Tersedia online di: http:ejournal-balitbang.kkp.go.idindex.phpjra RESPONS IMUNITAS BENIH LOBSTER, Panulirus homarus DENGAN PENGGUNAAN PROBIOTIK PADA PAKAN MOIST

  Jurnal Riset Akuakult ur, 12 (1), 2017, 85-97

Tersedia online di: ht t p://ej ournal-balit bang.kkp.go.id/index.php/j ra

  

RESPONS IM UNITAS BENIH LOBSTER, DENGAN PENGGUNAAN

Panulirus homarus *) *) *) *)

PROBIOTIK PADA PAKAN M OIST

  

Haryanti , Sari Budi M oria Sembiring , Sudewi , Zeny W idiastuti ,

*) **)

Nyoman Adiasmara Giri , dan Ketut Sugama

Balai Besar Riset Bu didaya Laut dan Penyu luhan Pe rikanan

  

(Naskah dit erima: 21 November 2016; Revisi final: 10 M ar et 2017; Diset ujui publikasi: 20 M aret 2017)

ABSTRAK

Pemeliharaan benih lobster P. homarus masih menghadapi beberapa permasalahan, di antaranya infeksi

penyakit bakteri ( red body disease ) dan mortalitas yang tinggi. Tujuan penelitian ini adalah untuk mengkaji

respons imunitas benih lobster P. homarus yang diberi pakan pelet basah (moist diets) dengan penambahan

probiotik. Pemeliharaan benih lobster dilakukan secara individu (1 ekor/keranjang). Lama pemeliharaan

selama tiga bulan. Bobot awal puerulus P. homarus adalah 0,37 ± 0,05 g. Perlakuan meliputi pemberian

pakan moist yang ditambahkan (A) ragi Saccharomyces cerevisiae , (B) kombinasi probiotik, Alt eromonas sp. BY-

9 dan BC, dan (C) tanpa probiotik. Respons imunitas dianalisis dengan RT-qPCR melalui tujuh

  Bacillus cereus

gen target terkait ekspresi imunitas, setelah diuji tantang dengan Vibrio harveyi (penyebab red body disease ).

  

Hasil penelitian menunjukkan bahwa sintasan benih lobster sebesar (A) 32,22%; (B) 29,63%; dan (C) 33,33%.

Pertu mbuhan pan jang dan bobot benih lobster tidak berbeda nyat a (P> 0,05). Respons imunitas benih

lobster P. homarus pada perlakuan A dan B menunjukkan nilai ekspresi imun yang lebih tinggi dibandingkan

dengan perlakuan C (tanpa probiotik). Ekspresi gen penyandi anti lipopolisakarida (ALFHa-1) meningkat

pada (A) rata-rata sebesar 3,44 kali dan (B) 3,25 kali dibandingkan dengan perlakuan C (2,43 kali). Kelipatan

ekspresi profenoloksidase (proPO) benih lobster meningkat pada perlakuan A (penambahan ragi) rata-rata

sebesar 5,27 kali, sedangkan pada perlakuan B (kombinasi probiotik) sebesar 12,92 kali. Ekspresi Clot t ing

sistem (transglutaminase, clotting protein) dan ant ioxidant defense mechanism (glutathione peroxidase/GPO)

dan SAA juga mengalami peningkatan pada perlakuan A dan B.

  Panulirus homarus KATA KUNCI: benih lobster; ; probiotik; ekspresi terkait imunitas

  Immunity response of juvenile spiny lobster,

ABSTRACT: Panulirus homarus with probiotic supplementation on

moist diets. By: Haryanti, Sari Budi M oria Sembiring, Sudewi, Zeny W idiastuti, Nyoman Adiasmara Giri, and Ketut Sugama

  

A number of contrains including disease infect ions and significant mort alit y have been occurring in lobst er aquacult ure.

The aim of t his research was to obser ve t he immune response of juvenile lobst er P. homarus cult ure fed by moist pellet

supplemented wit h probiot ic . Experimental juveniles were reared in individual system (one juvenile/basket). The experiment

was conduct ed for t hree mont hs. The t reat ment s comprised (A) whole cell of yeast Saccharomyces cerevisiae, (B)

combinat ion of probiot ics Alteromonas sp. BY-9 and Bacillus sp. BC, and (C) wit hout probiot ic as cont rol. Init ial

weight of juveniles were 0.37 ± 0.05 g. Immunit y responses were analyzed using seven immunit y relat ed genes

expression by RT-qPCR. The result s showed t hat t he sur vival rat e of juvenile for t reat ment s A, B, and C were 32.22%,

29.63%, and 33.33% respect ively. The weight and lengt h gain of t he juvenile were not significant ly different (P> 0.05)

among treatments. Based on immunit y related gene expression analysis, it revealed that A and B t reat ment s have shown

differences in t he increament of immunit y responses. Expressions of ALFHa-1 genes were increased on (A) t reat ment

wit h average of 3.44 fold and (B) t reat ment (3.25 fold) and higher t han C t reat ment (2.03 fold). Prophenoloxidase

(ProPO) expression was increase average up t o 5.27 fold on A (yeast supplement at ed) t reat ment and B (combinat ion of

probiot ic) were 12.92 fold. Gene expression on Clot t ing syst em (t ransglut aminase, clot t ing prot ein) and ant ioxidant

  ) defense mechanism (glut at hione peroxidase/GPO was increased on A and B treat ment s.

  KEYW ORDS: puerulus; probiotics; # Panulirus homarus; immunity - related gen expression Ko r esp o n d e n si: Balai Be sar Riset Bu d id aya Lau t d an Pe n yu lu h an Pe r ikan an . Jl. Br. Go n d o l, Ke c. Ge ro kg ak Kab . Bu le le n g , Ko t ak Po s 1 4 0 , Sin g ar aja, Bali 8 11 0 1 , In d o ne sia. Te l. + (0 3 6 2 ) 9 2 2 7 8 haryant i @ i ndosat .net .i d

  E-m ail: Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

  85 Co p yright @ 2 017 , Jurnal Riset Akuakultu r, e-ISSN 250 2-65 34 Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i) PENDAHULUAN

  Lo b s t e r m e r u p a k a n k o m o d it a s e k s p o r ya n g dieksplo it asi dari penangkapan di laut . Hingga kini b e lu m a d a h a t ch e r i d i In d o n e s ia ya n g b e r h a s il m e m p ro d u k si la r va (p u e r u lu s ) a t au b e n ih (p o s t puerulus). Di samping meto de pembenihan yang belum dikuasai, juga diperlukan wakt u yang panjang unt uk memelihara lar va (6-9 bulan) sehingga dirasakan t idak e k o n o m is . Tin g g in ya p e r m in t a a n e k s p o r b e n ih lo bst e r, m en ye babkan p en an gkap an b en ih d i alam dilakukan secara int ensif.

  ., 2011; Luis-Villaseno r

  . (2011), dan Li

  et al

  . (2009), menyat akan bahwa penggunaan pro bio t ik pada udang

  L. va nn a m ei

  d a p a t m e n in g k a t k a n p e r fo r m a pert umbuhan, enzim pencenakan, resistensi penyakit ,

  immune gene expession

  , d an m en gu ran gi p re vale nsi infeksi virus at au bakt eri. Hasil uji t ant ang t erhadap

  Vibrio fluvialis pada Homarus americanus menunjukkan

  n ila i t r a n s k r ip s i r e s p o n s p r o t e in a n t im ik r o b a meningkat 17 kali (ClEark, 2013; Beale

  et al ., 2009).

  Efek pro t ekt if dan mengunt ungkan dari mikro ba at a u p ro b io t ik d isin ya lir d ap at b e rp e ran se b a gai im uno st imulan, im uno st im ulat o r, supleme n p akan, dan bahan aditif. Manfaat mikro ba atau probiotik sudah banyak dilaporkan antara lain untuk mencegah penyakit infeksi pada pemeliharaan krust asea dari st adia lar va, juvenil hingga ukuran ko nsumsi, sert a unt uk menjaga kualit as air (Fu

  et al

  et al

  . (2012), Karla

  ., 2011; Zho u

  et al

  ., 2009; Balcazar

  et al

  ., 2007; Ro driguez

  et al.

  , 2007).

  O le h k a r e n a it u , p o la e k s p r e s i g e n ya n g berhubungan dengan imunit as merupakan

  t ranscrip- t ional

  respo ns t erhadap infe ksi penyakit . Pe ngaruh bahan suplemen (imuno st imulan) akan berhubungan d e n gan sifat ge n o t ip e d a n t e re ksp re si p ad a sifat feno t ipe, yait u dengan menun jukkan ko ndisi sehat at au sakit .

  Be r d a s a r k a n u r a ia n d i a t a s , p e n e lit ia n ya n g berhubungan dengan respo ns imunit as lobster menjadi p ilih a n u n t u k m e n d a p a t k a n b e n ih ya n g s e h a t . Penelitian ini bert ujuan unt uk mendapat kan info rmasi t en t ang respo ns imun it as ben ih lo bst er

   P. homar us

  et al

  et al

  Budidaya lobster dengan keramba jaring apung (KJA) t e lah d ilaku kan d i b eb e rap a d ae rah d i In d o n e sia: Lo m b o k, Bim a , Sa p e , Su law e si Se lat an , Su law e si Tenggara, dan Aceh (Ujung Bat ee) dengan ko nt ribusi seb esar 2 ,6 7% (30 8 t o n/t ah un ) dari t o t al p ro du ksi bu did aya (Priyam bo d o , 201 4). Se men t ara, Viet n am merupakan negara dengan perkembangan budidaya lobst er yang pesat sejak t ahun 2005. Pro duksi tahunan lo bst er dihasilkan secara ko nsist en mencapai 1.500 t o n dengan bo bo t 300-500 g/eko r (

  Whit e Spot Syndrome Virus

  P. ornat us

  ) (Anh & Jo nes, 2014). Tingkat keberhasilan pemeliharaan lo bst er di In- do nesia masih rendah, t erut ama pemeliharaan pada t in g kat p u e r u lu s h in gga m e n jad i ju ve n il d e n g an sint asan hanya sekit ar 20%-50% (Shanks et al ., 2014). Hal yang sama juga dialami dalam pemeliharaan dari juvenil hingga ukuran ko nsumsi. Lo bst er

  P. homarus

  yang dipelihara dari ukuran juvenil 2 cm hingga 200 g selama enam bulan, hanya dipero leh sint asan < 50%. Namun, pembudidaya lo bst er P. ornat us di Viet nam selama delapan bulan pemeliharaan dari juvenil 2 cm hingga 350 g dapat mempero leh sint asan hingga 90%, b ila s is t e m p e m e lih a r a a n d a n n u t r is in ya b a ik (Priyam bo do & Sarifin , 20 09 ; An h & Jo ne s, 2 01 4). Mort alitas yang masih tinggi tersebut disebabkan o leh s ifa t k a n ib a lis m e a t a u in fe k s i p e n ya k it , s t r e s transpo rt asi, kualitas air, dan manajemen pemeliharaan yan g belum st andar. Be berapa pe nyakit pada sp iny lo bst er di ant aranya adalah

  milky hemolymph disease

  (Ano nymo us, 2007, Nunan et al ., 2010), red body dis-

  ease

  ,

  black gill disease

  ,

  red t ail disease

  (Sields, 2011), dan WSSV (

  ) (Clark

  St r at e gi u n t u k m e n gk o n t ro l p e n ya k it in fe ks i meliput i peningkat an kondisi lingkungan, penggunaan benih sehat , sert a peningkat an daya t ahan t erhadap penyakit dengan menggunakan pro bio t ik. Zo kaeifar

  et al

  ., 2 01 3). Beb e rap a p en e lit ian t e lah dilaku kan u n t u k mencegah t erjadinya in feksi penyakit , di ant aranya dengan perbaikan mut u lingkungan dan penyediaan p a k a n d e n g a n fo r m u la s i ya n g m e m a d a i. Ha s il penelit ian pengaruh paramet er lingkungan dan lama penampungan t erhadap respo ns imun pada

  P. homarus

  dan

  P. cygnus

  menunjukkan bahwa perubahan ekst rem lingkungan dan efek penampungan (empat hari) dapat menginduksi perubahan imunit as lo bst er (Verghese

  et al ., 2007).

  Info rmasi t ent ang penambahan dan penggunaan imunost imulan pada pemeliharaan benih lobster dalam b u d id aya m as ih t e rb at as. Ko m p o n e n yan g se rin g digunakan pada up aya peningkat an kesehat an d an p e n c e g a h a n p e n ya k it p a d a k r u s t a s e a a d a la h imuno stimulan (  -glucan). Kemampuan imuno stimulan d a la m m e n in g k a t k a n r e s p o n s k e k e b a la n t u b u h n o n s p e s ifik m e m p e r lih a t k a n h a s il p o s it if p a d a krustasea. Kerentanan t erhadap infeksi mikro ba sangat b e r h u b u n g a n d e n g a n

  i m m u no

  k o m p e t e n s i d a n kemampuan unt uk meno lak mikro o rganisme t ersebut (Haut o n

  et al

  ., 2013 , Jimenez-Vega

  et al ., 2004).

  yang diberi pakan moist pelet dengan penamb ahan p r o b io t ik. Has il p e n e lit ia n in i d ih a ra p k an d ap at digunakan unt uk peningkat an produksi lo bster melalui penyediaan benih lo bst er yang sehat pada perikanan budidaya yang dikembangkan di Indo nesia. Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

  87 Jurnal Riset Akuakult ur, 12 (1), 2017, 85-97

  dingin dan dise nt rifugasi kem bali dengan ke cepat an yang sam a . Se la n ju t n ya d ilaku kan e k st raksi t o t al RNA m e n ggu n akan laru ran lysis RNA ext r act ion d e n gan met o de IQ-2000 yang t elah dimo difikasi.

  Analisis RT-qPCR pada Gen yang Terkait dengan Im unitas P. homarus

  Larutan dalam mikro tub diinkubasi berturut-t urut pada suhu 25°C selama lima me nit , 42°C (15 menit ) dan 95°C selama lima men it . Laru t an cDNA selanju t nya d ile t a kkan d a lam e s u n t u k m e n gh e n t ikan re ak si sint esis dan disimpan pada suhu -20°C unt uk analisis berikut nya.

  ; 1,0 µL affinit y script RT ; dan 3,0 µg total RNA.

  ; 3,0 µL oligo (dT) primer

  Agilent Affinit y Script qPCR cDNA Synt hesis kit. Volume reaksi 20 µL yang terdiri atas 10,0 µL first st rand 2x mast er mix

  Sin t e sis cDNA ( com plement ar y DNA ) d ila ku k an dengan menggunakan

  ant icoagulant

  Pro PO

  He m o lim ya n g t e la h d ik o le k s i, k e m u d ia n disent rifugasi dengan kecepat an 12.000 rpm pada suhu 4°C selama 10 menit . Pelet hemo sit yang dipero leh dicuci sat u kali dengan larut an

  Ekspresi Gen Terkait Im unit as Isolasi Total RNA dan Sintesis cDNA

  secara kohabit asi. Uji tantang dilakukan selama 96 jam dengan int er val wakt u pengambilan hemo lim set iap 24 jam.

  red body disease

  p enye bab

  V. har veyi

  Pe n g a m a t a n s t a t u s im u n d ila k u k a n d e n g a n membandingkan tingkat ekspresi mRNA pada hemo sit benih lo bst er pada awal dan akhir perlakuan. Analisis e k s p r e s i g e n im u n it a s m e n g g u n a k a n RTq -PCR. Pengamatan respons imun dilakukan dengan uji tantang dengan

  Analisis pro fil st at us imun menggunakan met o de ekspresi t ranskripsi gen yang t erkait dengan imunit as secara kuant itat if dengan RT-qPCR dan primer spesifik mengikut i Wang et al . (2010) dan Clark (2013). Analisis

  ,

  d ih it u n g m e n ggu n ak an h e m o sit o m e t e r d i b awah mikro sko p cahaya dengan perbesaran 400x.

  (

  Nuclease Free Wat er

  (

  NFW

  masing-masin g 25 0 n M,

  sebanyak 20,0 µL dengan final konsentrasi 1x hot M aster mix ( Rox ), p asan gan p rim e r F/R 1 0 p m o l (Tab e l 2 )

  ). Vo lu me reaksi u n t u k am p lifikasi cDNA

  ROX

  Hot Firepol Evagreen qPCR mix

  Glut at hione Peroxidase

  dengan 5x

  sequens

  . (2010), sedangkan ALFHa- 1, ALFHa-2, SAA-Serum Amylo id Pro t ein A mengikut i Clark (20 13) sepe rt i t ert era pad a Tab el 2. Int e rn al ko n t ro l m en ggu n akan 18 SrRNA. An alisis RT-q PCR d ilaku k an m e n gg u n ak an ABI PRISM 7 5 0 0 sis t e m det eksi

  et al

  dengan met o de Wang

  Clot t ing Prot ein

  (GPo ),

  Stat us Im unitas

  dilakukan dengan mengambil hemolim (10 µL) dan

  BAHAN DAN M ETODE Pemeliharaan Benih P. homarus

  BC), dan (C) t anpa probiot ik. Masing-masing bahan pro bio tik dicampurkan dalam pakan

  moist

  Persent ase bahan baku unt uk pembuat an pakan

  Pem buatan Pakan M oist Pelet

  berupa pipa PVC dan waring yang dibent uk sep ert i kipas unt uk persemb unyian benih lo bst er. Benih lo bst er dipelihara selama t iga bulan. Pe r co b a an d e n ga n r a n ca n g a n a ca k le n g k ap d a n d ia n a lis is d e n g a n ANOVA. Se la m a p e m e lih ar aa n dilakukan pembersihan sisa-sisa makanan, pergant ian air dengan sist em mengalir. Pengamat an pert umbuhan panjang dan bo bo t , sert a sint asan dilakukan set iap bulan, dan penghit ungan hemo sit dilakukan pada awal dan akhir pemeliharaan.

  shelt er

  Ukuran rat a-rat a bo bo t benih yang digunakan adalah 0,37 ± 0,0 5 g dan panjan g t o t al 2,34 ± 0,25 cm. Pemeliharaan benih lo bst er dilakukan secara individu (1 eko r/keranjang), setiap perlakuan menggunakan satu s e t r a n g k a ia n k e r a n ja n g (t e r d ir i a t a s s e m b ila n keranjang) dan diulang dua kali. Keranjang berbent uk bulat (diamet er 20 cm, t inggi 30 cm) dan diapungkan d alam b ak b e t o n vo lu m e 5 m 3 . Se t iap ke ran jan g diberikan

  moist pelet .

  cillus cereus

  Alt eromonas

  ; (B) ko mbinasi pro bio t ik ( Alt eromonas sp. BY-9 dan Ba-

  S. cerevisiae

  (A) ragi,

  whole cell

  pe le t d e ngan perlakuan penambahan

  moist

  Ben ih lo b st e r d ib eri pakan

  adalah tepung pelet udang (24,77%); tepung rebon (2 4 ,7 7 %); cu m i d an u d an g s e g a r m a s in g m as in g (24,77%); sert a perekat (CMC) (0,74%); dan vitamin mix (0,19%). Campuran t ersebut dit ambahkan mikroba ragi (100 m L, kepadat an 10 11 sel/mL), sed angkan u nt uk perlakuan ko mbinasi pro bio t ik (

  sp. BY-9 d an Bacillus cer eus BC), p akan moist d it am b ah kan p ro b io t ik t e rse b u t m asin g-m asin g 5 0 m L d e n gan kep ad at an 1 0 12 sel/m L). Set e lah t e rcam p ur, b ah an digiling unt uk menghasilkan

  dingin (2% NaCl; 0,1 M gluco se; 30 mM Na cit rat ; 26 mM asam citrat; 10mM EDTA). Pengambilan hemo sit hanya dilakukan pada awal dan akhir perlakuan sebanyak t iga eko r set iap perlakuan. Pe nghit ungan t o t al he mo sit

  Hem o lim diko leksi p ada b enih lo b st er dari

  ant icoagulant

  1 mL yang berisi senyawa

  sy- ringe

  dan

  gauge

  menggunakan jarum 25

  ven- t ral-sinus cavit y

  Penghitungan Hem osit

  moist

  t ert era pada Tabel 1.

  moist

  dilakukan secara berkala unt uk menghindari t erjadinya penurunan nilai nut risi. Kompo sisi pro ksimat pakan

  moist

  t ersebut selanjut nya dikeringanginkan selama t iga jam dan disimpan di dalam lemari pendingin pada suhu 5-6°C. Pembuat an pakan

  moist

  pelet . Hasil pakan

  ) Co p yright @ 2 017 , Jurnal Riset Akuakultu r, e-ISSN 250 2-65 34 Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i) ditambahkan hingga volume 20 µL dan cDNA (0,01

  ng/uL). Ko ndisi suhu

  

Table 2. Primer sequence t hat were used for immune – relat ed gen analysis of j uvenile P. homarus by RT-qPCR

Sist em i m un

  Gp o ALFHa-1 An tio xid ant d efen se mech an ism p r o PO activatin g system Clo ttin g System An timicr o b ial p ep tid e system Pr o p hen o lo xid ase

  

1 8 s-F/R

p r o PO Tgase CP

  Ser um amylo id p r o tein In ter nal con tro l 1 8 s SAA SAA F/R

  EE 5 7 2 3 0 5 DQ9 8 4 1 8 2 AY 9 7 3 2 5 2 EU6 2 5 5 16 ALFHa-2 ALFHa-2F/R SAA

  CP-F/R GPO-F/R

ALFHa-1F/R

EF 5 6 5 4 6 9

  18 s RNA F:AGCAGGCTGGTTTTTGCTTA R:AGCAGGCTGGTTTTTGCTTA FC5 5 6 43 0 EH1 1 6 0 55 AF 1 8 6 2 5 0

p r o PO-F/R

Tgase-F/R

  F:AGACTACCACTGACTTCGTGAGGA R:TCTCGGGATGATCCGTTAACACCT F:TACCACTACCAGCACTCATCACCT R:TCAAACACAGAGAATAGGCACGGG

  An ti-Lip op o ly- sach ar id e F:CAGTCGTTCTGGTGTTGTTGGGAA R:TTGTTGGGCATCCCTCTCGGTTAT

  F:TCTTTGCGCAGTTGGTGATC R:TGAGGTGACCGAGTGCAAAA F:TTTTTCCGTGCAAAAAGGAC R:TAATACGCGATGCCCCTAAC

  F:GAGATCGCAAGGGAGAACTG R:CGTCAGTGAAGTCGAGACCA F:CCTCAGGATCTCCTTCACCA R:TTGGGAAAACCTTCATTTCG

  Prim er Sequence (5"-3") Bank gen Gene bank

  Nam a Nam e

  Imm une system Target gen Gene tar get

  dengan RT-qPCR

  cycling

  P. homarus

  Tabel 2. Sekuens primer yang digunakan untuk analisis gen t erkait dengan imunit as benih lobst er

  Perl akuan ( Treatments ) Kom posisi proksim at Pr oximate composition

  Fat ) 6 .3 1 6 .1 2 6.0 3

Ab u ( Ash ) 12 .1 8 1 2 .4 1 1 2 .1 8

  A B C

Air ( M oist ure ) 9 .5 7 9 .1 8 1 0 .3 4

Pr otein 50 .3 5 4 9 .4 1 4 8 .8 7

Lemak (

  P. homarus

Table 1. Proximat e composit ion of moist diet used for rear ing j uvenile of lobst er

P. homarus

  secara individu Tabel 1. Ko mpo sisi pro ksimat pakan mo ist yang digunakan unt uk pemeliharaan benih lo bst er

  P. homarus

  Ha s il ya n g d ip e r o le h m e n u n ju k k a n b a h w a pemeliharaan benih lo bst er,

  HASIL DAN BAHASAN Perform a Pert um buhan dan Sint asan Benih Lobst er P. homarus

  Pen ghit ungan  Ct dari t hreshold siklu s PCR (Ct ) gen yang diuji dino rmalisasi secara relat if t erhadap Ct 18sRNA (int ernal ko nt ro l) pada sampel yang sama. Nilai  Ct dihit ung dari  Ct (kelo mpo k sampel yang diuji) -  Ct (e ksp re si awal). Rep resen t asi kelipat an re lat if yang be rbe da t e rhadap e ksp resi awal d ap at dihit ung dengan 2

  • -  Ct

  60°C (3 0 det ik) se ban yak 4 0 siklus d an su hu e kst e n si akhir 60 °C selama sat u menit .

  annealing

  unt uk RT-qPCR terdiri at as suhu awal denat urasi 95°C (15 menit ) diikut i dengan 95°C (15 det ik) dan suhu

  Tr an sg lu tamin ase Clo tting pr o tein Glu tath ion e p er o xid ase Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

  89 Jurnal Riset Akuakult ur, 12 (1), 2017, 85-97 memberikan laju pertumbuhan bobot dan panjang yang t idak berbeda (P> 0,05) sepert i t erlihat pada Gambar

  III Awal

  P. homarus

  yang dipelihara secara individu dengan pakan moist yang dit ambah (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

  

Figure 1. Growt h performance of body weight (g) and t ot al lengt h (cm) j uvenile of spiny lobst er P. homarus reared

wit h individually syst em and fed moist diet s supplement ed wit h (A) yeast S. cerevisiae (B) combinat ion of probiot ic, and (C) wit hout probiot ic

  1

  2

  3

  4

  5

  6 P

  a n ja n g t o ta l ( T o ta l le n g h t )( c m )

  Wakt u pe me liharaan (bulan)

  Cult ure period (mont hs)

  A B C

  I II

  Initial

  ) t e rt inggi dalam m enghasilkan hem o sit (196,5 x 10 4 sel/mL) (Gambar 3), sedangkan jumlah

  o b o t b a d a n ( B o d y w ei g h t )( g )

  Initial

  III Awal

  I II

  A B C

  Cult ure period (mont hs)

  Wakt u p em eliharaan (b ulan)

  4 B

  0.5

  3.5

  3

  2.5

  2

  1.5

  1

  Gambar 1. Keragaan (A) pert umbuhan bo bo t (g) dan (B) panjang t o t al (cm) benih lo bst er

  S. cerevisiae

  1. Hasil pengamat an bo bo t akhir benih lo bst er yang d ib e ri p ak an moi st d e n gan p e n am b ah an ragi (A), ko m b in as i p ro b io t ik (B), d an t an p a p ro b io t ik (C) masing-masing sebesar 3,77 ± 1,72 g; 3,29 ± 2,06 g; dan 3,47 ± 1,4 g. Semen t ara, pert ambah an bo bo t benih lo bst er selama t iga bulan pemeliharaan adalah (A) 3,4 g; (B) 2,92 g; dan (C) 3,1 g.

  (2013) dan Daniel et al . (2010) menjelaskan t ent ang st u d i m e n g o m b in as ika n p ro b io t ik d an p r e b io t ik (

  Bila dilihat dari ko mpo sisi pro ksimat pakan mo ist p e le t , p e n a m b ah an ra gi

  S. cer evisiae

  m e m p u n ya i kandungan pro t ein 50,35% dibandingkan pakan mo ist yang dit ambahkan ko mbinasi pro bio t ik (49,41%) dan t anpa pro bio t ik (48,87%). Perbedaan kandungan pro - t e in yan g r e lat if ke cil (0 ,5 %-1 ,5 %), ke m u n gk in an menyebabkan t idak adanya perbedaan pert umbuhan b o b o t d an p an jang p ad a be n ih lo b st er. Se lain it u , diduga efek

  mode of act ion

  pro bio t ik yang diberikan t idak t erekspresi t erhadap perfo rma pertumbuhan dan sint asan, namun t erlihat pada imunit as. Oelschlaeger (201 0) menyat akan bahwa di ant ara

  mode of act ion

  pro bio t ik dapat unt uk memo dulasi pert ahanan usus ho st (lo bst er) meliput i innat e maupun acquired sist em imun dan aksi ini sangat pent ing unt uk mencegah dan t erapi infeksi penyakit dan

  t reat men

  inflamasi sist em pencernakan. Hasil penelit ian Jayakumar

  et al

  . (2011) m en yat akan b ah wa fo rmu lasi p akan p ele t de n gan perbedaan t ingkat variasi pro t ein yang relat if t inggi (54,9%; 45,92%; dan 35,88%) menghasilkan perfo rma p e t u m b u h a n ya n g b e r b e d a p a d a ju ve n il lo b s t e r

  P. homarus

  . Sement ara, hasil penelit ian Daniel

  et al .

  synbiot ic

  ya n g d it a m b a h r a g i

  dengan pen ambah an ragi (A), ko mbin asi p ro bio t ik (B), dan t anpa pro bio t ik (C), masing-masing sebesar 32,22%; 2 9 ,6 3 %; d a n 3 3 ,3 3 %. Ha l in i t id a k m e n u n ju k ka n perbedaan nyat a (P> 0,05). Mo rt alit as t erjadi karena k e g a g a la n p a d a s a a t b e n ih lo b s t e r m e n g a la m i pe rgant ian kulit . Sifat karn ivo r p ada be nih lo bst er sa n g at d o m in an s e s u a i d e n ga n ko n d is i d i a la m . Kebiasaan memangsa hewan hidup (ikan atau krustasea ke cil) m en jadikan be nih lo b st er relat if sulit u nt uk dialihkan ke makanan buat an (

  m oi st

  pelet dengan p e n am b ah a n p r o b io t ik m au p u n t an p a p ro b io t ik, m e m b e rikan ju m lah h e m o sit yan g b e rb e d a. Pad a p e r la k u a n A (p a k a n

  moist

  Ha s il p e n g a m a t an t o t a l h e m o s it p a d a b e n ih lo bst ers t erlihat bahwa pemberian

  Total Hemosit

  art ificial diet ).

  moist

  ), d an t e rlihat ad an ya p eru bahan sp esifik ko mpo sisi akt ivit as mikro flo ra dalam gast roint est inal yang memberikan keuntungan pada host (lo bster) dan kesehat an. Aksi sinergit ik t ersebut dit unjukkan dari ko m binasi

  L. d a n d a p a t meningkat kan perfo rma pert umbuhan dan sint asan. Besarnya sin t asan be nih lo b st er yan g dipelihara secara individu pada pemberian pakan

  H om m a r u s g a m m a r us

  yang merupakan prebio t ik dalam pemeliharaan lar va lo b s t e r

  M annan oligosacchar ida

  sp p. dan

  Bacillus

  A B Co p yright @ 2 017 , Jurnal Riset Akuakultu r, e-ISSN 250 2-65 34 Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i)

  hemo sit t erendah pada perlakuan C (tanpa pro bio t ik). Pe ra n ra gi

  80 100 120

  4 se l/ m L )

  T o ta l h a em o cy te ( x

  1 4 ce ll /m L )

  Awal (Init ial) Akhir (Final)

  20

  40

  60

  S in ta sa n ( S u rv iv a l ra te ) (% )

  T o ta l h a e m o si t (x

  Wakt u pe me liharaan (bulan)

  Cult ure period (mont hs)

  A B C

  I II

  III Awal

  Initial

  Awal (

  Initial)

  1

  41.7 196.5 151.5 125.5

  S. cer evi si ae

  

Figure 2. Sur vival rat e (%) of j uvenile spiny lobst er, P. homarus reared wit h indi-

vidual syst em and fed wit h moist diet s supplement ed wit h (A) yeast S. cerevisiae (B) combinat ion of probiot ic, and (C) wit hout probiot ic

  d e n g an d in d in g s e l yan g men gandun g  (1 ,3 dan 1,6 ) glu kan dapat sebagai

  imunomodulat or

  u n t u k m e n in g kat k an ju m lah d an kemampuan sel T, sel B (pada ikan), sel hemo sit (pada krust asea) dan makro fag dalam rangka melawan infeksi penyakit . Hemo sit berperan pent ing dalam meregulasi r e s p o n s im u n p a d a k r u s t a s e a , w a la u p u n pengukurannya akan lebih kompleks dengan perbedaan jenis kelamin dan ukuran lo bst er yang diamat i (Huu & Jo nes, 2014). Pada krust asea, hemo sit t erlibat dalam reaksi pert ahanan t ubuh (

  immediat e defense react ion

  ), sepert i mo dulasi, enkapsulasi, dan fago sit o sis. Selain it u, hemo sit membant u pada perbaikan jaringan yang ru sa k p ad a t u b u h m e lalu i p ro s e s re ge n e rasi d an penyembuhan. Gambar 2. Sint asan (%) benih lo bst er

  P. homarus

  yang dipelihara secara individu de ngan p akan mo ist yan g dit amb ahkan (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

  Gambar 3. To t al h e m o sit (x 1 0 4 se l/m L) b e n ih

  41.7

  P. homar us

  d e n g a n p e m b e r ia n p a k a n m oi st p e le t ya n g dit ambahkan (A) ragi

  S. cerevisiae

  , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

  Figure 3. Tot al hemocyt es (x 10

4

cell/mL) of j uvenile lobst er P. homarus reared wit h fed of moist diet supplement ed wit h (A) yeast S. cerevisiae, (B) pr obiot ic, and (C) without probiot ic

  50 100 150 200

  A B C

  41.7

  Akhir ( Final) Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

  91 Jurnal Riset Akuakult ur, 12 (1), 2017, 85-97

  ). Benih lo bst er diberi pakan

  sp. BY-9 adalah menekan adanya infeksi

  Vibrio

  (

  biological cont rol

  ) dalam pemeliharaan ud ang dan kepit in g, sehingga m edia p eme lih araan menjadi sehat. Sementara, Bacillus cereus BC merupakan pro bio t ik yang berperan dalam sist em pencernaan,

  Gambar 4. Tingkat ekspresi mRNA dari ALFHa-1, ALFHa-2, SAA, Pro PO, Tgase, CP, dan GPO pada hemo sit benih lo bst er

  P. homarus

  set elah t iga bulan pemeliharaan (sebelum uji t ant ang dengan

  V. har veyi

  moist

  Peran

  pelet dengan penambahan (A) ragi

  S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

Figure 4. Expression value mRNA of ALF-1, ALF-2, SAA, ProPO, Tgase, CP, and GPO on hemocyt es of

j uvenile P. homarus aft er t hree mont hs reared (before challenge t est wit h V. harveyi) .

   Juvenile lobst er fed moist diet s supplement ed wit h (A) yeast S. cerevisiae, (B) probiot ic, and (C) without probiot ic

  0.05

  0.1

  0.15

  0.2

  0.25

  0.3 ALF-1 ALF-2 SAA ProPO Tgase CP Gp o

  E k sp re si ( E x p re ss io n f o ld )

  Alt eromonas

  ) dan enzim dengan gen h o mo lo g akt if dapat men gekspresikan peningkat an imunit as (Ahmad, 2005).

  Status Imun Benih Lobster P. homarus

  moist

  Hasil analisis ekspresi gen yang t erkait imunit as dengan t arget gen ALF-1, ALF-2, SAA, Pro PO, Tgase, CP, dan GPO pada benih lo bst er sebelum diuji t ant ang d en gan

  V. har veyi

  t e rt e ra pada Gamb ar 4. An alisis ekspresi gen dilakukan pada akhir penelit ian. Pada Gambar 4 menunjukkan bahwa hasil analisis e k s p r e s i g e n ya n g t e r k a it im u n it as p a d a b e n ih lo bst er set elah t iga bulan pemeliharaan (sebelum uji t ant an g) pada perlakuan A (ragi

  S. cerevisiae

  ) dan B ko m b in a s i p ro b io t ik (

  Al t er om on as

  s p . BY-9 d a n

  Bacillus cereus BC), t erlihat lebih t inggi st at us imunnya

  pada t arget gen ALFHa-1, ALFHa-2, SAA, Pro PO, dan CP dibandingkan dengan perlakuan t anpa penambahan pro bio t ik. Tingkat ekspresi mRNA sebagai indikat o r im u n it as p ad a b e n ih lo bst e r se b e lu m u ji t an t an g de ngan V. har veyi m asih relat if ren dah . Pad a b en ih lobst er dengan pakan

  yang dit ambahkan ragi (A), t erlihat kelipat an imunit as dari t arget gen ALF Ha-1 dan ALFHa-2 adalah sama (0,07 kali), sedangkan pada t a rge t ge n SAA, Pro PO, d an CP ad a p e n in gkat an e kspresi masin g-masing 0 ,17 ; 0,19 ; dan 0 ,1 1 kali. Se m e n t a r a , p a d a t a r g e t g e n Tg a s e d a n GPO menun jukkan ekspresi yan g rendah (0,04 dan 0,01 kali). Pada benih dengan perlakuan pakan

  Reticula Endot helial System

  moist

  pelet yang dit ambah ko mbinasi pro bio t ik (B) menunjukkan ekspresi imunit as yang lebih tinggi pada ALFHa-1 (0,17 kali), SAA (0,26 kali), dan CP (0,19 kali), sedangkan pada empat t arget gen lainnya menunjukkan ekspresi imunit as yang rendah yait u ALFHa-2 ( 0,06 kali), Pro PO (0,08 kali), Tgase (0,02 kali), dan GPO (0,03 kali). Sementara, pada benih lobst er yang diberi pakan moist t anpa pro bio t ik (C), kelipat an imun it as p ada t ujuh t arget gen hanya berkisar ant ara 0,02-0,13 kali.

  S. cereviceae

  adalah ragi yang t ergo lo ng

  eukaryot e

  , mempunyai dinding sel dengan kandungan  (1,3 dan 1,6) glukan, kit in, dan mano pro t ein.  (1,3 dan 1,6) glukan meru pakan subst an si esen sial d an memiliki kemampuan menst imulasi secara nonspesifik terhadap respo ns imun (imuno st imulan). Ko mpo sisi kimia ragi

  S. cer evi ceae t e rd ir i at as p ro t e in kasar (5 0 %-5 2 %),

  karbohidrat (30%-37%), lemak (4%-5%), dan mineral (7%- 8 %) (Ah m ad, 2 0 0 5 ).

  S. cer eviceae

  ju ga m e m p u n yai beberapa enzim dan berfungsi pent ing di ant aranya pe pt id ase , zimase, dan int er vase. Enzim pep t idase mempunyai 92 gen dan enzim t ersebut yang homo lo g inakt if sebanyak 32 gen. Adanya  (1,3 dan 1,6) glukan dapat meningkatkan fungsi imun t ermasuk fago sit o sis dan stimulasi RES (

  A B C

  . Pro ses akt ivasi sist em Pro PO memerlukan part isipasi pro t ease dan mekanisme ini memerlukan ket epatan pengontrolan untuk mencegah kerusakan jaringan. Pheno lo xyd ase d ipro du ksi d ari pengakt ifan prophenoloxidase (proPO system) sebagai

  Sist e m akt ivasi gen p ro PO (p ro p h en o lo xidase ) t erlihat signifikan t erhadap peningkat an regulasi imun pada perlakuan A (pakan

  m oi st

  d e n g a n ko m b in as i p ro b io t ik (B) d an t a n p a p r o b io t ik (C) masing-m asing menu njukkan t in gkat ekspresi 3 ,69 dan 3,09 kali pada 24 jam set elah uji t ant ang. Ant i

  Lipopolysacharide Fact or

  (ALF) merupakan bagian kecil dari pro t ein dasar dan be rperan unt uk menet ralisir lipo po lysaccharida (LPS). Peran lain dari ALF adalah t erlibat dalam penghambat an infeksi fungi dan bahkan replikasi at au pert umbuhan virus (Wang

  et al ., 2010).

  Dari hasil ekspresi imun ALFHa-2 pada benih lo bst er d e n gan p e rlaku an A (p akan

  moist

  d e n gan ragi, S.

  cerevisiae ) menunjukkan nilai kuant it at if yang rendah.

  Hal ini diduga karena pakan

  moist

  dengan penambahan ragi diberikan melalui o ral, sehingga peningkat an atau penurunan mekanisme pert ahanan t ubuh t ergant ung pada jumlah ragi (dengan kandungan  glukan) yang diko nsumsi. Oleh karena it u, respo ns t erhadap hewan uji sangat bervariasi t ergantung pada ada atau tidaknya resept o r yang dikenal o leh ko mpo nen gluko sa dari  (1,3 dan 1,6) glukan.

  Pro PO Activating System

  moist

  V. har veyi

  dengan ragi,

  S. cerevisiae

  ) dan B (pakan

  moist

  dengan ko mbinasi pro bio t ik) dari 2 4 , 4 8 , d an 9 6 jam se t e la h u ji t an t a n g. Tin gk at t ranskripsio nal pro PO pada perlakuan A (pakan

  moist

  dengan ragi, S. cerevisiae ) mencapai 6,00 kali (24 jam); 8,59 kali (48 jam) dan 3,42 kali (96 jam), sedangkan p ad a p e rlaku an B (p akan

  moist

  de n gan ko m bin asi pro bio t ik) dipero leh 24,53 kali (48 jam) dan 7,33 kali (9 6 ja m ). Se m e n t a r a , p a d a p e r la k u a n C (t a n p a pro b io t ik) t erlih at pada 24 dan 7 2 jam set e lah u ji t ant ang

  V. har veyi

  mencapai t ingkat t ranskripsi 2,09 dan 4,7 kali (Gambar 6). Sist em akt ivasi pro PO pada krust asea merupakan aspek pent ing dari innat e immunit y , dan t ahapan awal dalam mengkatalisa melanisasi pada invertebrata. Wang et al. (2010) menyat akan bahwa t ingkat ekpresi proPO m e n in g k a t p a d a Fenn er op en aeus chi nensi s ya n g t erinfeksi

  Vibrio anguillar um

  . Pe nin gkat an re gu lasi pro PO merupakan hal yang pent ing sebagai respo ns melawan infeksi

  Vibrio

  (Gambar 5A). Pada ALFHa-2 ekspresi im un it as be nih lo bst e r pad a perlaku an (B) d an (C) t erlihat lebih t inggi pada 24 jam set elah uji t ant ang (Ga m b a r 5 B). Pe m b e r ia n p a k a n

  3,32 kali (24-48 jam) dan 2,20 kali (96 jam), sedangkan p e rlak u a n C (t an p a p r o b io t ik) t e rlih at k e lip at an ekspresi sebesar 2,3-2,9 kali (24-96 jam) set elah uji t ant ang

  , dan 

  s e h in g g a fu n g s i u s u s lo b s t e r m e n ja d i b a ik , d im u n g k in k a n t in g k a t k e ce r n a a n le b ih e fis ie n . Ko m b in asi p e ran in ilah yan g m e nye b ab kan b e n ih lo bst er yang selama pemeliharaannya menggunakan ko mbinasi dua jenis pro bio t ik t ersebut menunjukkan ekspresi imun yang lebih baik set elah melalui analisis ekspresi gen yang t erkait imunit as, walaupun belum diuji t ant an g de ngan

  V. har veyi

  p en ye bab

  red body disease

  . Se l he mo sit dalam he mo lim, b erim plikasi pada perbedaan respo ns kekebalan, di antaranya melanisasi dan co agulasi yang dimediasi o leh pelepasan efekt o r h e m o s it , s e p e r t i p r o p h e n o lo xid a s e (p r o PO ) a ct iva t in g s is t e m , t r a n s g lu t a m in a s e a t a u

  a n t i microbial pept ida

  . Dalam sist em

  immune-relat ed prot ein

  pada krust asea, dapat digambarkan sebagai

  clot t ing

  pro t ein,

  lysozyme

  ,

  Lipopolysacharide aglut inin

  • - glucan-binding pro t ein.

  Co p yright @ 2 017 , Jurnal Riset Akuakultu r, e-ISSN 250 2-65 34 Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i)

  ) dari 24 jam hingga 96 jam set elah uji tant ang. Tingkat transkripsional ALFHa- 1 mencapai 2,09 kali (24 jam), dan 4,79 kali (96 jam). Se ment ara, pada perlaku an B (p akan moist d engan ko mbinasi pro bio t ik) t erlihat ekspresi imunit as 1,18-

  vat ing

  e n zim (PPA). PPA m e r u p akan p ro t e in yan g berlo kasi di sel granular hemo sit dan dapat diakt ifkan o leh lipo po lysacharida (LPS) dan  1,3-Glucan; yang d a p a t m e r a n g s a n g p r o p h e n o lo xid a s e m e n ja d i phenolo xidase. Sebagai akibat dari perubahan ini akan dihasilkan semacam

  Prot eine Opsonin Factor

  yang dapat m e n g in d u k s i s e l-s e l a g r a n u le r h e m o s it u n t u k m e la ku ka n p r o s e s fag o s it o s is . Se l h e m o sit ju ga melakukan de granu lasi dan bebe rapa pro t e in akan dilepas sebagai respo ns imun (Van de Braak, 2002).

  Ekspresi Gen yang Terkait Imunitas Anti-Lipopolysacharida Fakt or

  Pe n g u jia n e k s p r e s i g e n im u n it a s d e n g a n m e n g g u n a k a n RT-q PCR p a d a b e n ih lo b s t e r d im a k s u d k a n u n t u k m e n g e t a h u i p e n g a t u r a n t r a n s k r ip s i g e n s e la m a u ji t a n t a n g d e n g a n menginfeksikan

  V. har veyi

  . Tingkat ekspresi gen mRNA se cara in d ivid u al d ari b en ih lo b st e r din o rmalisasi menggunakan 18srRNA sebagai

  reference endogenous

  (ko nt ro l int ernal), kemudian diekspresikan t erhadap ekspresi dasar pada paparan no l (0) jam. Hasil yang dipero leh disajikan dalam masing-masing pengat uran mekanisme pert ahanan pada lo bst er.

  Sist em akt ivasi gen ALFHa-1 dan ALFHa-2 (an t i- lipo po lysacharida fact o r) t erlihat signifikan t erhadap peningkat an regulasi imun pada perlakuan A (pakan

  moist

  dengan ragi,

  S. cerevisiae

  Me k a n is m e k e ke b ala n t u b u h p a d a k r u s t a se a t e r m a s u k lo b s t e r t id a k s e p e r t i p a d a ik a n ya n g m em p u nyai sist e m im u no glo b u lin . Im un o glo b u lin pada krust asea dikenal dengan Prophenoloxidase Act i-

  Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

  k sp re ss i ( E x p re ss io n f

Dokumen yang terkait

Dokumen baru