26 M
Table 1 GABA receptor subunit-selective RT–PCR primers
A
Subunit Primer sequence 59 to 39
Position Product size
a1 sense AGCTATACCCCTAAC
1178–1482 304
TTAGCCAGG a1 antisense
AGAAAGCGATTCTC AGTGCAGAGG
b2 sense TGAGATGGCCACAT
1201–1518 317
CAGAAGCAGT b2 antisense
TCATGGGAGGCTGG AGTTTAGTTC
g2S sense AAGAAAAACCCTGCCCCTACAATT
1156–1492 336
g2S antisense TTCGTGAGATTCAGCGAATAAGAC
g2L sense CTTCTTCGGATGTTTTCCTTCAAG
1144–1534 390
g2L antisense CATAGGGTATTAGATCGTTGGACT
to completely denature the template. The thermocycler was applied to the drinking tube, responding decreased P,
then programmed for 32 cycles, with each cycle consisting 0.001 as a function of increasing shock intensity Fig. 1a,
of a temperature of 958C for 45 s, 558C for 45 s, and 728C demonstrating that responding was punished. Intensities
for 45 s, followed by a final elongation step 728C for 6 greater than 0.2 mA significantly decreased responding
min. PCR products were digested overnight with 10 units P,0.001. When the shock intensity was 0.5 mA the
Bgl II and separated on a 1.8 agarose gel in 0.53Tris intensity used for all subsequent studies the number of
Borate EDTA buffer, stained with ethidium bromide and shocks was 28.863.94 for non-injection controls and
photographed under UV illumination. Adjacent lanes with 30.062.88 for vehicle controls Fig. 1b. Fig. 1b also
control PCR samples no template were always included shows that increasing doses up to 1.2 mg kg of al-
to determine background. prazolam dose-dependently increased P,0.01 punished
Data are presented as the log ratio of density of the responding. Doses higher than 1.2 mg kg increased
amplified cRNA internal standards to the density of target punished responding less than 1.2 mg kg, possibly due to
GABA subunit mRNA amplification product and plotted their mild ataxic effects. Although significant increases
A
against the log of known amounts of internal standard were obtained at all doses from 0.6–4.8 mg kg P,
cRNA added to the test sample to generate a competitive 0.001, 1.2 mg kg was used for all subsequent studies
PCR linear regression curve. The absolute amount of target because it produced maximal increases 208.8611.08
GABA subunit mRNA was calculated from the curve as shocks session. Fig. 1c compares the effects of saline,
A
the point of equivalency see arrows, Fig. 3, where the vehicle and alprazolam on punished and non-punished
ratio of internal standard to target RNA was equal to 1. responding. The number of shocks taken under the punish-
ment compared to the no punishment conditions was 2.6. Statistical analyses
significantly different for both saline and vehicle. Al- prazolam significantly P,0.0001 increased punished
All data behavioral, binding and RT–PCR were ana- responding compared to both saline and vehicle controls.
lyzed using a two-way analysis of variance with Neuman– Keuls post hoc tests. Differences were considered signifi-
cant if P-values less than 0.05 were obtained. All data are 3.2. Receptor autoradiography
expressed as the mean6S.E.M. Data for licking are
3
characterized as the number of shocks per session, as five Fig. 2 shows that [ H]Ro 15-1788 binding was topog-
licks always produced a shock, regardless of intensity. raphically distributed in the sections that were studied.
Table 2 shows that among the 20 brain regions studied, the
3
greatest density of specific [ H]Ro 15-1788 binding was
3. Results found in the cerebral cortex. Moderately high levels of
binding were observed in CA1 and dentate gyrus of the 3.1. Behavior
hippocampus, basolateral amygdaloid nucleus and medial amygdaloid nucleus. The CA3 and CA2 areas of the
Without shock, water-restricted animals responded al- hippocampus, central amygdaloid nucleus, several nuclei
most without interruption resulting in 203.567.34 shocks of the thalamus and hypothalamus, medial mammillary
0 mA per 10 min session 5 licks51 shock. Vehicle nucleus, ventral tegmental area and substantia nigra dis-
3
204.367.94 shocks session
and alprazolam
played moderate levels of [ H]Ro 15-1788 binding. The 208.8367.27 shocks session had no effect on non-
caudate–putamen and laterodorsal thalamic nucleus ex-
3
punished responding see Fig. 1c. When shock was hibited relatively low densities of [ H]Ro 15-1788 binding.
M . Liu, J.R. Glowa Brain Research 887 2000 23 –33
27
Fig. 1. Effects of alprazolam and punishment of responding in rats. Water-restricted rats were trained to lick a tube attached to a water bottle. The top frame A illustrates the effects of shock intensity on licking, when each fifth lick produced a shock. The middle frame B illustrates the effects of vehicle
and different doses of alprazolam 0.3–4.8 mg kg on responding suppressed by 0.5 mA shock. The bottom frame compares the effects of saline, vehicle or alprazolam 1.2 mg kg on responding during non-punished conditions and that occurring when each fifth response produced a 0.5 mA shock
3
punished. These animals were the same as those used to assess the effects of punishment and alprazolam on [ H]Ro 15-1788 binding and GABA
A
receptor subunit transcription. Significant differences denoted by: P,0.001, compared to vehicle or nonpunished control; P,0.0001, compared to punished control or vehicle.
28 M
Fig. 2. Representative autoradiograms of midbrain coronal sections for three conditions of this study: A control; B punishment; C punishment plus alprazolam. Each of the regions identified, the cerebral cortex CC, basolateral amygdaloid nucleus B, medial amygdaloid nucleus M, mediodorsal
3
thalamic nucleus MD, and ventrolateral thalamic nucleus V, exhibited decreased levels of [ H]Ro 15-1788 binding during punishment compared to
3
controls. However, only the changes in [ H]Ro 15-1788 binding in the basolateral amygdaloid nucleus and mediodorsal thalamic nucleus exhibited significant changes during punishment. Regardless, all of these effects were reversed by alprazolam, compared to punished vehicle.
3
Alprazolam had no effect on [ H]Ro 15-1788 binding punishment, punishment plus vehicle and punishment plus
3
under the non-punished condition. alprazolam. Punishment significantly decreased [ H]Ro 15-
3
Table 2 also shows the changes in [ H]Ro 15-1788 1788 binding in the basolateral amygdaloid nucleus 12
binding in the same brain regions of rats exposed to and the mediodorsal thalamic nucleus 15, compared to
Table 2
3 a
Changes in [ H]Ro 15-1788 binding in brain regions of rats as a function of treatment condition Brain region
Non-punished responding Punished responding
Saline Vehicle
Alprazolam Saline
Vehicle Alprazolam
Cerebral cortex 260.368.5
263.667.6 259.266.4
247.466.9 248.268.3
258.966.6
Hippocampus CA1
222.063.4 219.864.4
224.964.3 218.765.2
220.167.1 225.065.9
CA2 170.465.2
165.565.4 168.266.3
171.465.6 169.967.8
175.064.0 CA3
187.865.4 191.766.2
187.065.4 179.966.3
183.368.7 187.664.7
Dentate gyrus 233.265.7
228.967.4 225.965.8
223.068.2 224.168.0
235.065.9
Caudate–putamen 83.063.1
81.664.6 79.564.2
80.862.7 83.763.3
78.862.8
Amygdala Central amygdaloid nucleus
144.966.2 142.064.7
146.665.4 137.266.0
141.066.3 153.765.5
[
Basolateral amygdaloid nucleus 240.968.0
236.464.8 234.766.6
206.65.8 212.268.6
231.667.0 Medial amygdaloid nucleus
207.268.1 209.765.7
206.965.7 188.466.6
191.667.3 212.865.1
Thalamic nucleus Centromedial thalamic nucleus
183.8610.0 178.669.5
176.6610.1 181.1611.1
173.569.3 180.6610.2
[
Mediodorsal thalamic nucleus 171.667.3
168.765.6 169.566.1
142.666.0 146.065.1
165.167.2 Ventrolateral thalamic nucleus
150.067.3 152.967.4
147.566.2 124.666.0
128.766.9 140.565.3
Ventroprosterior thala nucleus 118.266.4
122.665.3 116.165.3
107.365.8 113.265.4
111.764.0 Laterodorsal thalamic nucleus
77.162.3 73.463.2
79.463.7 73.862.0
78.962.8 74.862.7
Hypothalamic nucleus Ventromedial hypothalamic nu.
173.765.3 174.864.3
177.364.8 170.965.2
175.465.9 178.165.3
Anterior hypothalamic nucleus 167.166.6
159.864.3 164.666.2
166.365.3 165.966.7
172.466.2 Lateral hypothalamic area
145.366.4 149.266.7
147.163.9 139.266.1
142.166.7 147.866.0
Medial mammillary nucleus 131.167.8
124.667.8 126.066.8
129.667.7 128.867.8
122.867.0
Ventral tegmental area 113.163.0
116.963.8 110.564.3
114.364.5 108.864.2
109.964.6
Substantia nigra 107.568.0
111.165.8 106.964.1
105.866.8 102.565.5
99.065.2
a 3
[ H]Ro 15-1788 binding was measured using quantitative autoradiography as described in the text. Values are the mean 6S.E.M. fmol mg, specific
3
[ H]Ro 15-1788 binding per wet weight of tissue n56 per condition. Significant P,0.05 differences between punished and non-punished groups are indicated by an asterisk , while significant differences between treated and control punished groups are indicated by a pound [ sign.
M . Liu, J.R. Glowa Brain Research 887 2000 23 –33
29
average of saline saline and vehicle vehicle controls. In ratio of g2L mRNA to g2S mRNA for alprazolam plus
contrast to its effects on non-punished responding, al- punishment did not statistically differ from that of any
3
prazolam significantly increased [ H]Ro 15-1788 binding non-punished responding condition.
above vehicle and control levels in all regions in which punishment had decreased it basolateral amygdaloid nu-
cleus, F 54.808, P50.014; mediodorsal thalamic nu-
4. Discussion
