substitution that
changes the
glutamine CAG
residue at position 360 of the mature apo A-IV to histidine CAT. The frequency of this allele has been
studied in several populations and it ranges from 0.05 to 0.117 [14,15]. Several authors have reported an
association between this mutation and changes in fast- ing plasma lipid levels, but these results are controver-
sial. These variations are dependent on the sex [16], insulin levels and degree of obesity of the subjects
[17].
Individuals with
the apo
A-IV 360His
mutation have also been shown to present a different response in dietary intervention studies with a de-
creased response of low density lipoprotein LDL-C to cholesterol-enriched diets [18] and to diets with
a high fat and cholesterol content [19]. Moreover, in a recent
study it
was demonstrated
how the
re- placement of saturated fats by carbohydrates in the diet
produced a greater decrease in HDL-C and apo A-I plasma levels in carriers of the apo A-IV 360His muta-
tion [20]. In addition, it has been shown that this polymorphism interacts with body mass index BMI to
determine the postprandial lipemia in the EARS study [21].
Since apo A-IV can modulate LPL and postprandial lipid metabolism, it was studied whether the apo A-IV
360His mutation could bring about changes in the postprandial metabolism and if these changes could
explain the different lipid responses to dietary fat and cholesterol reported in the cited studies.
2. Materials and methods
2
.
1
. Human subjects Fifty-one healthy male subjects, 42 homozygous
for the most common allele, the apo A-IV 360Gln allele GlnGln, and nine carriers of the apo A-IV
360His allele His + two homozygotes and seven heterozygotes
were studied.
All subjects
were students at the University of Cordoba and all re-
sponded to an advertisement. They ranged in age from 18 to 49 years. None of them had liver, renal or
thyroid disease or diabetes. All subjects selected had the apo E33 genotype to avoid allele effects
of this gene locus on postprandial lipemia [22]. They were not taking medication or vitamins known to
affect plasma lipids. The fasting plasma lipid, lipo- protein, apolipoprotein levels, age and BMI according
to apo A-IV alleles are shown in Table 1. All studies were carried out in the Research Unit of the
Reina Sofia University Hospital. The experimental protocol was approved by the Human Investigation
Review Committee at the Reina Sofia University Hospital.
2
.
2
. Vitamin A fat-loading test After a 12 h fast, all subjects were given a fatty meal
enriched with 60 000 units of vitamin A per m
2
of body surface area. The fatty meal consisted of two cups of
whole milk, eggs, bread, bacon, cream, walnuts and butter and it was consumed in 20 min. This meal
provided 1 g of fat and 7 mg of cholesterol per kg body weight, and it contained 60 of calories as fat, 15 as
protein and 25 as carbohydrates. After the meal, subjects were not allowed to consume any calorie-con-
taining food for 11 h. Blood samples were drawn before the meal, every hour until the 6th hour and every 2nd
hour and 30 min until the 11th hour.
2
.
3
. Lipoprotein separations Blood was collected in tubes containing EDTA to
give a final concentration of 0.1 EDTA. Plasma was separated from red cells by centrifugation at 1500 × g
for 15 min at 4°C. The chylomicron fraction of triacyl- glycerol rich lipoproteins large-TRL was isolated from
4 ml of plasma overlayered with 0.15 M NaCl, 1 mM EDTA pH 7.4, d 1.006 gml by a single ultracentrifu-
gal spin 28 000 × g, 30 min, 4°C in a 50 type rotor Beckman Instruments, Fullerton, CA. Chylomicrons,
contained in the top layer, were removed by aspiration after cutting the tubes and the infranatant was cen-
trifuged at a density of 1.019 gml for 24 h at 115 000 × g in the same rotor. The non-chylomicron
fraction of TRL also referred to as small-TRL was removed from the top of the tube. All operations were
done in subdued light. Large and small TRL fractions were stored at − 70°C until assayed for retinyl palmi-
tate RP.
Table 1 Characteristics of the subjects at baseline according to apolipoprotein
apo A-IV 360GlnHis polymorphism 360GlnGln 42 360His+ 9
P value Age years
26 9 9 0.032
22 9 4 23 9 2
0.049 BMI kgm
2
25.5 9 3 0.134
4.26 9 0.82 Cholesterol
3.92 9 0.54 mmoll
Triacylglycerol 1.14 9 0.54
0.106 0.897 9 0.36
mmoll 2.39 9 0.57
2.48 9 0.77 0.700
LDL-C mmoll 1.21 9 0.28
HDL-C mmoll 1.24 9 0.36
0.726 0.527
0.103 9 0.26 0.98 9 0.16
Apo A-I gl 0.65 9 0.17
Apo B gl 0.70 9 0.24
0.430 10 24.4
4 44.4 No. smokers
0.273 One-way analysis of variance ANOVA.
2
.
4
. Lipid analysis Cholesterol and triacylglycerol in plasma and lipo-
protein fractions were assayed by enzymatic procedures [23,24]. Apo A-I and apo B were determined by tur-
bidimetry [25]. HDL cholesterol was measured by ana- lyzing the supernatant obtained following precipitation
of a plasma aliquot with dextran sulphate-Mg
2 +
, as described by Warnick et al. [26]. LDL cholesterol was
obtained as the difference between the HDL cholesterol and the cholesterol from the bottom part of the tube
after ultracentrifugation at 1.019 gml.
2
.
5
. RP assay The RP content of large and small TRL fractions
was determined using a method previously described [27]. Peaks of RP and retinyl acetate were identified by
comparing its retention time with a purified standard Sigma, St Louis, MO, and the RP concentration in
each sample was expressed in terms of the ratio of the area under the RP peak to the area under the RA peak
[28]. Here too, all operations were performed in sub- dued light.
2
.
6
. Determination of apo B-
48
and apo B-
100
Apo B-48 and apo B-100 were determined by SDS- polyacrylamide gel electrophoresis PAGE as described
by Karpe et al. [29]. Electrophoretic separation was performed using a 3 – 20 gradient polyacrylamide
gel with a vertical Hoefer Mighty Small II electrophore- sis apparatus. Gels were scanned with a videodensito-
meter scanner TDI, Madrid, Spain connected to a personal computer for integration of the signals. Back-
ground intensity was calculated after scanning an empty lane. The coefficient of variation for the
SDS-PAGE was 7.3 for apo B-48 and 5.1 for apo B-100.
2
.
7
. DNA amplification and genotyping DNA was extracted from 10 ml of EDTA-containing
blood. Amplification of a region of the apo A-IV gene was done by polymerase chain reaction PCR with 250
ng of genomic DNA and 0.2 mmol of each oligonucle- otide
primer P1:5-GCCCTGGTGCAGCAGATG-
GACAGCTCAGG-3 and P2:5-CATCTGCACCTG- CTCCTGCTGCTGCTCCAG-3 in 50 ml, according to
the method previously described [30]. Amplification of a region of 266-bp of the apo E
gene was done by PCR with 250 ng of genomic DNA and 0.2 mmol of each oligonucleotide primer E1,
5-GACACTGACCCCGGTGGCGGAG-3, and E2, 5- TCGCGGGCCCCGGCCTGGTACACTGCCA - 3
and 10 dimethyl sulfoxide in 50 ml according to the method previously described [20].
2
.
8
. Apo A-IV measurement Apo A-IV was measured in total plasma and in both
large and small TRL, in postprandial samples obtained at 0, 1, 3, 5, 8:30 and 11 h using an ELISA assay.
Briefly, polystyrene
microtiter plates
Nunc Im-
munoplate I were coated with affinity-purified poly- clonal apo A-IV antibody 10 mgml in PBS 0.1 M pH
7.4, 100 mlwell. The plates were covered with acetate plate sealers ICN and incubated overnight at room
temperature. The next day the solution containing the unbound Ab was removed and the remaining binding
sites in the plate were blocked using 0.5 bovine serum albumin RIA grade BSA, Sigma and 0.1 NaN
3
in PBS 1 h incubation. Plates were then washed 3 times
with PBS containing 0.5 Tween-20 PBST. Control and plasma samples were diluted 1:5000 in
PBS-BSA. Large and small TRL samples were diluted, 1500 and 1100, respectively. Two-fold serial dilutions
were performed for the plasma standard standard curve 333.3 – 10.4 ngml. Controls were prepared in the
laboratory by pooling plasma from different individu- als. Multiple aliquots were stored at − 70°C. Controls
were calibrated against a primary standard determined by amino acid analysis.
Aliquots 100 ml of standards, controls, and plasma samples were added to designated wells in the microt-
iter plate. Aliquots were diluted and thoroughly mixed immediately before addition. Controls and samples
were run in duplicate wells in each plate. After 2 h incubation at 37°C, the contents of the plate were
discarded and the plate was washed 3 times with PBST.
The goat-immunopurified anti apo A-IV Ab conju- gated to peroxidase was diluted in PBS-BSA at 1:5000
and 100 ml was added to each well. The plate was sealed and incubated at 37°C for 2 h. Following this incuba-
tion, the plate was washed 5 times with PBST. The substrate used for the enzymatic color reaction is ortho-
phenylene diamine OPD and H
2
O
2
in 0.1 M citrate buffer. This solution was added to each well 100 ml
and incubated for 30 min at room temperature, then it was read at 410 nm on a microtiter plate reader Dynat-
ech MR 600.
2
.
9
. Statistical analyses Several variables were calculated to characterize the
postprandial responses of plasma triacylglycerol, large- TRL and small-TRL to the test meal. The area under
the curve AUC is defined as the area between the plasma concentration versus time curve and a baseline
drawn parallel to the horizontal axis. This area was calculated with a computer program using the trape-
zoidal rule. Other variables were the normalized peak concentration, which was the average of the peak and
the second highest concentration above the baseline;
and the peak time, which was the average of the time to peak concentration and the time to the second highest
concentration. Data were tested for statistical signifi- cance between genotypes by analysis of variance
ANOVA and the Kruskal – Wallis test, and between genotypes and time by ANOVA for repeated measures
including the BMI and age as co-variants in all analy- ses. A probability value less than 0.05 was considered
significant. The maximum peak of triacylglycerol was used in small-TRL and AUC of triacylglycerol in small-
TRL as dependent variables and did stepwise multiple regression to identify other concomitant variables. The
independent variables included age, BMI, apo A-IV genotype, basal cholesterol, HDL-C and triacylglycerol
values. Discrete variables were divided into two classes for analysis. All data presented in the text and tables
are expressed as mean 9 S.D. adjusted by BMI and age as co-variant.
3. Results
