tissues to the liver. This glycoprotein mediates the transfer of cholesteryl esters from HDL or LDL into
triglyceride-rich lipoproteins, and thereby stimulates re- verse cholesterol transport [8]. The CETP mRNA en-
codes
a polypeptide
of Mr53000,
which is
N-glycosilated at four sites, giving rise to the mature form of CETP of Mr74000 [9]. The CETP gene encom-
passes 16 exons and it has been assigned to chromo- some 16 16q21 near the LCAT locus. Sib pair linkage
analyses have suggested that variation in HDL-C be- tween individuals was related to the inheritance of
alleles at or near the cholesteryl ester transfer protein CETP gene [10]. Several polymorphisms and rare
variants have been detected [11,12], and some of these have been shown to have a significant effect on plasma
lipid levels [12 – 14]. A common polymorphism detected using TaqI TaqIB has been shown to be a silent base
change affecting the 277th nucleotide in the first intron of the CETP gene [15]. The allele carrying the cutting
site for the TaqI enzyme is called B1, whereas the one in which the cutting site is missing is known as B2. This
polymorphism has been consistently associated with plasma levels of HDL-C, individuals carrying the B2
allele having the highest levels of HDL-C [16 – 18]. However, this association might be population specific
[14,19] and highly influenced by environmental factors such as alcohol consumption and tobacco smoking
[17,20,21]. Therefore, the aim of this study was to estimate allele frequencies of the TaqIB polymorphism,
and to investigate the relationship between this poly- morphism and plasma lipid levels taking into account
other biological and environmental factors in a healthy population from Valencia on the Mediterranean coast
of Spain. This region presents an unusually high rate of cardiovascular disease that, at the present time, is the
highest in the country [22]. The results of this research could contribute to our understanding of the genetic
and environmental factors associated with cardiovascu- lar risk.
2. Methods
2
.
1
. Subjects and study design This work is part of a broader population survey on
cardiovascular risk factors in the Valencia Community, aimed to ascertain the prevalence of both genetic and
environmental CHD risk factors in this population. In this paper we present data obtained in a cross-sectional
study with 514 healthy, unrelated subjects 231 men and 283 women residing and working in Valencia. These
subjects were randomly selected from more than 5000 employees examined in a Medical Center Mutua de
Accidentes de Trabajo y Enfermedades Profesionales. A random sample was selected and invited to partici-
pate in this study. Informed consent was only obtained in 63 of those invited. More men than women refused
to provide a blood sample for the genetic analysis. Previously validated questionnaires were distributed at
the time of the medical check-up, and participants were invited to fill them. Non-Caucasians, pregnant and
hysterectomized women, individuals taking any lipid lowering drug or those who were diagnosed of any type
of cardiovascular disease, were excluded from the study at this stage. The final group size used in this study
included 514 participants with a mean age of 36.3 years range: 17 – 66.
2
.
2
. Sample and data collection A venous blood sample was collected in the morning
during the medical check-up into EDTA-containing glass tubes after overnight fasting. The same day,
aliquots of the whole blood tubes were transported to the Central Laboratory of the Medical Center for
plasma lipid analyses, and to the Laboratory of the Genetic and Molecular Epidemiology Unit, for DNA
isolation and genotyping.
Anthropometric measurements were taken using standard techniques: weight with light clothing by digi-
tal scales; height without shoes by fixed stadiometer. Body mass index BMI was calculated as the ratio of
weight to the square height kgm
2
. Blood pressure was taken with a calibrated mercury
sphygmomanometer following the WHO MONICA protocol with the average of two consecutive readings
of the first and fifth Korotkoff sounds for systolic and diastolic blood pressure SBP and DBP, respectively.
2
.
3
. Questionnaire Data on ethnicity, nationality, place of residence,
date of birth, gender, marital status, type of education, profession, medication, possible pregnancies or hys-
terectomies, health problems, tobacco smoking, alcohol consumption and physical activity, were assessed by a
self-administered questionnaire, that had been previ- ously validated in a small sample of this population.
This questionnaire contained detailed questions about tobacco smoking, including number of cigarettes
smoked, number of years smoking, and years without smoking in the case of ex-smokers. Current smokers
were defined as those smoking at least one cigarette a day. Former smokers were defined as those who
smoked regularly at least one cigarette a day but had not smoked for over one month before the examina-
tion. Alcohol consumption was carefully evaluated by a set of 22 questions about the use of alcoholic beverages
during workdays Monday to Friday, and weekends Saturday and Sunday. This use was addressed by
questions on the consumption of the 11 most common
types of alcoholic beverages consumed in Spain, which presumably covered all types of alcoholic beverages
usually consumed. For each item, the questionnaire included seven frequency categories, and requested in-
formation on the number of glassesday. For each item, glassesday were calculated by adding the weekend
consumption to the workday consumption. For each alcoholic beverage, mean of daily ethanol consumption
in grams was calculated by multiplying the amount consumed in ml by the percentage of ethanol supplied
by each specific beverage. From the reported alcoholic beverages, alcohol consumption was categorized as a
drinker variable according to the amount of alcohol consumed. Men and women were classified into three
groups according to the population tertiles: No con- sumption alcohol consumption = 0 gday, Moderate
B 10.5 g alcoholday for men, and B 5.5 gday for women, and High consumption \ 10.6 g alcoholday
for men, and \ 5.6 g alcoholday for women. In some analyses, only two categories were considered: non-
drinkers alcohol consumption = 0 and drinkers sub- jects with any amount of alcohol consumed.
Physical activity was estimated by questions about regular leisure-time physical sports aerobics, basket-
ball, bicycling, gymnastics, running, soccer, squash, swimming, tennis, volleyball, and others, as well as the
average number of h per week spent in each activity. According to the type and time [23], subjects were
categorized as Sedentary no physical exercise, Moder- ate one sport less than 3 hweek and High one sport
more than 3 hweek or more than two sports. For regression analyses, physical exercise was also dichoto-
mized into Sedentary versus Active Moderate plus High. In addition to the type and time spent per week
in physical exercise, another question about regular daily walking more than 20 min, with two possible
answers ‘yes’ and ‘no’, was also included.
Marital status, classified as married, single and di- vorced, was dichotomized as being Single living alone
and divorced or Living with a partner. Education was initially coded into five categories: Non-schooling, Pri-
mary school, Secondary school, University-1 short cy- cle and University-2 long cycle, and afterwards
recoded into three levels: Primary, Secondary and Uni- versity short + long cycles.
2
.
4
. Laboratory analyses Plasma total cholesterol and tryglicerides were deter-
mined by a Technicon Chem 1 assay Technicon Instru- ments, Tarrytown, NY, and HDL-C was measured in
the supernatant after precipitation of apolipoprotein B — containing lipoproteins with heparin-manganese
chloride. LDL-C was calculated according to the equa- tion of Friedewald et al. [24] for samples with serum
triglyceride concentrations below 400 mg per deciliter.
2
.
5
. DNA extraction and genotyping Genomic DNA was extracted from white blood cells
by phenol extraction. A fragment of 535 base pairs in the intron 1 of CETP gene was amplified by polymerase
chain reaction PCR. Each amplification was per- formed using 500 ng of genomic DNA in a volume of
50 ml containing 40 pmol of each oligonucleotide U: CACTAGCCCAGAGAGAGGAGTGCC and L: CT-
GAGCCCAGCCGCACACTAAC, 0.2 mM dNTPs, 1.5 mM MgCl
2
, 10 mM Tris pH 8.4 and 0.25 U of Taq polymerase Gibco BRL, Paisley, UK. The PCR con-
ditions were 95°C for 5 min, and subsequently 28 cycles at 95°C for 30 s, 60°C for 30 s, and 72°C for 45 s, and
finally at 72°C for 5 min. The PCR products were subject to restriction enzyme analysis by digestion with
4 units of the restriction endonuclease TaqI for 16 ml of PCR sample at 65°C for 2 h, in the buffer recom-
mended by the manufacturer Pharmacia Inc. Sweden.
3. Statistical analysis
