Analisis Pewarisan Marka Cyca-DAB105

  Jurnal Riset Akuakult ur, 11 (2), 2016, 115-123

Tersedia online di: ht t p://ej ournal-balit bang.kkp.go.id/index.php/j ra

  

PEWARISAN M ARKA Cyca-DAB1*05 DAN KERAGAM AN GENETIK IKAN M AS

( Cyprinus carpio ) STRAIN RAJADANU TAHAN INFEKSI KOI HERPESVIRUS DAN

#

TUM BUH CEPAT

Khairul Syahput ra , Yogi Himawan, Didik Ariyanto, dan Flandrianto Sih Palimirmo

  

Balai Penelitian Pem uliaan Ikan

ABSTRAK

Balai Penelitian Pemuliaan Ikan (BPPI) telah membentuk ikan mas Rajadanu tahan infeksi koi herpesvirus (KHV)

dan tumbuh cepat melalui program seleksi. Ikan mas Rajadanu dihasilkan dari kegiatan seleksi bersamaan

pada karakte r ket ah anan terhadap KHV dan p ertum bu han. Se leksi karakte r ket ah anan terhadap KHV

dilakukan dengan menggunakan marka Cyca-DAB1*05 dan seleksi karakter pertumbuhan cepat dilakukan

dengan metode seleksi individu. Penelitian ini bertujuan untuk mengevaluasi pewarisan marka Cyca-DAB1*05

dan keragaman genotipe ikan mas varietas Rajadanu tahan infeksi KHV dan tumbuh cepat generasi ketiga

(F ). Se banyak 44 ind ividu ikan mas Rajadanu F d igu nakan pada pe nelit ian in i. Evalu asi m arka Cyca-

3 3 DAB1*05 d ilakukan de ngan me tod e PCR m en ggunakan prime r spe sifik m arka Cyca-DAB1*05. An alisis

keragaman genotipe dilakukan menggunakan tiga lokus mikrosatelit (MFW6, MFW7, dan MFW9). Data alel

mikrosatelit dianalisis m enggunakan program Fstat dan Arlequin. Hasil pen elitian menunjukkan bahwa

semua individu pada populasi ikan mas Rajadanu F membawa marka Cyca-DAB1*05. Ikan mas Rajadanu F

3 3

memiliki keragaman genotipe yang relatif rendah. Nilai rata-rata heterozigositas teramati (0,31) lebih kecil

daripad a rata-rata h eterozigosit as harapan (0,46). Nilai p osit if p ada indeks fiksasi (0,32) menu njukkan

status inbreeding pada populasi tersebut. Hasil penelitian ini dapat menjadi acuan, baik dalam kegiatan

manaje men indu k maupun dalam p rogram seleksi selanjut nya dengan t ujuan un tuk memp ertahankan

keragaman genetik dan meminimasi tekanan inbreeding ikan mas Rajadanu tahan infeksi KHV dan tumbuh

ce pat.

  

KATA KUNCI: ikan mas; tahan KHV; tumbuh cepat; Cyca-DAB1*05; mikrosatelit; keragaman genetik

ABSTRACT: Inheritance of Cyca-DAB1*05 marker and genetic variation of Rajadanu strain of common carp

resistant to koi herpesvirus infection and fast growth. By: Khairul Syahputra, Yogi Himawan, Didik Ariyanto, and Flandrianto Sih Palimirmo

  

Research Inst it ut e for Fish Breeding (RIFB) has creat ed Rajadanu common carp resist ant t o koi herpesvirus (KHV)

infect ion and fast growt h t hrough select ion program. Rajadanu common carp has been produced by independent

culling select ion on resist ant t o KHV and fast growt h charact ers. Select ion on resist ant t o KHV and fast growt h

charact er was conduct ed using Cyca-DAB1*05 marker and mass-select ion met hod respect ively. The aim of t his st udy

was t o evaluat e t he inherit ance of Cyca-DAB1*05 as a marker and t he genot ype variat ion of Rajadanu common carp

resist ant t o KHV infect ion and fast growt h. A t ot al of 44 fish were used for t his st udy. Evaluat ion of Cyca-DAB1*05

marker was conduct ed by PCR met hod using specific primer t o Cyca-DAB1*05 marker. Analysis of genot ype variat ion

was conduct ed using t hree microsat ellit e loci (M FW6, M FW7, and M FW9). M icrosat ellit e allele dat a was analyzed

using Fst at and Arlequin software. The result showed t hat all of F Rajadanu common carp were posit ive carrying Cyca-

3 DAB1*05 marker. Genet ic variat ion of t his populat ion was relat ively low. The average obser ved het erozygosit y

(Ho= 0.31) was lower t han t he average expect ed het erozygosit y (He= 0.46). Posit ive value of fixat ion index (0.32)

showed inbreeding st at us in t his populat ion. The result of t his st udy can be use as reference for broodst ock management

and next select ion program t o maint ain the genet ic diversit y and t o minimize inbreeding depression level of Rajadanu

common carp resist ant t o KHV infect ion and fast growt h.

  Common carp; resitant to KHV; fast growth; Cyca-DAB1*05; microsatellite; genetic variation # KEYWORDS: Ko r esp o nd e nsi: Balai Pe n e lit ian Pem u liaan Ikan .

  Jl. Raya 2 Pan t u ra Su kam an d i, Pat o kb e usi, Su b an g 4 1 2 6 3 , Jawa Bar at , In d o n e sia. Te l.: + (0 2 6 0 ) 5 2 0 5 0 0 khai r ul _ syahput r a@ yahoo.com

  E-m ail:

  116

  et al

  (No rris

  et al

  ., 1999; Beaumo nt & Ho are, 2003; Dunham, 2004). Pe n e lit ia n in i b e r t u ju a n u n t u k m e n ge va lu a s i p e w a ris an m ar k a Cyca -DAB1 *0 5 d a n ke r ag a m a n genet ik pada ikan mas Rajadanu t ahan infeksi KHV dan t umbuh cepat generasi F 3 . Evaluasi marka MHC II seb agai m arka ke t ahanan pe nyakit KHV dilaku kan de ngan me t o d e PCR spe sifik u nt u k Cyca-DAB1*0 5. Analisis keragaman genet ik dilakukan dengan aplikasi penanda genet ik DNA mikro sat elit . DNA mikro sat elit merupakan penanda genet ik yang banyak digunakan u n t u k analisis ke ragam an ge n e t ik p ad a ikan m as (Chist iako v & Vo ro no va, 2009), marka genet ik ini dapat d igun akan u nt uk me mo nit o ring p e ru bahan variasi genet ik sebagai ko nsekuensi dari kegiat an pemuliaan yang dilakukan (Brinez et al ., 2011).

  BAHAN DAN M ETODE Ikan Uji

  Ikan uji yang digunakan pada penelit ian ini adalah po pulasi ikan mas Rajadanu t ahan infeksi KHV dan t umbuh cepat gen erasi ket iga (F 3 ) (Himawan

  et al

  ., 2 0 14 ), d e n gan ju m lah ikan u ji se b an yak 4 4 e ko r. Po pulasi ikan mas Rajad anu t ahan infeksi KHV dan t u m b u h ce p at F 3 d ih asilkan d ari ke giat an se le ksi b e r s a m a a n ( i nd ep en d en t cul l i ng ) p a d a k a r a k t e r ket ahanan t erhadap KHV dan t umbuh cepat . Seleksi karakt er ket ahanan t erhadap infeksi KHV dilakukan dengan seleksi individu yang membawa marka Cyca- DAB1*05 (Alimuddin

  ., 2011), sedangkan seleksi karakt er t u m bu h cep at d ilaku kan d e ngan me t o d e s e le k s i in d ivid u . Se le k s i m a r k a Cyca -DAB1 *0 5 d ilakukan p ad a in du k-in d u k yan g t e rse le ksi p ad a karakt er pert umbuhan.

  ., 2004). Selain it u, fakt o r lain yang dapat menurunkan keragaman genetik adalah rekaman silsilah ( pedigree ) yang kurang baik yang akan meningkat kan peluang penggunaan t et ua yan g seke rabat sehin gga akan men ingkat kan

  Sampel sirip eko r yang berukuran sekit ar 1 cm 2 d iamb il d ari set iap ikan u ji d en gan cara d ip o t o n g menggunakan gunt ing

  sect ion

  yang t elah dibersihkan de ngan alko ho l 70%. Sampe l sirip d isim pan d alam t ab u n g m ik ro yan g b e ris i 1 m L alko h o l 7 0 % d an kemudian disimpan pada suhu ruang hingga dilakukan pro ses ekst raksi DNA.

  Ekst raksi DNA

  Ekst raksi DNA dari sampel sirip eko r dilakukan d en gan me nggu nakan kit ko me rsial Ge ne JET DNA Purificat io n Kit (Thermo Scient ific), dengan pro sedur mengikut i pro t o ko l yang t erdapat pada manual kit . Kualit as dan kuant it as DNA diukur menggunakan alat GeneQuant TM 1300. DNA hasil ekst raksi disimpan pada suhu -20°C hingga dilakukan pro ses amplifikasi PCR.

  Analisis Pewarisan M arka Cyca-DAB1*05

  Analisis PCR unt uk det eksi marka Cyca-DAB1*05 pada po pulasi ikan mas Rajadanu F 3 t erkait ket ahanan t erhadap infeksi KHV dilakukan menggunakan primer ya n g d a p a t m e n g a m p lifik a s i a le l Cyca-DAB1 *0 5 (Alimuddin et al ., 2011). Program PCR amplifikasi MHC

  inbreeding depression

  et al

  Pewarisan marka Cyca-DAB1*05 dan keragaman genet ik ikan mas ..... (Khairul Syahputra) PENDAHULUAN

  ., 2011) dan se le ksi karakt e r t u m b u h ce p at d ilaku kan d e n gan met o de seleksi individu. Hasil evaluasi menunjukkan bahwa ikan mas Rajadanu F 3 memiliki perfo rma yang unggul pada karakter ket ahanan t erhadap infeksi KHV dan pert umbuhan (Ariyant o

  Salah satu kendala utama dalam usaha budidaya ikan mas d i Ind o ne sia saat in i adalah t imbu lnya wab ah p e n ya kit

  koi her pesvir us

  (KHV). Pe n yakit in i t e lah me wab ah sejak t ahu n 2 002 (Sunart o

  et al ., 20 05 ).

  Selain penyakit , penurunan laju pert umbuhan akibat ren d ah n ya ku alit as in d uk d an be n ih ju ga m en jad i kendala lain yang menyebabkan penurunan pro duksi ikan mas b u did aya. Dalam ran gka me n an ggu langi permasalahan tersebut , Balai Penelitian Pemuliaan Ikan (BPPI) mempunyai pro gram pem bent ukan ikan mas t ahan t erhadap infeksi KHV dan t umbuh cepat . Pada t ahun 2015, BPPI t elah berhasil membent uk ikan mas Rajadanu tahan infeksi KHV dan t umbuh cepat generasi ket iga (F 3 ) melalui pro gram seleksi. Ikan mas Rajadan u F 3 d ih asilkan d ari ke giat an seleksi bersamaan pada karakt er ket ahanan t erhadap

  KHV dan pert umbuhan. Seleksi karakt er ket ahanan t erhadap KHV dilakukan dengan menggunakan marka mo lekuler Cyca-DAB1*05 (Alimuddin

  et al

  et al ., 2015).

  ., 2004) dan abalo n di Australia (Evans

  Sebagai bagian dari kelanjut an program pemuliaan yan g t e lah dilaku kan , karakt e risasi ge n e t ik p e rlu dilakukan dalam rangka memonit o r st at us keragaman g e n e t ik p o p u las i ya n g t e la h d ih a silk an . Se p e rt i d ik e t a h u i, k e g ia t a n s e le k s i t id a k h a n ya d a p a t memperbaiki karakt er yang diinginkan, namun juga d a p a t m e m ilik i e fe k b u r u k b e r u p a p e n u r u n a n ke ragam an ge n e t ik p o p u lasi. No rris

  et al

  . (1 9 9 9 ) m e n ya t a k a n b a h w a p r o g r a m s e le k s i d a p a t m e n ye bab kan p e n u ru n an ke ragam an ge n e t ik b ila p o p u la s i a t a u fa m ili ya n g d ig u n a k a n m e m ilik i kekerabat an yang dekat dan int ensit as seleksi yang t inggi. Penurunan keragaman genet ik akibat pro gram sele ksi t e rjadi pada p o pulasi budidaya ikan mas di Vie t n a m (Th ai

  et al

  ., 2 0 0 7 ), h asil p e n e lit ian la in menunjukkan bahwa penurunan keragaman genet ik t erjadi pada ikan salmo n At lant ik di Irlandia (No rris

  et al

  ., 1999), salmo n At lant ik di No r wegia (Skala

  et al

  II meliput i: 95°C selama t iga menit ; (95°C selama 30

  Jurnal Riset Akuakult ur, 11 (2), 2016, 115-123

  et al

  versi 3.1 (Excoffier

  et al ., 2006).

  HASIL DAN BAHASAN Analisis M arka Cyca-DAB1*05

  Berdasarkan hasil analisis marka Cyca-DAB1*05 dari 44 eko r sampel yang diperiksa menunjukkan bahwa semua ind ividu ikan mas Rajadanu F 3 t ahan infeksi

  KHV dan t u mb uh cep at me mb awa marka t e rseb ut (Gam b ar 1 ). Pe rs e n t ase t e rs e b u t m e n in g kat d a ri generasi sebelumnya, yait u F 1 (93,30%) dan F 2 (86,44%)

  (Ariyan t o

  et al

  ., 2 0 1 5 ). Pe rse n t ase in d ivid u ya n g membawa marka Cyca-DAB1*05 pada penelit ian ini lebih t inggi dibandingkan dengan ikan mas Majalaya (MANTAP) generasi F 2 , yait u 83,33 % (Sucipt o

  ., 2014).

  Variasi ge net ik dalam dan ant ar ind ividu dianalisis menggunakan AMOVA ( Analysis of M olecular Variance ) yang terdapat pada

  Tabel 1. Sekuen primer yang digunakan unt uk mengamplifikasi marka Cyca- DAB1*05 dan lo kus mikro sat elit po limo rfik pada po pulasi ikan mas Rajadanu F 3 Table 1. Pr im er sequnces used t o ampli ficat ion Cyca-DAB1 *0 5 m ar ker and

  polymorphic microsat ellit e loci in F 3 Raj adanu common carp populat ion Lokus/m arka Locus/mar ker

  M ot if M otif

  

Sekuen prim er (5’-3’)

Primer sequence (5 ’-3 ’)

  Ki saran ukuran Size r ange

  (bp) Tm (°C)

F:CTAATGGATACTACTGG

R:ATCGCTGACTGTCTGTT

  

F: ACCTGATCAATCCCTGGCTC

R:GTTTGGGACTTTTAAATCACGTTG

F: TACTTTGCTCAGGACGGATGC

R:TTTATCACCTGCACATCGCCACTC

F: GATCTGCAAGCATATCTGTCG

R:GTTTATCTGAACCTGCAGCTCCTC

  Cyca-DAB1 *0 5 3 0 0 5 0

MFW6 (CA) n 1 16 -1 66 6 2

  software Arlequin

  soft ware st at ist ika genet ik Fst at versi 2.9.3. (Go udet , 2001).

  det ik; 50°C selama 30 det ik; 72°C selama sat u menit ) sebanyak 30 siklus; dan 72°C selama 10 menit . Hasil amplifikasi PCR diseparasi dengan elekt rofo resis pada gel agaro se 2% yang t elah diberi pewarna GelRed TM

  unt uk mengamplifikasi marka Cyca- DAB1*05 dan t iga lo kus mikro sat elit disajikan pada Tabel 1. Pro ses PCR dilakukan dengan pro gram: 95°C selama lima menit ; (95°C selama 30 det ik; 50°C-62°C s e la m a 9 0 d e t ik s e s u a i d e n g a n d e r a ja t s u h u penempelan (Tm) t iap primer (Tabel 1); 72°C selama 30 de t ik) se ban yak 32 siklus; d an 6 0°C se lam a 30 m e nit .

  (Bio t ium) dan hasil elekt ro fo resis diamat i di bawah lampu UV t ransiluminat o r dan difo t o menggunakan kamera digit al Cano n EOS 1100D.

  Analisis Keragaman Genotipe

  Ke r a g a m a n g e n o t ip e ik a n m a s Ra ja d a n u F 3 dianalisis menggunakan met o de PCR dengan t arget t iga lo ku s m ikro sat e lit , yakn i MHF6 , MFW7 , d an MFW9 . Lo ku s m ikro sat e lit in i d ip ilih b e rd asarkan reko mendasi Yue

  et al

  . (2004) dan Thai

  et al

  . (2007) karena dapat menunjukkan po limo rfisme pada ikan mas Rajadanu. Sekuens primer, kisaran pro duksi PCR dan suhu

  annealing

  Po lim o r fis m e lo k u s m ik r o s a t e lit d i- scr eeni ng dengan menggunakan alat analisis fragmen QIAxcel (Qiagen) dan menggunakan kit

  (HW), dan indeks fiksasi (F IS ) dianalisis menggunakan

  QIAxcel DNA High Reso- lut i on (Qiag e n ), d a n u k u r a n a le l-a le l d it e n t u ka n

  berdasarkan ukuran produk PCR relatif terhadap ukuran fragmen DNA pada QX size marker 50-800 bp (Qiagen). Da t a p o la p it a d a n e le k t r o fo r e g r a m d ia n a lis is menggunakan

  soft ware QIAxcel Screening gel

  (Qiagen) unt uk mensko r alel-alel yang muncul. Dat a sko r alel kemudian digunakan unt uk analisis paramet er genetik yang relevan.

  Analisis Dat a

  Hasil det eksi marka Cyca-DAB1*05 pada po pulasi ikan mas Rajadanu tahan infeksi KHV dan t umbuh cepat F 3 dit ampilkan dalam bent uk gambar elekt ro fo regram dan dianalisis secara deskript if. Dat a alel mikro sat elit yang teramat i dio lah menggunakan program M icrosoft

  Excel

  . Paramet er variabilit as geno t ipe meliput i jumlah alel (A), frekuensi alel, het ero zigo sit as t eramat i (Ho ) dan harapan (He),

  Hardy-Weinberg equilibrium

  

MFW7 (CA) n 1 98 -2 22 6 3

MFW9 (CA) n 8 8 -1 7 8 6 0

  118

  ., 1999). Meskipun t erjadi reduksi jumlah alel, akan t et api met o de seleksi yang digunakan pada pembent ukan ikan mas Rajadanu F 3 t ahan KHV dan t umbuh cepat dapat mengendalikan penurunan jumlah alel pada t iap generasi.

  400 bp 300 bp 200 bp 400 bp 300 bp 200 bp 400 bp 300 bp 200 bp 400 bp

  M + 34 35 36 37 38 39 40 41 42 43 44 -

  M + 1 2 3 4 5 6 7 8 9 10 11 - M + 12 13 14 15 16 17 18 19 20 21 22 - M + 23 24 25 26 27 28 29 30 31 32 33 -

  Elect ropherogram of Cyca-DAB1*05 marker analysis in F 3 Raj adanu common carp resist ant t o KHV inf ect ion and fast gr ow t h. M = DNA mar ker ladder ; (+ )= posi t ive cont r ol; (-)= negat ive cont rol; 1-44= F 3 Raj adanu common carp samples

  ) di Viet nam dari t iga lo kus mikro sat elit MFW6, MFW7, dan MFW9, sedangkan Biba et al . (2015) m e la p o r k a n b a h w a d a r i t ig a lo k u s ya n g s a m a t erident ifikasi 25,33 alel unt uk rat a-rat a jumlah pada p o p u la s i ik a n m a s d i Da n a u Sh k o d r a , Alb a n ia . Gambar 1. Elekt ro fero gram hasil analisis marka Cyca-DAB1*05 pada ket urunan ket iga (F 3 ) ikan mas Rajadanu t ahan infeksi KHV dan t umbuh cepat (M= marka DNA; (+ )= ko nt ro l po sit if; (-)= ko nt ro l negat if; 1-44= sampel ikan mas Rajadanu F 3 ) Figure 1.

  Indonesian yellow carp

  . (2007) melapo rkan bahwa sebanyak 4,33 rat a-rata jumlah alel t erid en t ifikasi pada ikan m as Sinyo n ya (

  et al

  Rat a-rat a ju mlah ale l yan g t erid e nt ifikasi pad a p e n e lit ian in i le b ih se d ikit d ib a n d in gkan d e n gan penelit ian lainnya pada ikan mas. Thai

  et al

  Pewarisan marka Cyca-DAB1*05 dan keragaman genet ik ikan mas ..... (Khairul Syahputra)

  2015). Berkurangnya jumlah alel dapat disebabkan oleh kegiat an seleksi yang dilakukan, ket erbat asan jumlah induk yang digunakan dalam pembent ukan po pulasi seleksi menyebabkan alel-alel dengan frekuensi rendah t idak diwariskan (No rris

  penelitian ini dapat mengamplifikasi dan menghasilkan lo kus mikro sat elit yang polimo rfik pada po pulasi ikan mas Rajadanu F 3 . To t al sebanyak 12 alel yang berbeda t erident ifikasi dari ketiga lo kus yang dianalisis dengan k is a r a n p a n ja n g a le l 8 8 -2 2 2 b p . Lo k u s MFW 6 merupakan lo kus yang paling bervariasi dengan jumlah alel enam, diikut i o leh lo kus MFW9 dengan empat alel, sedangkan lo kus MFW7 merupakan lo kus yang p alin g re nd ah variasin ya d e ngan ju mlah alel yan g t erident ifikasi sebanyak dua (Tabel 2). Rata-rat a jumlah alel t iap lo kus adalah empat alel, rat a-rat a jumlah alel ini lebih sedikit dibandingkan dengan rat a-rata jumlah alel yang t erident ifikasi pada generasi sebe lumnya, yait u 4,3 alel pada F 1 dan 3,7 pada F 2 (Ariyant o et al .,

  Variasi Genotipe Ikan M as Rajadanu F 3 Ket iga primer mikro sat elit yang digunakan pada

  ., 2011), sehingga marka ini dapat d igu nakan dalam kegiat an seleksi u nt u k m e m be n t uk ikan mas Rajadan u t ah an KHV. Mark a Cyca-DAB1 *0 5 ju ga t e lah d ig u n a kan p a d a kegiat an seleksi ikan mas Majalaya (MANTAP) t ahan KHV (Sucipt o et al ., 2014).

  et al

  ., 2009; Alimuddin

  et al

  . (2015) melapo rkan bahwa ikan mas Rajadanu F 3 memiliki sint asan 95,00% dan lebih baik dibandingkan dengan ikan mas Majalaya dari Unit Pembenihan Rakyat (UPR) set elah uji t ant ang dengan KHV pada skala labo rat o ium. Nilai sint asan yang t inggi p ad a ge n e rasi F 3 ju ga d it u n ju kka n p ad a ge n e rasi sebelumnya, yaitu 93,33% pada F 1 dan 94,44% pada F 2 . Marka Cyca-DAB1 *0 5 m erup akan marka m o lekuler ke t ah an an t e rh ad ap p e nyakit KHV p ad a ikan m as (Rakus

  et al

  Peningkat an persentase ikan mas Rajadanu F 3 yang m e m bawa m arka Cyca-DAB1 *0 5 b e rban d in g lu ru s dengan peningkat an ket ahanannya t erhadap infeksi KHV. Ariyant o

  300 bp 200 bp

  Jurnal Riset Akuakult ur, 11 (2), 2016, 115-123

  Tabel 2. Variabilit as genet ik dari t iga lo kus mikro sat elit pada ikan mas t ahan infeksi KHV dan t umbuh cepat generasi F 3 Genet ic variabilit y of t hree microsat ellit e loci in F Raj adanu common Table 2. 3

  carp resist ant t o KHV and fast growt h Populasi F 3 Lokus Param et er

  Loci Parameters F population 3 Kisar an p an jan g alel ( Alelle size range ) (bp ) 1 1 6 -1 6 6 Ju mlah samp el ( Number of sample ) (N) 4 1 Ju mlah alel (A) ( Number of alelle )

  6 MFW6 Hetero zig o sitas ter amati ( Observed heterozygosit y ) (Ho) 0.2 2 Hetero zig o sitas h ar ap an ( Expect ed heterozygosit y ) (He) 0.4 8 In d eks fiksasi ( Fixat ion index ) (Fis) 0.5 4 Nilai p Hard y-weinb erg ( p value Hardy-Weinberg ) (HW) Kisar an p an jan g alel ( Alelle size range ) (bp ) 1 9 8 -2 2 2 Ju mlah samp el ( Number of sample ) (N) 4 4 Ju mlah alel (A) ( Number of alelle )

  2 MFW7 Hetero zig o sitas ter amati ( ) (Ho) 0.4 1 Observed heterozygosit y

  Hetero zig o sitas h ar ap an ( Expect ed heterozygosit y ) (He) 0.4 8 In d eks fiksasi ( ) (Fis) 0.1 5 Fixat ion index

  Nilai p Hard y-weinb erg ( p value Hardy-Weinberg ) (HW) 0 .3 4 9 Kisar an p an jan g alel ( ) (bp ) 8 8-1 78

Alelle size range

  Ju mlah samp el ( Number of sample ) (N) 4 3 Ju mlah alel (A) ( )

  4 Number of alelle MFW9 Hetero zig o sitas ter amati ( Observed heterozygosit y ) (Ho) 0 .3 Hetero zig o sitas h ar ap an ( Expect ed heterozygosit y ) (He) 0.4 1 In d eks fiksasi ( Fixat ion index ) (Fis) 0.2 7 Nilai p Hard y-weinb erg ( ) (HW) 0 .0 1 2 p value Hardy-Weinberg

  Ju mlah alel (A) ( Number of alelle ) (N)

  4 Rata-rata Hetero zig o sitas ter amati ( Observed heterozygosit y ) (Ho) 0.3 1 Average

  Hetero zig o sitas h ar ap an ( Expect ed heterozygosit y ) (He) 0.4 6 In d eks fiksasi ( Fixat ion index ) (Fis) 0.3 2

  Perbedaan jumlah alel yang t eramat i pada penelit ian dit emukan beberapa alel jarang at au alel dengan nilai

  et

  ini d ib an din gkan d e ngan p e n elit ian lain n ya d apat frekuensi alel lebih kecil dari 5% (Co le, 2005; Hale

  al

  dipengaruhi o leh perbedaan met o de dan st rain ikan ., 2012). Tiga alel jarang t eramat i pada lo kus MFW6 mas yang diuji, dan perbedaan jenis populasi yang diuji. dan dua alel pada lokus MFW9. Alel 116, 128, dan 136

  Indonesian yellow carp

  Po pulasi ikan m as Sinyo n ya ( ) merupakan alel jarang yang teramati pada lo kus MFW6, merupakan po pulasi ikan mas hasil pro gram seleksi alel 138 dan 178 merupakan alel jarang pada lo kus

  et al

  di Viet nam (Thai ., 2007), sedangkan ikan mas di MFW9. Alel jarang t idak dit emukan pada lo kus MFW7 Danau Shkodra, Albania merupakan po pulasi ikan mas (Gambar 2).

  et al t ipe liar (Biba ., 2015).

  Nila i h e t e r o z ig o s it a s m e n u n ju k k a n s t a t u s Freku e n si alel yang t e ram at i d ari ke t iga lo ku s keragam an genet ik ikan mas Rajadanu F . Po p ulasi 3 menunjukkan st rukt ur genot ipe dari populasi ikan mas ik a n m a s Ra ja d a n u F m e m ilik i n ila i r a t a -r a t a 3 Rajadanu F . Pada lo kus MFW6 t eridentifikasi sat u alel h e t e r o z ig o s it a s t e r a m a t i (Ho ) 0 , 3 1 d a n 3 yang do minan dari alel lainnya dengan frekuensi pal- h e t e r o z ig o s it a s h a r a p a n (He ) 0 ,4 6 . De fis it ing tinggi (0,71), yaitu alel 152. Sat u alel yang dominan het ero zigo sit as t erident ifikasi pada penelit ian ini, hal juga t erident ifikasi pada lo kus MFW9 yait u alel 122 ini dit unju kkan de ngan nilai Ho po pulasi ikan mas dengan frekuensi alel 0,73. Selain alel dengan frekuensi Rajadanu F lebih kecil dari He baik pada t iap lo kus 3 yang t inggi, pada po pulasi ikan mas Rajadanu F juga maupun dalam po pulasi. Dua dari t iga lo kus yang diuji 3

  120

  Alel ( Allele )

  0.1

  0.2

  0.3

  0.4

  0.5

  0.6

  0.7

  0.8 88 122 138 178

  F re k u e n si a le l ( A ll el e fr eq u en ce s )

  MFW9

  )

  0.1

  0.2

  0.3

  0.4

  0.5

  0.6

  0.7

  0.8 198 222

  F re k u e n si a le l ( A ll el e fr eq u en ce s )

  MFW6

  Allele

  Pewarisan marka Cyca-DAB1*05 dan keragaman genet ik ikan mas ..... (Khairul Syahputra)

  Number of allele and dist ribut ion of allele frequencies on each microsat ellit e loci M FW6, M FW7, and M FW9 in F 3 Raj adanu common carp resist ant t o KHV and fast growt h

  menunjukkan adanya deviasi t erhadap keset imbangan Hard y-We inb e rg (P< 0 ,0 5), yait u lo ku s MFW6 d an MFW9. Hasil ini mengindikasikan bahwa keragaman genot ipe ikan mas Rajadanu F 3 relatif rendah. Meskipun m e m ilik i k e r a g a m a n g e n o t ip e r e n d a h , n a m u n se b alikn ya ikan m as Rajadan u F 3 m e m iliki variasi fe n o t ip e p e r t u m b u h a n yan g le b ih t in ggi. Ha l in i dit unjukkan d engan nilai ko e fisie n variasi karakt er bo bot ikan mas Rajadanu F 3 sebesar 60,94% (Himawan

  et al

  ., 2014). Oleh karena it u, dapat dikat akan bahwa lo kus mikro sat elit yang digunakan pada penelit ian ini t idak berhubungan dengan variasi pert umbuhan ikan mas Rajadanu F 3 .

  Het ero zigo sit as pent ing bagi suat u po pulasi baik ikan budidaya maupun ikan liar karena heterozigo sitas akan me mb erikan gen o t ipe d engan sp ekt rum lu as sebagai bent uk respo ns adapt if t erhadap perubahan lin g k u n g a n . Um u m n ya , in d ivid u -in d ivid u ya n g h et ero zigo t leb ih su p erio r d aripad a in d ivid u yan g ku ra n g h e t e r o zigo t p ad a b e r b agai k arakt e r yan g b e rn ilai e ko n o m is p e n t in g s e p e rt i p e rt u m b u h an , fert ilit as, dan ket ahanan penyakit (Beardmo re

  et al

  ., 1997; Ho sseinnia

  et al ., 2014).

  Nilai het ero zigo sit as po pulasi ikan mas Rajadanu F 3 relat if lebih rendah jika dibandingkan dengan nilai het erozigosit as t eramat i pada sembilan jenis ikan mas

  Gambar 2. Jumlah alel dan dist ribusi frekuensi alel pada po pulasi F 3 ikan mas Rajadanu t ahan infeksi KHV dan t umbuh cepat dari t iap lo kus mikro sat elit MFW6, MFW7, dan MFW9 Figure 2.

  0.1

  Alel (

  0.2

  0.3

  0.4

  0.5

  0.6

  0.7

  0.8 116 128 136 142 152 166

  F re k u e n si a le l

  A ll el e fr eq u en ce s

  Ale l ( Allele ) MFW7

  Jurnal Riset Akuakult ur, 11 (2), 2016, 115-123

  Sour ce of var iations Jum lah kuadrat

  inbreeding

  teramat i pada po pulasi t ersebut . Ikan mas Rajadanu F 3 t idak me nunjukkan penurunan keragaman genet ik dibandingkan dengan generasi sebelumnya. Variasi genet ik dalam individu m e m b e rikan ko n t r ib u si t e rb e sa r d ib a n d in ga n kan variasi genet ik ant ar individu t erhadap variasi genet ik ikan mas Rajadanu F 3 .

  UCAPAN TERIM A KASIH

  Penelit ian ini dibiayai o leh Anggaran Pendapat an dan Belanja Negara (APBN) melalui DIPA Tahun Anggaran Tabel 3. AMOVA (

  Analysis of M olecular Variance

  ) ikan mas Rajadanu t ahan infeksi KHV dan t umbuh cepat generasi F 3 Table 3.

  AM OVA (Analysis of M olecular Variance) of F 3 Raj adanu common carp resis- t ant t o KHV and fast growt h Sum ber keragam an

  Sum of squares Kom ponen ragam

  dari t et ua hingga generasi ket iga.

  Variation components Persent ase ragam

  Per centage of variations An tar ind ivid u Among individuals

  3 7 .7 1 0 .2 2 3 2 .2 7 Dalam in d ivid u W it hin individuals

  2 0 .0 0 0 .4 7 6 7 .7 3 Tot al (

  Total )

  57.71

  0.69

  Ik an m as Rajad an u F 3 m e m b awa m ar ka Cyca- DAB1*05 dengan persentase 100%. Keragaman genetik ik a n m a s Ra ja d a n u F 3 r e la t if r e n d a h , d e fis it het erozigo sitas, dan

  level inbreeding

  do mest ikasi di Indo nesia yang dilapo rkan o leh Aliah & Taniguchi (1999), yait u berkisar ant ara 0,44-0,74. Namun, jika dibandingkan dengan t et uanya, ikan mas Rajad a n u F 3 t id ak m e n u n ju k ka n a d an ya r e d u ks i het ero zigo sit as sebagai akibat kegiat an seleksi yang dilakukan. Ariyant o

  . , 2 0 1 5 ). Pr o g r a m d a n m e t o d e s e le k s i ya n g d igu n akan p ad a kegiat an p e mb e n t u kan ikan m as Rajadanu tahan infeksi KHV dan t umbuh cepat mampu mengendalikan t ingkat keragaman genet ik dan

  et al

  Meskipun keragaman genet iknya relat if rend ah, ikan mas Rajadanu F 3 memiliki perfo rma yang relat if lebih baik pada karakt er ket ahanan t erhadap infeksi KHV dan pert umbuhan dibandingkan dengan ko nt ro l dan ikan mas yang beredar di masyarakat (Ariyant o

  Berdasarkan hasil analisis variasi genet ik dengan AMOVA, variasi genet ik dalam individu memberikan kont ribusi t erbesar dibandingkan variasi genet ik antar individu t erhadap variasi genet ik ikan mas Rajadanu F 3 . Pada Tabel 3 menunjukkan bahwa variasi genet ik d a la m in d ivid u m e m b e r ik a n k o n t rib u s i 6 7 ,7 3 %; s e d a n g ka n va r ias i ge n e t ik an t a r in d ivid u h an ya memberikan ko nt ribusi sebesar 32,27%.

  et al

  . (2014) melapo rkan bahwa h e t e ro zigo sit as p o pu lasi ikan m as Rajad an u yan g dianalisis menggunakan met o de RAPD adalah 0,274. Po pulasi t ersebut digunakan sebagai t et ua (P) unt uk kegiat an pembent ukan ikan mas Rajadanu t ahan KHV dan t umbuh cepat. Rendahnya keragaman genetik ikan mas Rajadanu F 3 tidak disebabkan o leh met ode seleksi yang dilakukan, akan t et api lebih disebabkan karena penggunaan jumlah induk at au t et ua yang terbat as dan memiliki keragaman genet ik yang rendah. Induk t et ua yang digunakan merupakan po pulasi

  survivor

  terhadap serangan virus KHV dan t erseleksi berdasarkan marka Cyca-DAB1*05. Jumlah induk ikan mas yang digunakan sebagai t et ua unt uk membent uk ikan mas Rajadanu F 3 berjumlah 55 eko r yang t erdiri at as 30 eko r induk betina dan 25 ekor induk jant an (Ariyanto et al ., 2013). Pembent ukan populasi seleksi ikan mas Rajadanu tahan KHV d a n t u m b u h ce p at m e n gacu p a d a p r o t o k o l pemuliaan ikan mas, pembent ukan po pulasi seleksi dilakukan dengan pemijahan 30 pasang dan met o de pe rsilan gan

KESIM PULAN

  po pulasi tersebut. Pada Tabel 2 menunjukkan bah wa nilai Fis po p ulasi adalah 0,32; lo kus MFW6 memberikan nilai Fis t erbesar dan diikut i o leh lo kus MFW 9 d a n MFW 7 . Nila i Fis ya n g p o s it if mengindikasikan

  Defisit het ero zigo sit as yang t erjadi pada po pulasi ikan mas Rajadanu F 3 berkorelasi t erhadap nilai indeks fiksasi ( fixat ion index , Fis) yang menunjukkan st at us

  et al ., 2015).

  d ilaku kan un t uk me mb ent uk po pulasi F 1 , F 2 , dan F 3 (Ariyant o

  backcross

  level inbreeding

  dari po pulasi ikan mas Rajadanu F 3 . Nilai Fis berkisar ant ara -1 dan + 1, nilai positif pada Fis mengindikasikan

  inbreeding

  sedangkan nilai negat if men gind ikasikan out breeding (Keller & Waller, 2002; Vlaeva & Lukano va, 2015).

  breeding

  122

  M olecular Bi- ology Research Communicat ions

  midae ).

  Aquacult ure , 233, 109-127.

  Exco ffier, L., Laval, G., & Schneider, S. (2006). Arlequin ver. 3.0: An int egrat ed so ft ware package fo r po pu- la t io n g e n e t ic s d a t a a n a lys is .

  Evol u t i ona r y Bioinformat ics Online

  , 1, 47-50. Go udet , J. (2001). FSTAT, a pro gram t o est imat e and t est gene diversit ies and fixat io n indices (versio n

  2 . 9 . 3 ). In s t it u t e o f Ec o lo g y, Un ive r s it y o f Lau sann e, Swit zerland . h t t p://www.un il.ch/izea/ so ft ware/fst at .h t ml.

  Hale, M.L., Burg, T.M., & St eeve s, T.E. (2012 ). Sam- pling fo r micro sat ellit e based po pulat io n genet ic st udies: 25 t o 30 individ uals pe r p o pu lat io n is eno ugh t o accurat ely est imat e allele frequencies.

  PLoS One , 7(9), e45170.

  Himawan , Y., Syah put ra, K., & Ariyant o , D. (20 14 ).

  Evaluasi dan uji performa benih ikan mas Rajadanu t ah an KHV d an t u mb uh ce pat gen erasi ke t iga. Lapo ran Teknis Hasil Penelit ian BPPI t ahun 2014. Sukamandi, 26 hlm. Ho sseinnia, Z., Shabany, A., & Ko langi-Miandare, H.

  (2014). Co mpariso n o f genet ic variat io n o f wild and farmed Bream (

  Abramis brama orient alis; berg, 1995

  ) using micro sat ellit e markers.

  , 3(3), 187-195. Keller, L.F., & Waller, D.M. (2002). Inbreeding effect s in wild po pulat io ns.

  Oxfordshire , 115 pp.

  Trends in Ecology and Evolu- t ion , 17, 230-241.

  No rris, A.T., Bradley, D.G., & Cunningham, E.P. (1999).

  Micro s at e llit e ge n e t ic variat io n b e t we e n a n d wit hin farme d an d wild At lant ic salm o n (

  Salmo salar

  ) po pulat io ns.

  Aquacult ure , 180, 247-264.

  Raku s, K.L., Wiege rt je s, G.F., Ad ame k, M., Siwicki, A.K., Lepa, A., & Irnazaro w, I. (2009). Resist ance o f co mmo n carp (

  Cyprinus carpio

  L.) t o Cyprinid herpesvirus-3 is in flue nced by majo r hist o co m- pat ibilit y (MH) class II B gene po lymo rphism.

  Fish & Shellfish Immunology

  , 26, 737-743. Skala, O., Ho yheim, B., Glo ver, K., & Dahle, G. (2004).

  Micro sat ellit e analysis in do mest icat ed and wild At lant ic salmo n (

  Salmo salar

  L.): allelic diversit y and ident ificat io n o f individuals. Aquacult ure , 240, 131-143. Sucipt o , A., Faridah, N., Mundayana, Y., Haniyant i, D.,

  Evans, B., Bart let t , J., Swe ijd, N., Co o k, P., & Ellio t , N.G. (2 0 0 4 ). Lo s s o f g e n e t ic va r ia t io n a t micro sat ellit e lo ci in hat cher y pro duced abalo ne in Australia ( Haliot is rubra ) and So uth Africa ( Haliot is

  Dunham, A.R. (2004). Aquacult ure and fisheries bio - t echno lo gy genet ic appro aches. CABI Publishing,

  Pewarisan marka Cyca-DAB1*05 dan keragaman genet ik ikan mas ..... (Khairul Syahputra)

  J. Ris. Akuakult ur , 9(2), 215-228.

  2014 di Balai Penelit ian Pemuliaan Ikan, Sukamandi. Terima kasih disampaikan kepada semua t eknisi yang t elah membant u dalam kegiat an penelit ian ini. Terima kasih juga disampaikan kepada dewan redaksi unt uk se m u a sa ra n , m as u k an , d a n p e rb aika n t e rh ad ap makalah ini.

  DAFTAR ACUAN

  Aliah, R.S., & Tan iguch i, N. (19 99 ). Co mp ariso n o f ge net ic variabilit y in n in e d o me st icat ed st o cks of Indonesian commo n carp by using microsat ellite DNA markers.

  Fish Genet ics and Breeding Science, 28, 121-130.

  Alimuddin, Mubinun, Sant ika, A., Charman, O., Faizal, I., & Sumant adinat a. K. (2011). Ident ificat io n o f Majalaya co mmo n carp st rains resist ant t o KHV infect io n using Cyca-DAB1*05 allele as t he marker.

  Indonesian Aquacult ure Journal, 6(2), 157-163.

  Ariyan t o , D., Hayu n in g t yas, E.P., & Syah p u t ra, K.

  (2 0 1 3 ). Pe n in g k a t a n m u t u g e n e t ik k a r a k t e r p e rt u m b u h an ikan m as r ajad an u h asil se le ksi gen erasi ke -0 (G-0).

  M akalah disampaikan pada Seminar Hasil Penelit ian . Balai Penelit ian Pemuliaan

  Ikan, Sukamandi. Ariyan t o , D., Hayu n in g t yas, E.P., & Syah p u t ra, K.

  (2014). Ko leksi, karakt erisasi, dan seleksi plasma nut fah ikan mas (

  Cyprinus carpio

  ) t ahan penyakit ko i herpes virus.

  Ariyan t o , D., Syahp ut ra K., & Him awan , Y. (20 1 5).

  Populus t remuloides ). New Phyt ologist , 167, 155-164.

  Naskah akademik pelepasan variet as unggul ikan m as Rajad an u t ah an p en yakit ko i h e rp e sviru s (KHV). Balai Penelit ian Pemuliaan Ikan. Sukamandi, 90 hlm. Bib a, A., Ho da, A., Vardh am i, E., & Bo zg, V. 20 15 .

  Genet ic diversit y o f co mmo n carp fro m Shko dra Lake based o n m icro sat ellit e markers.

  Livest ock Research for Rural Development , 27(4), 1-4.

  Be a rd m o re , J.A., Mair, G.C., & Le wis , R.I. (1 9 9 7 ).

  Bio d ive rsit y in a q u at ic syst e m s in re lat io n t o aquacult ure.

  Aquac. Res ., 28, 829-839.

  Beaumo nt , R.A., & Ho are, K. (2003). Bio t echno lo gy and genet ics in fisheries and aquaculture. Blackwell Publishing, Oxfo rd. Brinez, B.R., Carab allo , X.l., & Salazar, M.V. (201 1).

  Genet ic diversit y o f six po pulat io ns o f red hybrid t ilapia, using micro sat ellit es genet ic markers.

  Rev. M VZ Cordoba , 16(2), 2491-2498.

  Chist iako v, D.A., & Vo ro n o va, N.V. (2 00 9). Ge ne t ic evo lut io n and diversit y o f co mmo n carp

  Cyprinus carpio

  L.

  Cent . Eur. J. Biol ., 4(3), 304-312.

  Co le, C.T. (2005). Allelic and po pulat io n variat io n o f micro sat ellit e lo ci in aspen (

  Santika, A., Mawardi, M., Handayani, D.I., Prayo ga, T., Pur want o , J., Juanda, T., & Dimyat i, A. (2014).

  Jurnal Riset Akuakult ur, 11 (2), 2016, 115-123

  Nas k a h a k ad e m ik ik a n m a s ( Cypr i nus car pi o ) Majalaya t ahan p enyakit . Balai Be sar Perikan an Budidaya Air Tawar. Sukabumi, 38 hlm.

  Sun art o , A., Tau khid, Ru kyani, A., Ko e sh ar yan i, I., Su p r iya d i, H. , Ga r d e n ia , L. , Hu m in t o , H. , Agungpriyo no , D.R., Pasaribu, F.H., Herdikiawan,

  D., Rukmo no , D., & Prayit no , B. (2005). Field in- vest igatio ns o n a serio us disease o ut break amo ng ko i and co mmo n carp (

  Cyprinus carpio

  ) in Indo ne- sia. In Walker, P., Lest er, R., & Bo ndad-Reant aso , M.G. (Eds.).

  Diseases in Asian Aquacult ure V

  , p. 125- 13 5. Fish Healt h Se ct io n , Asian Fishe ries So ci- et y, Manila.

  Thai, B.T., Burridge C.P., & Aust in, C.M. (2007). Ge- net ic diversit y o f co mmo n carp (

  Cypr inus carpio L.) in Viet nam using fo ur micro satellit e lo ci.

  Aquac- ult ure , 269, 174-186.

  Vlaeva, R., & Lukano va, N. (2015). DNA micro sat ellit e analysis o f t he t ho ro ughbred ho rse po pulat io n in Bulgaria. Genet ic relat io nships bet ween t he st ud- ied sirelines.

  Trakia Journal of Sciences

  , 13(1), 83- 87. Yue , G.H., Ho , M.Y., Orban, L., & Ko me n, J. (200 4).

  Micro sat ellit es wit hin genes and ESTs o f co mmo n carp and t heir applicabilit y in silver crucian carp.

  Aquacult ure , 234, 85-98.

Dokumen yang terkait

Dokumen baru