Directory UMM :Data Elmu:jurnal:B:Biochemical Systematics and Ecology:Vol28.Issue10.Dec2000:
Biochemical Systematics and Ecology 28 (2000) 963}973
Molecular characterization and mitochondrial
sequence variation in two sympatric species
of Proechimys (Rodentia: Echimyidae)
in French Guiana
Cynthia Steiner, Patricia Sourrouille, Franc7 ois Catze#is*
Laboratoire de Pale& ontologie, Pale& obiologie & Phyloge& nie, Universite& Montpellier 2, Institut des Sciences de
l'Evolution, UMR 5554 CNRS, Case Courrier 064, 34095 Montpellier cedex, France
Received 13 December 1999; accepted 26 January 2000
Abstract
Variations in mitochondrial DNA characters were used to characterize two morphologically
similar and sympatric species of Neotropical terrestrial rodents of the genus Proechimys
(Mammalia: Echimyidae). We sequenced both cytochrome b (1140 pb) and part of the control
region (445 pb) from four individuals of P. cuvieri and "ve of P. cayennensis from French
Guiana, which allowed us to depict intra- and inter-speci"c patterns of variation. The
phylogenetic relationships between the nine sequences evidence the monophyly of each species,
and illustrate that more polymorphism might exist within P. cuvieri than within P. cayennensis.
By developing species-speci"c primers to amplify a fragment of the cytochrome b gene, we were
able to identify 50 individuals of Proechimys spp. caught in two localities of French Guiana. In
both sites of primary rainforests, we showed that the two species live in syntopy, and this
observation emphasizes the need to document ecological di!erences which should exist in order
to diminish inter-speci"c competition. ( 2000 Elsevier Science Ltd. All rights reserved.
Keywords: Proechimys; Cytochrome b; Control region; Species identi"cation; Syntopy; French Guiana
1. Introduction
The spiny rats of the genus Proechimys (Echimyidae: Rodentia) are generally the
most abundant and widely distributed rodents in Neotropical forests, representing at
* Corresponding author. Fax: #33-4-6714-3610.
E-mail address: [email protected] (F. Catze#is).
0305-1978/00/$ - see front matter ( 2000 Elsevier Science Ltd. All rights reserved.
PII: S 0 3 0 5 - 1 9 7 8 ( 0 0 ) 0 0 0 2 1 - 1
964
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
least 23 species (Wood, in Wilson and Reeder, 1993). Their distribution extends from
Honduras to Paraguay, where they inhabit tropical and subtropical forested habitats.
In contrast to most other echimyids, all species of this diverse genus are terrestrial,
with elongated head and long rostra, large and erect ears, and narrow and long hind
feet. The tail is always shorter than the head-and-body length, the dorsal fur is
composed of a mixture of soft hairs and expanded, varyingly sti!ened spines. The
dorsal and lateral color is generally reddish brown and the belly is usually white
(Emmons and Feer, 1990).
Our limited knowledge of the taxonomy and systematics of Proechimys stands in
contrast to their abundance in all lowland forest types. Two to "ve species might be
sympatric at a single locality, may even occupy the same burrows (Emmons, 1982;
Patton et al., 1999). To identify the species from living animals and de"ne species
boundaries has often proven extremely di$cult as a consequence of the polymorphism of external characters due to geographic and non-geographic variation. The
latter includes sexual dimorphism (rarely) and especially age-related changes (Patton
and Rogers, 1983; Lara et al., 1992). Even karyotypes, which have proven useful in
di!erentiating sympatric taxa, may be highly variable geographically at intra- and
inter-speci"c levels (Gardner and Emmons, 1984; Aguilera et al., 1995).
Only a few studies have succeeded in documenting and describing sympatric
entities over large geographic areas (e.g. Patton and Gardner, 1972; Gardner and
Emmons, 1984; Patton, 1987; Patton et al., 2000). In French Guiana, before 1978, only
one species of Proechimys was recognized ("P. guyannensis), with a strong morphological variation. Petter's (1978) work in this country, at the same time as Husson
in Suriname, showed the presence of two morphological species: a larger one
(P. cuvieri Petter, 1978; unfortunately called P. guyannensis E. Geo!roy, 1803 by
Husson, 1978) and a smaller one (P. guyannensis E. Geo!roy, 1803 sensu Petter; called
P. warreni Thomas, 1905 by Husson, 1978). Subsequent studies by Guillotin (1982),
Guillotin and Ponge (1984), Voss and Emmons (1996) and Ringuet (1998) documented
the sympatry of these two species in French Guiana.
Currently, external morphological characters proposed by taxonomic studies are
not su$cient for identifying living individuals of many species of Proechimys in the
"eld (Voss and Emmons, 1996), such as in the case of P. cuvieri and P. cayennensis in
French Guiana. Subadult and adult males can be recognized by palpation of the
phallus, since P. cuvieri has a much broader, shorter, and massive baculum than
P. cayennensis, in which this bone is long and narrow (Patton and Gardner, 1972;
Patton, 1987). But other external characters are largely ovelapping in French Guianan
samples of P. cuvieri and P. cayennensis (Petter, 1978), thus rendering the "eld
identi"cation very di$cult. Thus, a molecular or biochemical technique making use of
a small biopsy might be desirable for discriminating each species without killing
animals. We have considered analysing molecular sequences of mitochondrial DNA
based on the premises that such genetic data are of great help in the discrimination of
local species of Neotropical mammals (da Silva and Patton, 1993; Mustrangi and
Patton, 1997; Patton et al., 2000). In this paper we examine the phylogenetic relationships among French Guianan specimens of Proechimys cuvieri Petter, 1978 and
P. cayennensis Desmaret, 1817 ("P. guyannensis E. Geo!roy, 1803) based on the
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
965
analyses of cytochrome b and of the control region mitochondrial sequences. Then, we
show that a molecular discrimination of these two sympatric species in French
Guiana is possible without killing the individuals for skull and teeth measurements.
This method will allow one to carry out ecological studies for understanding resource
competition, space distribution (home range) and dispersing behavior in di!erent
habitats, for each of these similar species. To understand the particular ecology of
each sympatric species of Proechimys is a prerequisite for assessing their role in
ecosystem regeneration (Forget, 1989, 1991; Forget and Sabatier, 1997). Indeed,
terrestrial spiny rats take a large part in seed-removal and in seed scatterhoard for
later consumption. Despite high predation on caches, some seeds survive and germinate, and Proechimys spp. are thus important for a reliable and e!ective seed dispersal.
2. Materials and methods
The complete cytochrome b sequence (1140 pb) and a 5@ fragment of the control
region (545 pb) were obtained for nine Proechimys individuals (four P. cuvieri and "ve
P. cayennensis) collected in the "eld from "ve localites in French Guiana: St. Jean du
Maroni, Petit Saut, Nouragues, TriniteH , and St. Euge`ne (voucher specimens listed in
Fig. 1).
DNA was extracted from 95% ethanol-preserved pieces of ear (biopsies) using
phenol/chloroform, proteinase K/RNAse methods (Sambrook et al., 1989) and
Wizard DNA clean-up system (Promega). Cytochrome b and control region were
ampli"ed by polymerase chain reaction (PCR) (Innis et al., 1990) using the conserved
primers L0 (Douzery and Randi, 1997) and E3 (Huchon et al., 1999) for the control
region, and L15 (5@-TGATATGAAAAACCATCGTTG-3@) and H6 (5@-TCTCCATTTCTGGTTTACAAGAC-3@) for the cytochrome b. Ampli"cation were performed in
a thermocycler Crocodile II (Applige`ne), with 30 cycles comprising denaturation at
943C (30 s), annealing at 523C (30 s), and extension at 723C (30 and 60 s, respectively).
An initial cycle employed denaturation at 953C (3 min), annealing at 523C (1 min), and
extension at 723C (1 min). Both strands of each mitochondrial fragment were
sequenced using the dideoxy chain termination method (Sanger et al., 1977), either by
manual sequencing with the thermo-sequenase radiolabeled terminator cycle
sequencing kit (Amersham) or by the use of an automatic sequencer (ABI 373 Perkin
Elmer) with dye terminator cycle polymerase sequencing (Applied Biosystems). Six
internal primers were used for cytochrome b sequencing (details not shown).
Sequence alignment, cytochrome b translation, and nucleotidic composition analyses were performed using CLUSTAL-V (Higgins et al., 1992) and MUST (Philippe,
1993) softwares. Proechimys simonsi and P. amphichoricus (EMBL U35414 and
U35413: Lara et al., 1996) sequences were used as outgroups. The phylogenetic
relationships were analysed by distance and maximum likelihood methods. Maximum likelihood was performed with PUZZLE version 4.0 (Strimmer and von
Haeseler, 1996) with the Tamura and Nei (1993) model of substitution. We assumed
a heterogeneous rate of change among sites with a fraction of variable and invariable
sites. The variable sites evolution follows a Gamma distribution (Gu et al., 1995; Yang,
966
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
Fig. 1. Phylogenetic tree based on a maximum likelihood analysis (PUZZLE software) of concatenated
sequences of cytochrome b and control region (1585 sites) for nine individuals of Proechimys spp. caught in
French Guiana. Values along the branches indicate the reliability percentages from the quartet puzzling
approach (14.5% of unresolved quartets). Specimens of spiny rats are deposited at Museum National
d'Histoire Naturelle, Paris, under the following vouchers numbers: P. cayennensis Petit Saut (MNHN
CG-1998-311,-312; 1999}1092), St Euge`ne (1994}128), Nouragues (1999}1098); P. cuvieri Petit Saut
(1998}313), Nouragues (1999}1093), TriniteH (1999}1090), St Jean du Maroni (1999}1088). The new sequences have been deposited to EMBL gene bank under accession numbers AJ251395 to AJ251403
(cytochrome b), and AJ251420 to AJ251428 (control region).
1994). The strength of internal nodes was obtained by `Quartet Puzzling Support
valuea. Distance matrices were analysed using neighbour-joining algorithm with
Tamura}Nei estimator (1993). The strength of internal nodes was estimated by
bootstrap analysis, with 1000 replicates (Felsenstein, 1985).
2.1. Molecular typing of two species
We designed a pair of speci"c primers for each species in the cytochrome b gene by
taking into account sites variation in nine complete cytochrome b sequences from
French Guiana and 15 partial 800-pb-long sequences (nine P. cuvieri and six
P. cayennensis; J. L. Patton pers. comm.) from di!erent Amazonian localities. Two
pairs of primers of 22 bases contained the nucleotidic characteristics of each targeted
species (L and H for light and heavy strands; cay and cuv for P. cayennensis and
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
967
P. cuvieri):
Lcay2"5@ GATTCTTCAAATCATTACCGGA 3@,
Hcay2"5@ CTATAAAGGCGGTGGCTATTACT 3@,
Lcuv2"5@ AATACTTCAAATCATCACTGGG 3@
Hcuv2"5@ CTATGAAAGCAGTGGCTATGACA 3@.
Ampli"cation reactions were carried out in 50 ll volumes including 1 ll of each
10 lM primer, 1 ll of 10 mM dNTP, 5 ll of 10X reaction bu!er and 0.25 ll of 5 U/ll
taq DNA polymerase. 10 ll of a 1/40 dilution of DNA extract was used for a PCR
ampli"cation with a pair of species-speci"c primers. The cycle pro"le was 943C
denaturation (30 s), 603C annealing (30 s), and 723C extension (40 s) for 30 cycles in
a thermocycler Crocodile III (Applige`ne). An initial round employed a 3 min denaturation at 953C and the "nal cycle had an extension step of 723C for 5 min.
We tested the e$ciency of this molecular discrimination on 14 individuals of
Proechimys spp. previously identi"ed by morphological characters. After observing
complete agreement between molecular and morphological identi"cations, we applied
this method on unknown individuals from two localities in French Guiana: 32
animals from Les Nouragues (4303@N; 52342@W) and 18 from St. Eugene (4350@N;
53304@W). Each individual was tested with both pairs of speci"c primers. When
ampli"cation was positive, speci"c primers ampli"ed a 243 pb long fragment. The
ampli"cation signals were visualized on agarose gel (1.5%) by ethidium bromide
staining.
3. Results and discussion
Cytochrome b and control region divergence values among conspeci"c individuals
were relatively low (less than 4%), and Proechimys cuvieri appeared more polymorphic than P. cayennensis (Table 1). This result might be due to a biased locality
sampling for each species (one much more distant locality for P. cuvieri individuals).
The average high genetic similarity also suggests that there has been a strong gene
#ow among conspeci"c individuals in the surveyed geographic area. P. cuvieri haplotypes from Petit Saut and TriniteH , two localities only 67 km apart, exhibit a slightly
reduced divergence (less than 1.7%) than the one separating a more distant * 130 km
* locality (St. Jean du Maroni: 2.4%), which suggests that some spatial genetic
structure might exist for this species in French Guiana.
The average degree of sequence divergence (for a 800 bp fragment of cytochrome b)
among other species of Proechimys, over a 1000 km Amazonian transect along
the Jurua River (Brazil), was 4.6% for Proechimys simonsi, 4.3% for P. echinothrix
and 5.7% for P. steerei (Patton et al., 2000). In French Guianan inter-speci"c
comparisons, P. cayennensis di!ered from P. cuvieri by an average of 12% (Table 1).
This value can be compared with an average sequence divergence of 15% among the
eight species of Proechimys considered by Patton et al. (2000). This pattern of
968
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
Table 1
Percentages of substitutions (average and standard deviation) in cytochrome b (1140 nucleotides) and
control region (545 nucleotides) sequences for Proechimys species in French Guiana, at two taxonomic
levels. Pcuv"Proechimys cuvieri, Pcay"P. cayennensis
Cytochrome b
Control region
Pairwise comparisons
Within-Pcuv
Within-Pcay
Within-species
Among-species
1.60$0.50
3.04$0.39
6
0.39$0.28
1.09$0.69
10
0.84$0.71
1.81$1.13
16
12.07$0.17
11.47$0.48
20
intra- and inter-speci"c sequences divergence is in good agreement with the values
obtained in other echimyid and sigmodontine rodents and marsupial didelphids by da
Silva and Patton (1993, 1998) and Patton et al. (1997, 2000) based on cytochrome b
sequences.
At the intra-speci"c level the evolutionary rate of the control region fragment
appears faster than that of the cytochrome b gene (Table 1), suggesting that it could be
an adequate molecular marquer for phylogeographic studies at this regional scale.
This result agrees with the high variability (deletions and insertions) of peripheric
regions of this non-coding gene (Sbisa` et al., 1997). In cytochrome b, most substitutions were silent changes, that is without amino-acid replacement (about 0.5 and 4.1%
amino-acid di!erences at intra- and inter-speci"c levels, respectively). This re#ects the
functional constraints at the amino acid level of this gene (Irwin et al., 1991). Whatever
be the codon position, transitions (TS) appeared much more frequent than transversions (TV), as usual for mitochondrial protein-coding genes (Moritz et al., 1987). The
TS : TV ratio is about 16 in comparison of conspeci"c sequences, and about 4 between
pairs of heterospeci"c sequences (Table 2).
With regard to each codon position, the relative frequence of each nucleotidic
substitution di!ers between conspeci"c (TS3ATS1ATV3'TS2'TV1"TV2) or
heterospeci"c (TS3ATV3'TS1'TS2'TV1'TV2) comparisons.
The phylogenetic relationships between the nine concatenated sequences (1585 pb)
evidence the monophyly of each species (Fig. 1), and illustrates (1) the isolated position
of P. cuvieri from St. Jean du Maroni and (2) the presence of two P. cayennensis
haplotypes at the Petit Saut locality. Strong support was obtained for most clades, as
evidenced by most Quartet Puzzling Support values being above 90%.
As the average intra-speci"c divergence is much lower than the one estimated
between the two species (Tables 1 and 2), we developed species-speci"c primers
amplifying a fragment of cytochrome b for typing each taxon. We applied this
approach to 50 undetermined individuals of Proechimys spp. caught in two localities
of French Guiana. The typing resulted in the identi"cation of 10 P. cayennensis and 40
P. cuvieri (Fig. 2), a ratio which is similar to what is known elsewhere in French
Guiana based on comparative skull morphology (Guillotin and Ponge, 1984). In both
sites, St. Euge`ne and Les Nouragues, we evidence that the two species live in syntopy
since they were caught in traps separated by less than 10 m within a 10 000 m2
trapping grid (Fig. 3). Thus, these interspeci"c distances among captures are much
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
969
Table 2
Numbers of transitions and transversions (average and standard deviation) in pairwise comparisons of
cytochrome b (1140 pb) sequences for two Proechimys species in French Guiana, at two taxonomic levels.
Pcuv"Proechimys cuvieri, Pcay"P. cayennensis
Transitions
Transversions
Number comparisons
Within-Pcuv
Within-Pcay
Within-species
Among-species
16.7$4.2
1.5$1.6
6
4.4$3.2
0
10
9.0$7.4
0.6$1.2
16
110.9$2.0
26.8$0.4
20
Fig. 2. Ampli"cation results for a 243 bp fragment of cytochrome b in seven individuals of Proechimys spp.
Individuals 1, 3 & 4 were only ampli"ed by primers L, H CAY2 designed for P. cayennensis, whereas
individuals 2, 5, 6 & 7 are ampli"ed by primers L, H CUV2 speci"c of P. cuvieri.
smaller than the home range sizes documented by Everard and Tikasingh (1973)
for P. cayennensis and by other authors (Fleming, 1971; Adler, 1994) for P.
semispinosus. Our typing results con"rm that P. cuvieri and P. cayennensis can share
the same habitat, as was suggested by Ringuet (1998) who evidenced the syntopy of
both species during three consecutive years on a 30-ha island at Petit Saut hydroelectric dam.
970
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
Fig. 3. Spatial distribution of Proechimys spp. individuals caught at Les Nouragues. An ear biopsy allowed
us to identify each individual by molecular typing. Squares are for P. cuvieri (24 individuals), dots for P.
cayennensis (7 individuals). The main habitat consists of lowland primary rainforests (white), with a northern granitic outcrop with xeric vegetation (1) and some small patches of bamboos thickets (2).
An alternative procedure, that we have not used, would be to look for speciesspeci"c fragment patterns after restriction enzymes applied onto the PCR-ampli"ed
product of cytochrome b, as was succesfully used by M. da Silva and J. L. Patton (pers.
comm.) on Brazilian Proechimys species.
Such a posteriori identi"cation allows one to examine the micro-distribution of
each species according to various habitats. At the Nouragues locality, both species
were caught mainly in continuous primary forest; only P. cuvieri (three individuals)
was caugth in low transition forests near a granitic outcrop characterized by a discontinuous, xeric vegetation. Malcolm (1992) in the Manaus region (Brazil) showed that
an increased proportion of P. cuvieri was observed in edge-dominated or early
successional habitats (fragments and secondary forest) in contrast with P. cayennensis,
mainly caught in continuous primary forest. This suggests that P. cuvieri and
P. cayennensis might use di!erent resources by selecting di!erent habitats, and more
research related to their respective role in seed dispersal and forest regeneration is
strongly needed.
Our molecular approach has thus allowed us to discriminate with a high con"dence
the individuals of two sympatric species of morphologically similar echimyids in
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
971
French Guiana. This was a necessary "rst step for allowing further ecological studies
aimed at understanding the population biology of Proechimys spp.
Acknowledgements
This study was partially funded by the French Ministe`re de l'Environnement (ref.
DGAD/SRAE/96125). Cynthia Steiner is supported by a grant from the Fundacion
Gran Mariscal de Ayacucho, Venezuela. We warmfully thank Jean-Franc7 ois Mauffrey, SteH phane Ringuet and especially Marie-Laure Guillemin who provided earbiopsies from terrestrial spiny rats caught during the course of their ecological work.
Field support was provided by Station Biologique des Nouragues (UPS CNRS 656),
by Laboratoire Hydreco at Petit Saut, and by O$ce National des Fore( ts de Guyane
(Cayenne). We thank James L. Patton for providing Proechimys spp. sequences before
publication, and for comments on an earlier version of this paper. This is contribution
ISEM 2000-21 of Institut des Sciences de l'Evolution de Montpellier.
References
Adler, G.H., 1994. Tropical forest fragmentation and isolation promote asynchrony among populations of
frugivorus rodents. J. Anim. Ecol. 63, 903}911.
Aguilera, M., Reig, O., Perez-Zapata, A., 1995. G- and C-banding karyotypes of spiny rats (Proechimys) of
Venezuela. Rev. Chil. Hist. Nat. 68, 185}196.
da Silva, M.N., Patton, J.L., 1993. Amazonian phylogeography: mtDNA sequence variation in arboreal
echimyid rodents (Caviomorpha). Mol. Phylogenet. Evol. 2, 243}255.
da Silva, M.N., Patton, J.L., 1998. Molecular phylogeography and the evolution and conservation of
Amazonian mammals. Mol. Ecol. 7, 475}486.
Douzery, E., Randi, E., 1997. The mitochondrial control region of Cervidae: Evolutionary patterns and
phylogenetic content. Mol. Biol. Evol. 14, 1154}1166.
Emmons, L., 1982. Ecology of Proechimys in southeastern Peru. J. Trop. Ecol. 23, 280}290.
Emmons, L.H., Feer, F., 1990. Neotropical rainforest mammals. A "eld guide. University Chicago Press,
Chicago.
Everard, C.O.R., Tikasingh, E.S., 1973. Ecology of the rodents, Proechimys cayennensis trinitatis and
Oryzomys capito velutinus, on Trinidad. J. Mamm. 54, 875}886.
Felsenstein, J., 1985. Con"dence limits on phylogenies: an approach using the bootstrap. Evolution 39,
783}791.
Fleming, T.H., 1971. Population ecology of three species of Neotropical rodents. Misc. Publ. Mus. Zool.
Univ. Michigan. 143, 1}77.
Forget, P.-M., 1989. La reH geH neH ration naturelle d'une espe`ce autochore de la fore( t guyanaise: Epertua falcata
Aublet (Caesalpiniaceae). Biotropica 21, 115}125.
Forget, P.-M., 1991. Scatterhoarding of Astrocaryum paramaca by Proechimys in French Guiana: comparison with Myoprocta exilis. Trop. Ecol. 32, 155}167.
Forget, P.-M., Sabatier, D., 1997. Dynamics of the seedling shadow of a frugivore-dispersed tree species in
French Guiana. Trop. Ecol. 13, 767}773.
Gardner, A.L., Emmons, L.H., 1984. Species groups in Proechimys (Rodentia, Echimyidae) as indicated by
karyology and bullar morphology. J. Mamm. 65, 10}25.
Gu, X., Fu, Y.-X., Li, W.-H., 1995. Maximum likelihood estimation of the heterogeneity of substitution rate
among nucleotide sites. Mol. Biol. Evol. 12, 546}557.
972
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
Guillotin, M., 1982. Place de Proechimys cuvieri (Rodentia, Echimyidae) dans les peuplements micromammaliens terrestres de la fore( t guyanaise. Mammalia 46, 299}318.
Guillotin, M., Ponge, J.-F., 1984. Identi"cation de deux espe`ces de rongeurs de Guyane franc7 aise,
Proechimys cuvieri et Proechimys guyannensis (Echimyidae) par l'analyse des correspondances. Mammalia 48, 287}291.
Higgins, D.G., Bleasby, A.J., Fuchs, R., 1992. Clustal V: improved software for multiple sequence alignement. Comput. Appl. Biosci. 8, 189}191.
Huchon, D., Delsuc, F., Catze#is, F.M., Douzery, E.J., 1999. Armadillos exhibit less genetic polymorphism
in North America than in South America: nuclear and mitochondrial data con"rm a founder e!ect in
Dasypus novemcinctus (Xenarthra). Mol. Ecol. 8, 1743}1748.
Husson, A.M., 1978. The Mammals of Suriname. E.J. Brill, Netherlands.
Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., 1990. PCR Protocols. A Guide to Methods and
Applications. Academic Press, San Diego.
Irwin, D.M., Kocher, T.D., Wilson, A.C., 1991. Evolution of the cytochrome b gene of mammals. J. Mol.
Evol. 32, 128}144.
Lara, M., Bogan, M.A., Cerqueira, R., 1992. Sex and age components of variations in Proechimys cuvieri
(Rodentia: Echimyidae) from northern Brazil. Proc. Biol. Soc. Wash. 105, 882}893.
Lara, M.C., Patton, J.L., da Silva, M.N., 1996. The simultaneous diversi"cation of South American echimyid
rodents (Hystricognathi) based on complete cytochrome b sequences. Mol. Phylogenet. Evol. 5, 403}413.
Malcolm, J.R., 1992. Use of tooth impressions to identify and age live Proechimys guyannensis and P. cuvieri
(Rodentia: Echimyidae). J. Zool. Lond. 227, 537}546.
Moritz, C., Dowling, T.E., Bron, W.M., 1987. Evolution of animal mitochondrial DNA: relevance for
population biology and systematics. Ann. Rev. Ecol. Syst. 18, 269}292.
Mustrangi, M.A., Patton, J.L., 1997. Phylogeography and systematics of the slender mouse opossum
Marmosops (Marsupialia Didelphidae). Univ. California Publ. Zool. 130, 1}86.
Patton, J.L., 1987. Species groups of spiny rats, genus Proechimys (Rodentia: Echimyidae). Fieldiana: Zool.
(New Series) 39, 305}345.
Patton, J.L., da Silva, M.N., Malcolm, J.R., 2000. Mammals of the Rio Jurua: evolutionary and ecological
diversi"cation in Amazonia. Bull. Am. Mus. Nat. Hist. 244, 1}306.
Patton, J.L., da Silva, M.N., Lara, M.C., Mustrangi, M.A., 1997. Diversity, di!erentiation, and the historical
biogeography of nonvolant small mammals in the Neotropical forests. In: Laurance, W.F., Bierregaard
Jr., R.O. (Eds.), Tropical Forest Remnants, Ecology, Management, and Conservation of Fragmented
Communities. The University of Chicago Press, Chicago.
Patton, J.L., Gardner, A.L., 1972. Notes on the systematics of Proechimys (Rodentia: Echimyidae), with
emphasis on Peruvian forms. Occas. Pap. Mus. Zool. Louisiana State Univ. 44, 1}30.
Patton, J.L., Rogers, M.A., 1983. Systematic implications of non-geographic variation in the spiny rat genus
Proechimys (Echimyidae). Z. Saugetierk. 48, 363}370.
Petter, F., 1978. EpideH miologie de la leishmaniose en Guyane franc7 aise, en relation avec l'existence d'une
espe`ce nouvelle de Rongeurs EchimyideH s, Proechimys cuvieri sp. C.R. Acad. Sci. Paris 287, 261}264.
Philippe, H., 1993. MUST, a computer package for management utilities for sequences and trees. Nucl.
Acids Res. 21, 5264}5272.
Ringuet, S., 1998. Evolution des peuplements et des populations de micromammife`res terrestres de la fore( t
tropicale a` la suite de la fragmentation de leur habitat: l'exemple du barrage de Petit Saut (Guyane
franc7 aise). The`se de Docteur du Museum National d'Histoire Naturelle, Paris.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring
Harbor Laboratory. Cold Spring Harbor, New York.
Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA-sequencing with chain-terminating inhibitors. Proc.
Natl. Acad. Sci. USA 74, 5463}5467.
Sbisa`, E., Tanzariello, F., Reyes, A., Pesole, G., Saccone, C., 1997. Mammalian mitochondrial D-loop region
structural analysis: Identi"cation of new conserved sequences and their functional and evolutionary
implications. Gene 205, 125}140.
Strimmer, K., von Haeseler, A., 1996. Quartet puzzling: a quartet maximum likelihood method for
reconstructing tree topologies. Mol. Biol Evol. 13, 964}969.
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
973
Tamura, K., Nei, M., 1993. Estimating of the number of nucleotide substitutions in the control region of
mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512}526.
Voss, R.S., Emmons, L.H., 1996. Mammalian diversity in Neotropical lowland rainforests: a preliminary
assessment. Bull. Amer. Mus. Nat. Hist. 230, 1}115.
Wilson, D.E., Reeder, D.M., 1993. Mammal species of the world. A taxonomic and geographic reference,
Second Edition. Smithsonian Institution Press, Washington.
Yang, Z., 1994. Maximum likelihood phylogenetic estimation from DNA sequences with variable rates over
sites: approximate methods. J. Mol. Evol. 39, 306}314.
Molecular characterization and mitochondrial
sequence variation in two sympatric species
of Proechimys (Rodentia: Echimyidae)
in French Guiana
Cynthia Steiner, Patricia Sourrouille, Franc7 ois Catze#is*
Laboratoire de Pale& ontologie, Pale& obiologie & Phyloge& nie, Universite& Montpellier 2, Institut des Sciences de
l'Evolution, UMR 5554 CNRS, Case Courrier 064, 34095 Montpellier cedex, France
Received 13 December 1999; accepted 26 January 2000
Abstract
Variations in mitochondrial DNA characters were used to characterize two morphologically
similar and sympatric species of Neotropical terrestrial rodents of the genus Proechimys
(Mammalia: Echimyidae). We sequenced both cytochrome b (1140 pb) and part of the control
region (445 pb) from four individuals of P. cuvieri and "ve of P. cayennensis from French
Guiana, which allowed us to depict intra- and inter-speci"c patterns of variation. The
phylogenetic relationships between the nine sequences evidence the monophyly of each species,
and illustrate that more polymorphism might exist within P. cuvieri than within P. cayennensis.
By developing species-speci"c primers to amplify a fragment of the cytochrome b gene, we were
able to identify 50 individuals of Proechimys spp. caught in two localities of French Guiana. In
both sites of primary rainforests, we showed that the two species live in syntopy, and this
observation emphasizes the need to document ecological di!erences which should exist in order
to diminish inter-speci"c competition. ( 2000 Elsevier Science Ltd. All rights reserved.
Keywords: Proechimys; Cytochrome b; Control region; Species identi"cation; Syntopy; French Guiana
1. Introduction
The spiny rats of the genus Proechimys (Echimyidae: Rodentia) are generally the
most abundant and widely distributed rodents in Neotropical forests, representing at
* Corresponding author. Fax: #33-4-6714-3610.
E-mail address: [email protected] (F. Catze#is).
0305-1978/00/$ - see front matter ( 2000 Elsevier Science Ltd. All rights reserved.
PII: S 0 3 0 5 - 1 9 7 8 ( 0 0 ) 0 0 0 2 1 - 1
964
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
least 23 species (Wood, in Wilson and Reeder, 1993). Their distribution extends from
Honduras to Paraguay, where they inhabit tropical and subtropical forested habitats.
In contrast to most other echimyids, all species of this diverse genus are terrestrial,
with elongated head and long rostra, large and erect ears, and narrow and long hind
feet. The tail is always shorter than the head-and-body length, the dorsal fur is
composed of a mixture of soft hairs and expanded, varyingly sti!ened spines. The
dorsal and lateral color is generally reddish brown and the belly is usually white
(Emmons and Feer, 1990).
Our limited knowledge of the taxonomy and systematics of Proechimys stands in
contrast to their abundance in all lowland forest types. Two to "ve species might be
sympatric at a single locality, may even occupy the same burrows (Emmons, 1982;
Patton et al., 1999). To identify the species from living animals and de"ne species
boundaries has often proven extremely di$cult as a consequence of the polymorphism of external characters due to geographic and non-geographic variation. The
latter includes sexual dimorphism (rarely) and especially age-related changes (Patton
and Rogers, 1983; Lara et al., 1992). Even karyotypes, which have proven useful in
di!erentiating sympatric taxa, may be highly variable geographically at intra- and
inter-speci"c levels (Gardner and Emmons, 1984; Aguilera et al., 1995).
Only a few studies have succeeded in documenting and describing sympatric
entities over large geographic areas (e.g. Patton and Gardner, 1972; Gardner and
Emmons, 1984; Patton, 1987; Patton et al., 2000). In French Guiana, before 1978, only
one species of Proechimys was recognized ("P. guyannensis), with a strong morphological variation. Petter's (1978) work in this country, at the same time as Husson
in Suriname, showed the presence of two morphological species: a larger one
(P. cuvieri Petter, 1978; unfortunately called P. guyannensis E. Geo!roy, 1803 by
Husson, 1978) and a smaller one (P. guyannensis E. Geo!roy, 1803 sensu Petter; called
P. warreni Thomas, 1905 by Husson, 1978). Subsequent studies by Guillotin (1982),
Guillotin and Ponge (1984), Voss and Emmons (1996) and Ringuet (1998) documented
the sympatry of these two species in French Guiana.
Currently, external morphological characters proposed by taxonomic studies are
not su$cient for identifying living individuals of many species of Proechimys in the
"eld (Voss and Emmons, 1996), such as in the case of P. cuvieri and P. cayennensis in
French Guiana. Subadult and adult males can be recognized by palpation of the
phallus, since P. cuvieri has a much broader, shorter, and massive baculum than
P. cayennensis, in which this bone is long and narrow (Patton and Gardner, 1972;
Patton, 1987). But other external characters are largely ovelapping in French Guianan
samples of P. cuvieri and P. cayennensis (Petter, 1978), thus rendering the "eld
identi"cation very di$cult. Thus, a molecular or biochemical technique making use of
a small biopsy might be desirable for discriminating each species without killing
animals. We have considered analysing molecular sequences of mitochondrial DNA
based on the premises that such genetic data are of great help in the discrimination of
local species of Neotropical mammals (da Silva and Patton, 1993; Mustrangi and
Patton, 1997; Patton et al., 2000). In this paper we examine the phylogenetic relationships among French Guianan specimens of Proechimys cuvieri Petter, 1978 and
P. cayennensis Desmaret, 1817 ("P. guyannensis E. Geo!roy, 1803) based on the
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
965
analyses of cytochrome b and of the control region mitochondrial sequences. Then, we
show that a molecular discrimination of these two sympatric species in French
Guiana is possible without killing the individuals for skull and teeth measurements.
This method will allow one to carry out ecological studies for understanding resource
competition, space distribution (home range) and dispersing behavior in di!erent
habitats, for each of these similar species. To understand the particular ecology of
each sympatric species of Proechimys is a prerequisite for assessing their role in
ecosystem regeneration (Forget, 1989, 1991; Forget and Sabatier, 1997). Indeed,
terrestrial spiny rats take a large part in seed-removal and in seed scatterhoard for
later consumption. Despite high predation on caches, some seeds survive and germinate, and Proechimys spp. are thus important for a reliable and e!ective seed dispersal.
2. Materials and methods
The complete cytochrome b sequence (1140 pb) and a 5@ fragment of the control
region (545 pb) were obtained for nine Proechimys individuals (four P. cuvieri and "ve
P. cayennensis) collected in the "eld from "ve localites in French Guiana: St. Jean du
Maroni, Petit Saut, Nouragues, TriniteH , and St. Euge`ne (voucher specimens listed in
Fig. 1).
DNA was extracted from 95% ethanol-preserved pieces of ear (biopsies) using
phenol/chloroform, proteinase K/RNAse methods (Sambrook et al., 1989) and
Wizard DNA clean-up system (Promega). Cytochrome b and control region were
ampli"ed by polymerase chain reaction (PCR) (Innis et al., 1990) using the conserved
primers L0 (Douzery and Randi, 1997) and E3 (Huchon et al., 1999) for the control
region, and L15 (5@-TGATATGAAAAACCATCGTTG-3@) and H6 (5@-TCTCCATTTCTGGTTTACAAGAC-3@) for the cytochrome b. Ampli"cation were performed in
a thermocycler Crocodile II (Applige`ne), with 30 cycles comprising denaturation at
943C (30 s), annealing at 523C (30 s), and extension at 723C (30 and 60 s, respectively).
An initial cycle employed denaturation at 953C (3 min), annealing at 523C (1 min), and
extension at 723C (1 min). Both strands of each mitochondrial fragment were
sequenced using the dideoxy chain termination method (Sanger et al., 1977), either by
manual sequencing with the thermo-sequenase radiolabeled terminator cycle
sequencing kit (Amersham) or by the use of an automatic sequencer (ABI 373 Perkin
Elmer) with dye terminator cycle polymerase sequencing (Applied Biosystems). Six
internal primers were used for cytochrome b sequencing (details not shown).
Sequence alignment, cytochrome b translation, and nucleotidic composition analyses were performed using CLUSTAL-V (Higgins et al., 1992) and MUST (Philippe,
1993) softwares. Proechimys simonsi and P. amphichoricus (EMBL U35414 and
U35413: Lara et al., 1996) sequences were used as outgroups. The phylogenetic
relationships were analysed by distance and maximum likelihood methods. Maximum likelihood was performed with PUZZLE version 4.0 (Strimmer and von
Haeseler, 1996) with the Tamura and Nei (1993) model of substitution. We assumed
a heterogeneous rate of change among sites with a fraction of variable and invariable
sites. The variable sites evolution follows a Gamma distribution (Gu et al., 1995; Yang,
966
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
Fig. 1. Phylogenetic tree based on a maximum likelihood analysis (PUZZLE software) of concatenated
sequences of cytochrome b and control region (1585 sites) for nine individuals of Proechimys spp. caught in
French Guiana. Values along the branches indicate the reliability percentages from the quartet puzzling
approach (14.5% of unresolved quartets). Specimens of spiny rats are deposited at Museum National
d'Histoire Naturelle, Paris, under the following vouchers numbers: P. cayennensis Petit Saut (MNHN
CG-1998-311,-312; 1999}1092), St Euge`ne (1994}128), Nouragues (1999}1098); P. cuvieri Petit Saut
(1998}313), Nouragues (1999}1093), TriniteH (1999}1090), St Jean du Maroni (1999}1088). The new sequences have been deposited to EMBL gene bank under accession numbers AJ251395 to AJ251403
(cytochrome b), and AJ251420 to AJ251428 (control region).
1994). The strength of internal nodes was obtained by `Quartet Puzzling Support
valuea. Distance matrices were analysed using neighbour-joining algorithm with
Tamura}Nei estimator (1993). The strength of internal nodes was estimated by
bootstrap analysis, with 1000 replicates (Felsenstein, 1985).
2.1. Molecular typing of two species
We designed a pair of speci"c primers for each species in the cytochrome b gene by
taking into account sites variation in nine complete cytochrome b sequences from
French Guiana and 15 partial 800-pb-long sequences (nine P. cuvieri and six
P. cayennensis; J. L. Patton pers. comm.) from di!erent Amazonian localities. Two
pairs of primers of 22 bases contained the nucleotidic characteristics of each targeted
species (L and H for light and heavy strands; cay and cuv for P. cayennensis and
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
967
P. cuvieri):
Lcay2"5@ GATTCTTCAAATCATTACCGGA 3@,
Hcay2"5@ CTATAAAGGCGGTGGCTATTACT 3@,
Lcuv2"5@ AATACTTCAAATCATCACTGGG 3@
Hcuv2"5@ CTATGAAAGCAGTGGCTATGACA 3@.
Ampli"cation reactions were carried out in 50 ll volumes including 1 ll of each
10 lM primer, 1 ll of 10 mM dNTP, 5 ll of 10X reaction bu!er and 0.25 ll of 5 U/ll
taq DNA polymerase. 10 ll of a 1/40 dilution of DNA extract was used for a PCR
ampli"cation with a pair of species-speci"c primers. The cycle pro"le was 943C
denaturation (30 s), 603C annealing (30 s), and 723C extension (40 s) for 30 cycles in
a thermocycler Crocodile III (Applige`ne). An initial round employed a 3 min denaturation at 953C and the "nal cycle had an extension step of 723C for 5 min.
We tested the e$ciency of this molecular discrimination on 14 individuals of
Proechimys spp. previously identi"ed by morphological characters. After observing
complete agreement between molecular and morphological identi"cations, we applied
this method on unknown individuals from two localities in French Guiana: 32
animals from Les Nouragues (4303@N; 52342@W) and 18 from St. Eugene (4350@N;
53304@W). Each individual was tested with both pairs of speci"c primers. When
ampli"cation was positive, speci"c primers ampli"ed a 243 pb long fragment. The
ampli"cation signals were visualized on agarose gel (1.5%) by ethidium bromide
staining.
3. Results and discussion
Cytochrome b and control region divergence values among conspeci"c individuals
were relatively low (less than 4%), and Proechimys cuvieri appeared more polymorphic than P. cayennensis (Table 1). This result might be due to a biased locality
sampling for each species (one much more distant locality for P. cuvieri individuals).
The average high genetic similarity also suggests that there has been a strong gene
#ow among conspeci"c individuals in the surveyed geographic area. P. cuvieri haplotypes from Petit Saut and TriniteH , two localities only 67 km apart, exhibit a slightly
reduced divergence (less than 1.7%) than the one separating a more distant * 130 km
* locality (St. Jean du Maroni: 2.4%), which suggests that some spatial genetic
structure might exist for this species in French Guiana.
The average degree of sequence divergence (for a 800 bp fragment of cytochrome b)
among other species of Proechimys, over a 1000 km Amazonian transect along
the Jurua River (Brazil), was 4.6% for Proechimys simonsi, 4.3% for P. echinothrix
and 5.7% for P. steerei (Patton et al., 2000). In French Guianan inter-speci"c
comparisons, P. cayennensis di!ered from P. cuvieri by an average of 12% (Table 1).
This value can be compared with an average sequence divergence of 15% among the
eight species of Proechimys considered by Patton et al. (2000). This pattern of
968
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
Table 1
Percentages of substitutions (average and standard deviation) in cytochrome b (1140 nucleotides) and
control region (545 nucleotides) sequences for Proechimys species in French Guiana, at two taxonomic
levels. Pcuv"Proechimys cuvieri, Pcay"P. cayennensis
Cytochrome b
Control region
Pairwise comparisons
Within-Pcuv
Within-Pcay
Within-species
Among-species
1.60$0.50
3.04$0.39
6
0.39$0.28
1.09$0.69
10
0.84$0.71
1.81$1.13
16
12.07$0.17
11.47$0.48
20
intra- and inter-speci"c sequences divergence is in good agreement with the values
obtained in other echimyid and sigmodontine rodents and marsupial didelphids by da
Silva and Patton (1993, 1998) and Patton et al. (1997, 2000) based on cytochrome b
sequences.
At the intra-speci"c level the evolutionary rate of the control region fragment
appears faster than that of the cytochrome b gene (Table 1), suggesting that it could be
an adequate molecular marquer for phylogeographic studies at this regional scale.
This result agrees with the high variability (deletions and insertions) of peripheric
regions of this non-coding gene (Sbisa` et al., 1997). In cytochrome b, most substitutions were silent changes, that is without amino-acid replacement (about 0.5 and 4.1%
amino-acid di!erences at intra- and inter-speci"c levels, respectively). This re#ects the
functional constraints at the amino acid level of this gene (Irwin et al., 1991). Whatever
be the codon position, transitions (TS) appeared much more frequent than transversions (TV), as usual for mitochondrial protein-coding genes (Moritz et al., 1987). The
TS : TV ratio is about 16 in comparison of conspeci"c sequences, and about 4 between
pairs of heterospeci"c sequences (Table 2).
With regard to each codon position, the relative frequence of each nucleotidic
substitution di!ers between conspeci"c (TS3ATS1ATV3'TS2'TV1"TV2) or
heterospeci"c (TS3ATV3'TS1'TS2'TV1'TV2) comparisons.
The phylogenetic relationships between the nine concatenated sequences (1585 pb)
evidence the monophyly of each species (Fig. 1), and illustrates (1) the isolated position
of P. cuvieri from St. Jean du Maroni and (2) the presence of two P. cayennensis
haplotypes at the Petit Saut locality. Strong support was obtained for most clades, as
evidenced by most Quartet Puzzling Support values being above 90%.
As the average intra-speci"c divergence is much lower than the one estimated
between the two species (Tables 1 and 2), we developed species-speci"c primers
amplifying a fragment of cytochrome b for typing each taxon. We applied this
approach to 50 undetermined individuals of Proechimys spp. caught in two localities
of French Guiana. The typing resulted in the identi"cation of 10 P. cayennensis and 40
P. cuvieri (Fig. 2), a ratio which is similar to what is known elsewhere in French
Guiana based on comparative skull morphology (Guillotin and Ponge, 1984). In both
sites, St. Euge`ne and Les Nouragues, we evidence that the two species live in syntopy
since they were caught in traps separated by less than 10 m within a 10 000 m2
trapping grid (Fig. 3). Thus, these interspeci"c distances among captures are much
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
969
Table 2
Numbers of transitions and transversions (average and standard deviation) in pairwise comparisons of
cytochrome b (1140 pb) sequences for two Proechimys species in French Guiana, at two taxonomic levels.
Pcuv"Proechimys cuvieri, Pcay"P. cayennensis
Transitions
Transversions
Number comparisons
Within-Pcuv
Within-Pcay
Within-species
Among-species
16.7$4.2
1.5$1.6
6
4.4$3.2
0
10
9.0$7.4
0.6$1.2
16
110.9$2.0
26.8$0.4
20
Fig. 2. Ampli"cation results for a 243 bp fragment of cytochrome b in seven individuals of Proechimys spp.
Individuals 1, 3 & 4 were only ampli"ed by primers L, H CAY2 designed for P. cayennensis, whereas
individuals 2, 5, 6 & 7 are ampli"ed by primers L, H CUV2 speci"c of P. cuvieri.
smaller than the home range sizes documented by Everard and Tikasingh (1973)
for P. cayennensis and by other authors (Fleming, 1971; Adler, 1994) for P.
semispinosus. Our typing results con"rm that P. cuvieri and P. cayennensis can share
the same habitat, as was suggested by Ringuet (1998) who evidenced the syntopy of
both species during three consecutive years on a 30-ha island at Petit Saut hydroelectric dam.
970
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
Fig. 3. Spatial distribution of Proechimys spp. individuals caught at Les Nouragues. An ear biopsy allowed
us to identify each individual by molecular typing. Squares are for P. cuvieri (24 individuals), dots for P.
cayennensis (7 individuals). The main habitat consists of lowland primary rainforests (white), with a northern granitic outcrop with xeric vegetation (1) and some small patches of bamboos thickets (2).
An alternative procedure, that we have not used, would be to look for speciesspeci"c fragment patterns after restriction enzymes applied onto the PCR-ampli"ed
product of cytochrome b, as was succesfully used by M. da Silva and J. L. Patton (pers.
comm.) on Brazilian Proechimys species.
Such a posteriori identi"cation allows one to examine the micro-distribution of
each species according to various habitats. At the Nouragues locality, both species
were caught mainly in continuous primary forest; only P. cuvieri (three individuals)
was caugth in low transition forests near a granitic outcrop characterized by a discontinuous, xeric vegetation. Malcolm (1992) in the Manaus region (Brazil) showed that
an increased proportion of P. cuvieri was observed in edge-dominated or early
successional habitats (fragments and secondary forest) in contrast with P. cayennensis,
mainly caught in continuous primary forest. This suggests that P. cuvieri and
P. cayennensis might use di!erent resources by selecting di!erent habitats, and more
research related to their respective role in seed dispersal and forest regeneration is
strongly needed.
Our molecular approach has thus allowed us to discriminate with a high con"dence
the individuals of two sympatric species of morphologically similar echimyids in
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
971
French Guiana. This was a necessary "rst step for allowing further ecological studies
aimed at understanding the population biology of Proechimys spp.
Acknowledgements
This study was partially funded by the French Ministe`re de l'Environnement (ref.
DGAD/SRAE/96125). Cynthia Steiner is supported by a grant from the Fundacion
Gran Mariscal de Ayacucho, Venezuela. We warmfully thank Jean-Franc7 ois Mauffrey, SteH phane Ringuet and especially Marie-Laure Guillemin who provided earbiopsies from terrestrial spiny rats caught during the course of their ecological work.
Field support was provided by Station Biologique des Nouragues (UPS CNRS 656),
by Laboratoire Hydreco at Petit Saut, and by O$ce National des Fore( ts de Guyane
(Cayenne). We thank James L. Patton for providing Proechimys spp. sequences before
publication, and for comments on an earlier version of this paper. This is contribution
ISEM 2000-21 of Institut des Sciences de l'Evolution de Montpellier.
References
Adler, G.H., 1994. Tropical forest fragmentation and isolation promote asynchrony among populations of
frugivorus rodents. J. Anim. Ecol. 63, 903}911.
Aguilera, M., Reig, O., Perez-Zapata, A., 1995. G- and C-banding karyotypes of spiny rats (Proechimys) of
Venezuela. Rev. Chil. Hist. Nat. 68, 185}196.
da Silva, M.N., Patton, J.L., 1993. Amazonian phylogeography: mtDNA sequence variation in arboreal
echimyid rodents (Caviomorpha). Mol. Phylogenet. Evol. 2, 243}255.
da Silva, M.N., Patton, J.L., 1998. Molecular phylogeography and the evolution and conservation of
Amazonian mammals. Mol. Ecol. 7, 475}486.
Douzery, E., Randi, E., 1997. The mitochondrial control region of Cervidae: Evolutionary patterns and
phylogenetic content. Mol. Biol. Evol. 14, 1154}1166.
Emmons, L., 1982. Ecology of Proechimys in southeastern Peru. J. Trop. Ecol. 23, 280}290.
Emmons, L.H., Feer, F., 1990. Neotropical rainforest mammals. A "eld guide. University Chicago Press,
Chicago.
Everard, C.O.R., Tikasingh, E.S., 1973. Ecology of the rodents, Proechimys cayennensis trinitatis and
Oryzomys capito velutinus, on Trinidad. J. Mamm. 54, 875}886.
Felsenstein, J., 1985. Con"dence limits on phylogenies: an approach using the bootstrap. Evolution 39,
783}791.
Fleming, T.H., 1971. Population ecology of three species of Neotropical rodents. Misc. Publ. Mus. Zool.
Univ. Michigan. 143, 1}77.
Forget, P.-M., 1989. La reH geH neH ration naturelle d'une espe`ce autochore de la fore( t guyanaise: Epertua falcata
Aublet (Caesalpiniaceae). Biotropica 21, 115}125.
Forget, P.-M., 1991. Scatterhoarding of Astrocaryum paramaca by Proechimys in French Guiana: comparison with Myoprocta exilis. Trop. Ecol. 32, 155}167.
Forget, P.-M., Sabatier, D., 1997. Dynamics of the seedling shadow of a frugivore-dispersed tree species in
French Guiana. Trop. Ecol. 13, 767}773.
Gardner, A.L., Emmons, L.H., 1984. Species groups in Proechimys (Rodentia, Echimyidae) as indicated by
karyology and bullar morphology. J. Mamm. 65, 10}25.
Gu, X., Fu, Y.-X., Li, W.-H., 1995. Maximum likelihood estimation of the heterogeneity of substitution rate
among nucleotide sites. Mol. Biol. Evol. 12, 546}557.
972
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
Guillotin, M., 1982. Place de Proechimys cuvieri (Rodentia, Echimyidae) dans les peuplements micromammaliens terrestres de la fore( t guyanaise. Mammalia 46, 299}318.
Guillotin, M., Ponge, J.-F., 1984. Identi"cation de deux espe`ces de rongeurs de Guyane franc7 aise,
Proechimys cuvieri et Proechimys guyannensis (Echimyidae) par l'analyse des correspondances. Mammalia 48, 287}291.
Higgins, D.G., Bleasby, A.J., Fuchs, R., 1992. Clustal V: improved software for multiple sequence alignement. Comput. Appl. Biosci. 8, 189}191.
Huchon, D., Delsuc, F., Catze#is, F.M., Douzery, E.J., 1999. Armadillos exhibit less genetic polymorphism
in North America than in South America: nuclear and mitochondrial data con"rm a founder e!ect in
Dasypus novemcinctus (Xenarthra). Mol. Ecol. 8, 1743}1748.
Husson, A.M., 1978. The Mammals of Suriname. E.J. Brill, Netherlands.
Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., 1990. PCR Protocols. A Guide to Methods and
Applications. Academic Press, San Diego.
Irwin, D.M., Kocher, T.D., Wilson, A.C., 1991. Evolution of the cytochrome b gene of mammals. J. Mol.
Evol. 32, 128}144.
Lara, M., Bogan, M.A., Cerqueira, R., 1992. Sex and age components of variations in Proechimys cuvieri
(Rodentia: Echimyidae) from northern Brazil. Proc. Biol. Soc. Wash. 105, 882}893.
Lara, M.C., Patton, J.L., da Silva, M.N., 1996. The simultaneous diversi"cation of South American echimyid
rodents (Hystricognathi) based on complete cytochrome b sequences. Mol. Phylogenet. Evol. 5, 403}413.
Malcolm, J.R., 1992. Use of tooth impressions to identify and age live Proechimys guyannensis and P. cuvieri
(Rodentia: Echimyidae). J. Zool. Lond. 227, 537}546.
Moritz, C., Dowling, T.E., Bron, W.M., 1987. Evolution of animal mitochondrial DNA: relevance for
population biology and systematics. Ann. Rev. Ecol. Syst. 18, 269}292.
Mustrangi, M.A., Patton, J.L., 1997. Phylogeography and systematics of the slender mouse opossum
Marmosops (Marsupialia Didelphidae). Univ. California Publ. Zool. 130, 1}86.
Patton, J.L., 1987. Species groups of spiny rats, genus Proechimys (Rodentia: Echimyidae). Fieldiana: Zool.
(New Series) 39, 305}345.
Patton, J.L., da Silva, M.N., Malcolm, J.R., 2000. Mammals of the Rio Jurua: evolutionary and ecological
diversi"cation in Amazonia. Bull. Am. Mus. Nat. Hist. 244, 1}306.
Patton, J.L., da Silva, M.N., Lara, M.C., Mustrangi, M.A., 1997. Diversity, di!erentiation, and the historical
biogeography of nonvolant small mammals in the Neotropical forests. In: Laurance, W.F., Bierregaard
Jr., R.O. (Eds.), Tropical Forest Remnants, Ecology, Management, and Conservation of Fragmented
Communities. The University of Chicago Press, Chicago.
Patton, J.L., Gardner, A.L., 1972. Notes on the systematics of Proechimys (Rodentia: Echimyidae), with
emphasis on Peruvian forms. Occas. Pap. Mus. Zool. Louisiana State Univ. 44, 1}30.
Patton, J.L., Rogers, M.A., 1983. Systematic implications of non-geographic variation in the spiny rat genus
Proechimys (Echimyidae). Z. Saugetierk. 48, 363}370.
Petter, F., 1978. EpideH miologie de la leishmaniose en Guyane franc7 aise, en relation avec l'existence d'une
espe`ce nouvelle de Rongeurs EchimyideH s, Proechimys cuvieri sp. C.R. Acad. Sci. Paris 287, 261}264.
Philippe, H., 1993. MUST, a computer package for management utilities for sequences and trees. Nucl.
Acids Res. 21, 5264}5272.
Ringuet, S., 1998. Evolution des peuplements et des populations de micromammife`res terrestres de la fore( t
tropicale a` la suite de la fragmentation de leur habitat: l'exemple du barrage de Petit Saut (Guyane
franc7 aise). The`se de Docteur du Museum National d'Histoire Naturelle, Paris.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring
Harbor Laboratory. Cold Spring Harbor, New York.
Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA-sequencing with chain-terminating inhibitors. Proc.
Natl. Acad. Sci. USA 74, 5463}5467.
Sbisa`, E., Tanzariello, F., Reyes, A., Pesole, G., Saccone, C., 1997. Mammalian mitochondrial D-loop region
structural analysis: Identi"cation of new conserved sequences and their functional and evolutionary
implications. Gene 205, 125}140.
Strimmer, K., von Haeseler, A., 1996. Quartet puzzling: a quartet maximum likelihood method for
reconstructing tree topologies. Mol. Biol Evol. 13, 964}969.
C. Steiner et al. / Biochemical Systematics and Ecology 28 (2000) 963}973
973
Tamura, K., Nei, M., 1993. Estimating of the number of nucleotide substitutions in the control region of
mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512}526.
Voss, R.S., Emmons, L.H., 1996. Mammalian diversity in Neotropical lowland rainforests: a preliminary
assessment. Bull. Amer. Mus. Nat. Hist. 230, 1}115.
Wilson, D.E., Reeder, D.M., 1993. Mammal species of the world. A taxonomic and geographic reference,
Second Edition. Smithsonian Institution Press, Washington.
Yang, Z., 1994. Maximum likelihood phylogenetic estimation from DNA sequences with variable rates over
sites: approximate methods. J. Mol. Evol. 39, 306}314.