74 D
Apaf-1 variants that might be functional homologs of pressed proteins corresponding to residues 1–563 not
CED-4L. including the 11 residue insert of the published protein
We report here the identification and characterization of sequence PID: g2330015, Accession[: AF013263. Se-
a murine variant of Apaf-1, termed Apaf-1L in accordance quences for the Not I and Xho I restriction sites were also
with the nomenclature of the homologous transcript that included in these primers for convenience in cloning.
was recently identified in human cells [11,15,48]. This The human apaf-
1, apaf-1L, apaf-1 5 9, and apaf-1L 5 9 variant contains an eleven amino acid insert that is similar,
clones were also subcloned into the yeast expression but not identical to the insert found in human Apaf-1L.
vectors pSD10 or Y.lexA [40] for yeast growth assays and Ribonuclease protection analysis in mouse tissues revealed
two-hybrid analysis. The same clones were also subcloned that apaf-
1 and apaf-1L have similar, ubiquitous patterns into the mammalian expression vector pCMV5 [2,7] for
of expression. However, apaf- 1L transcripts were con-
mammalian cell transfection assays. The cDNAs for sistently more abundant than those of apaf-
1. The relative human procaspase-
9, procaspase-9 S b, and procaspase-3 position of the insert in Apaf-1L is different to the location
were also obtained from Hela cell cDNA by PCR and of the insert in CED-4L. However, the two inserts show
subcloned into the above vectors. All clones were con- some sequence similarity at the amino acid level. We show
firmed by DNA sequence analysis. that, functionally, Apaf-1L is able to form homodimers and
Yeast expression vectors containing Bax, CED-3, CED- heterodimers with Apaf-1. Apaf-1L, like Apaf-1, also
4, and CED-9 are described previously [40]. The cDNA interacts with caspase-9 and a naturally occurring domi-
for CED-4 was also cloned into the pCMV5 expression nant-negative form of caspase-9. Mammalian cell transfec-
vector for use in mammalian cell transfection studies. tion experiments show that both Apaf-1 and Apaf-1L
potentiate cell death when co-expressed with caspase-9. 2.2. RNase protection assays
Although Apaf-1L may be somewhat more potent than Apaf-1 there are no fundamental differences in the binding
RNase protection assays were performed using RNase or biological properties of the two variants.
T2 as previously described [30]. RNA was isolated from various adult and embryonic mouse tissues using the
RNeasy kit Qiagen. An apaf- 1L antisense riboprobe was
2. Materials and methods generated using the 257 bp PCR product described above,
which was
subcloned into
the vector
BSSK1 2.1. Cloning and plasmid constructs
Stratagene. This riboprobe, which contains 200 nt up- stream of the insert, the 33 nt insert, and 25 nt downstream
In order to detect variants of apaf- 1, a scanning PCR
of the insert, gives an expected protected fragment of 257 strategy was employed. Oligonucleotide primers were
nt for the apaf- 1L mRNA species, while protected frag-
synthesized corresponding to various regions of the pub- ments of 200 nt and 25 nt are expected for apaf-
1 lished apaf-
1 mRNA sequence. PCR was performed using transcript. Since the 25 nt protected fragment is difficult to
mouse spleen
cDNA with
Turbo Pfu
polymerase detect in this assay, we used the 200 nt fragment as the
Stratagene according to the manufacturer’s recommended marker for the apaf-
1 transcript. protocol. PCR products were analyzed on an agarose gel
and compared to a DNA ladder. PCR products which 2.3. Cell culture and transfection
varied from their predicted size were cloned and sequenced by automated sequencing. One 257 bp PCR product was
Two-hundred and ninety three EBNA cells Invitrogen determined by sequence analysis to contain an insert. The
were cultured in 10 FBS in DMEM. Cells were plated in forward and reverse primers for this product were
6-well plates at 80 confluency 1 day before transfection. ATGGCGTCTTGTCAGTGATAGAGG and CACCTTC-
Transfection was performed using 2 mg of total DNA with ACACAGCACTGTCCTTG, respectively. This product
Superfect reagent Qiagen according to manufacturer’s was also used to generate an antisense probe for the RNase
protocol. All samples were cotransfected with either 0.1 protection assays described below.
mg of a CMVbgal vector or 0.1 mg of pEGFP vector Full length human apaf-
1 and apaf-1L clones were Invitrogen in order to visualize transfected cells. For
obtained by PCR using Hela cell cDNA with primers 59 samples transfected with the CMVbgal vector, 18 h after
CAT GAC CGCG GCCGCG ATG GAT GCAAAAGCTCG - transfection cells were fixed in a 4 paraformaldehyde
AAATT and 39 CATGACCCTCGAGTTATTCTAAAG- PBS solution for 5 min at room temperature. Cells were
TCTGTAAAATATAT, corresponding to the 59 and 39 then washed gently three times with PBS. Staining for
ends of the published mRNA sequence. The clones apaf- 1
bgal was performed by adding 1 ml of staining solution 59 and apaf-
1L 59 were also obtained by PCR of Hela cell PBS containing 5 mM K FeCN , 5 mM K FeCN , 2
3 6
4 6
cDNA using the same 59 primer shown above with the 39 mM MgCl , and 1 mg ml X-gal to cells. Plates were then
2
primer CATGACCCTCGAGGAAGTTTCCGGCTCACA- sealed and placed in a 378C incubator for 3 h. For cells
GAG. The truncated apaf- 1 clones obtained give ex-
cotransfected with the pEGFP vector, propidium iodide
D .W. Walke, J.I. Morgan Brain Research 886 2000 73 –81
75
was added to the cell medium 18 h after transfection at a as apaf-
1L, in accord with the nomenclature of the human concentration of 0.4 mg ml and cells were placed back in
homolog. The amino acid sequences of mouse and human the incubator for 30 min. Cells expressing GFP green or
Apaf-1L inserts are compared in Fig. 1B. Analysis of these taking up propidium iodide red were observed using
amino acid sequences revealed no obvious structural or florescence microscopy. The number of green living and
functional motifs. However, the insert present in CED-4L red dead cells were counted in four different fields per
has some sequence similarity to a region in Apaf-1L that well.
contains the insert Fig. 1B. This region of similarity in both mouse and human Apaf-1L encompasses the insert
2.4. Yeast growth and two hybrid assays and 5 additional amino acids flanking its carboxyl terminus
side that are common to Apaf-1 and Apaf-1L Fig. 1B. Yeast growth and two hybrid assays were performed as
Despite this similarity, the insert in Apaf-1L is located in a previously described [25,39].
different part of the molecule compared to the insert in CED-4L. In CED-4L, the insert is located between the
Walker’s A- and B-box consensus sequences for nucleotide
3. Results binding sites [41], while the insert in Apaf-1L lies N-
