCCTCATAATCATTAGGAGGAGGAGCAGCTGCTTC (B) Second

  

35S-F GGGAATTCCATGGAGTCAAAGATTCAAATAGAGGACCTAACAG

  35S Pro

  Gene Oligonucleotide sequences 5'-3' (A) First

  

Table 1. Oligonucleotides for cloning CaMV 35S Promoter and DhPEX11-like and splicing CaMV35S Promoter and DhPEX11-like

to generate 35S/DhPEX11

ISSN. 2087-2852

  42 Overlap Extension by PCR for Splicing CaMV 35S Promoter & DhPEX11-Like (Ikawati and Yen)

  PCR recombinant product DNA sequencing

  PCR recombinant product was ligated to be The identity value of alignment results of the cloned into pGEM-T Easy vector and infected to original sequence of 35S/PEX11-like and the

  

E. coli which was spanned on LB-agar medium sequence of 35S/PEX11-like fragment cloned

containing X-gal, IPTG and ampicillin. The white from p-GEM T-easy vector was 98%.

  colonies was the host of transformant vector which was confirmed by PCR. Its reactant were In the experiment, the recombinant PCR run on 1% agarose gel and distinct band of 1051 successfully spliced the 35S-DhPEX11 gene which bp revealed under the UV light (Fig. 3A). It appeared strong expression of transformant. SOE presented the DNA fragment of 35S/PEX11 in the by PCR is rapid because it does not need many transformant plasmid. vector constructions which are a time consuming process. This method is simple and widely

  Confirmed DNA fragments

  applicable approach has significante advantages The expression cassette of 35S/PEX11 that over standard recombinant DNA techniques [4]. released from the pGEM plasmid DNA digested

  Moreover, the recombinant might be amplified with BamHI and HindIII enzymes, the reactant and cloned into expression vector, and it is was run on 1% agarose gel which appeared both readily applied in plant transformation. The 35S 1051 bp fragment and 3 Kb of the vector promoter of cauliflower mosaic virus (CaMV) able backbone (Fig. 3B). The final product that has to confer high-level gene expression in most been amplified by flanking primers also can be organs of transgenic plants [19]. obtained restriction enzymes sites to insert it into an expression vector for cloning step [8].

  

Fig. 3. Gel checking of the DNA fragments inserted into pGEM-T Easy vector. (A) Polymerase chain reaction (PCR) analysis. The

figure showed the expected size of 35S/PEX11 cloned into vector. (B) The constructed 35S/PEX11/pGEM-T was digested by EcoRI and SpeI enzymes for double checked before sequencing, the 1051 bp band and the 3.0 kb band were shown. M: 1-kb DNA markers. C: Constructed 35S/PEX11/pGEM-T.

CONCLUSION REFERENCES

  Recombinant PCR in this study successfully [1] Deo, P.C., A.P. Tyagi, M. Taylor, R. Harding, spliced the 35S-DhPEX11 gene. SOE by PCR did

  D. Becker. 2010. Factors affecting somatic not need many vector constructions thus less embryogenesis and transformation in mo- time consuming. This simple and widely dern plant breeding. Nat. Appl. Sci. 28. 27- applicable method of approach has significante

  40. advantages for standard recombinant DNA. The [2]

  Nelson, M.D., D.H.A. Fitch. 2011. Overlap use on 35S promoter of CaMV confer high-level Extension PCR: an efficient method for gene expression for transgenic plants as in this transgene construction. Method Mol. Biol. study.

  772. 459-470.

  J.Exp. Life Sci. Vol. 5 No. 1, 2015

ISSN. 2087-2852

• –400. [4]

  [17] Hue, L.T. 2010.

  1999. Plant transformation: advances and perspectives Scientia. Agricola. 56. 1-8. [14] de Wilde, C., H. van Houdt, S. de Buck, G.

  Angenon, G. de Jaeger, A. Depicker. 2000. Plants as bioreactors for protein production: avoiding the problem of transgene silencing.

  Plant Mol. Biol. 43. 347-359.

  [15] Ling, M.F., B.H. Robinson. 1995. A one-step polymerase chain reaction site-directed mutagenesis method for large gene- cassettes with high efficiency, yield, and fidelity. Anal. Biochem. 230 (1). 167-172.

  [16] Blattner, F.R. 1999. Direct amplification of the entire ITS region from poorly preserved plant material using recombinant PCR.

  Biotechniques. 27. 1180-1186.

  Characterization of a salt- induced the mitochondrial import inner membrane translocase subunit DhTIM22 gene from the extreme halophilic yeast

  Gruber, M.Y., W.L. Crosby. 1993. Vectors for plant transformation. In: Glick, B.R., J.E.

  Debaryomyces hansenii and its overex-

  pression to enhance yeast tolerance to stresses. Master Thesis. Departement of Bioagricultural, National Chiayi University Science. [18]

  Hu, G. 1993. DNA polymerase-catalyzed addition of nontemplated extra nucleotides to the 3′ end of a DNA fragment. DNA Cell.

  Biol. 12. 763 –770.

  [19] Lam, E., P.N. Benfey, P.M. Gilmartin, R.X.

  Fang, N.H. Chua. 1989. Site-specific muta- tions alter in vitro factor binding and change promoter expression pattern in transgenic plants. Proc. Nati. Acad. Sci. 86. 7890-7894.

  Thompson (Eds). Methods in Plant Molecu- lar Biology and Biotechnology. CRC Press. Florida. 89-119. [13] Alves, A.C., V.M. Quecini, M.L.C. Vieira.

  Sharma. 2007. Transgenic approaches for abiotic stress tolerance in plants: retrospect and prospects. Plant Cell Reports. 27. 411- 424. [12]

  J.Exp. Life Sci. Vol. 5 No. 1, 2015

  Y. Yau, D.W. Ow. 2010. PhiC31 recombi- nation system demonstrates heritable germinal transmission of site-specific excision from the Arabidopsis genome. BMC

  43 Overlap Extension by PCR for Splice CaMV 35S Promoter & DhPEX11-Like (Ikawati and Yen)

  [3] Li,

  X., Y. Qiu, Y. Shen,

  C. Ding, P. Liu, J. Zhou, Z. Ma. 2008. Splicing together different regions of a gene by modified polymerase chain reaction-based site-directed mutage- nesis. Anal. Biochem. 373. 398

  Horton, R.M., H.D. Hunt, S.N. Ho, J.K. Pullen, L.R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77. 61 –68. [5]

  Bradley, R.D., D.M. Hillis. 1997. Recom- binant DNA sequences generated by PCR amplification. Mol. Biol. Evol. 14. 592-593. [6] Thomson, J.G., R. Chan, R. Thilmony, Y.

  Biotech. 10. 1-12.

  Bhatnagar-Mathur, P., V. Vadez, K.K.

  [7] Vallejo, A.N., R.J. Pogulis, L.R. Pease. 2003.

  Mutagenesis and synthesis of novel recom- binant genes using PCR. In: Dieffenbach, C.W., G.S. Dveksler (Eds). PCR Primer A Laboratory Manual. Cold Spring Harbor Laboratory Press. New York. 467-468. [8]

  Heckman, K.L., L.R. Pease. 2007. Gene splicing and mutagenesis by PCR-driven overlap extension. Nature Prot. 2. 924-932.

  [9] Warrens, A.N, M.D. Jones, R.I. Lechle. 1997.

  Splicing by overlap extension by PCR using asymmetric amplification: an improved technique for the generation of hybrid proteins of immunological interest. Gene. 186. 29 –35. [10] Higuchi, R. 1990. Recombinant PCR. In: M.A.

  Innis, D.H. Gelfand, J.J. Sninsky, T.J. White (Eds). PCR Protocols A Guide to Methods and Applications. Academic Press. San Diego. [11]