Tersedia online di: http:ejournal-balitbang.kkp.go.idindex.phpjra RESPONS IMUNITAS BENIH LOBSTER, Panulirus homarus DENGAN PENGGUNAAN PROBIOTIK PADA PAKAN MOIST

RESPONS IM UNITAS BENIH LOBSTER, Panulirus homarus DENGAN PENGGUNAAN PROBIOTIK PADA PAKAN M OIST

Haryanti *) , Sari Budi M oria Sembiring *) , Sudewi *) , Zeny W idiastuti *) , Nyoman Adiasmara Giri *) , dan Ketut Sugama **)

Balai Besar Riset Bu didaya Laut dan Penyu luhan Pe rikanan (Naskah dit erima: 21 November 2016; Revisi final: 10 M ar et 2017; Diset ujui publikasi: 20 M aret 2017)

ABSTRAK

Pemeliharaan benih lobster P. homarus masih menghadapi beberapa permasalahan, di antaranya infeksi penyakit bakteri ( red body disease ) dan mortalitas yang tinggi. Tujuan penelitian ini adalah untuk mengkaji respons imunitas benih lobster P. homarus yang diberi pakan pelet basah (moist diets) dengan penambahan probiotik. Pemeliharaan benih lobster dilakukan secara individu (1 ekor/keranjang). Lama pemeliharaan selama tiga bulan. Bobot awal puerulus P. homarus adalah 0,37 ± 0,05 g. Perlakuan meliputi pemberian

pakan moist yang ditambahkan (A) ragi Saccharomyces cerevisiae , (B) kombinasi probiotik, Alt eromonas sp. BY-

9 dan Bacillus cereus BC, dan (C) tanpa probiotik. Respons imunitas dianalisis dengan RT-qPCR melalui tujuh gen target terkait ekspresi imunitas, setelah diuji tantang dengan Vibrio harveyi (penyebab red body disease ). Hasil penelitian menunjukkan bahwa sintasan benih lobster sebesar (A) 32,22%; (B) 29,63%; dan (C) 33,33%. Pertu mbuhan pan jang dan bobot benih lobster tidak berbeda nyat a (P> 0,05). Respons imunitas benih lobster P. homarus pada perlakuan A dan B menunjukkan nilai ekspresi imun yang lebih tinggi dibandingkan dengan perlakuan C (tanpa probiotik). Ekspresi gen penyandi anti lipopolisakarida (ALFHa-1) meningkat pada (A) rata-rata sebesar 3,44 kali dan (B) 3,25 kali dibandingkan dengan perlakuan C (2,43 kali). Kelipatan ekspresi profenoloksidase (proPO) benih lobster meningkat pada perlakuan A (penambahan ragi) rata-rata sebesar 5,27 kali, sedangkan pada perlakuan B (kombinasi probiotik) sebesar 12,92 kali. Ekspresi Clot t ing sistem (transglutaminase, clotting protein) dan ant ioxidant defense mechanism (glutathione peroxidase/GPO) dan SAA juga mengalami peningkatan pada perlakuan A dan B.

KATA KUNCI:

benih lobster; Panulirus homarus ; probiotik; ekspresi terkait imunitas

ABSTRACT:

Immunity response of juvenile spiny lobster, Panulirus homarus with probiotic supplementation on

moist diets. By: Haryanti, Sari Budi M oria Sembiring, Sudewi, Zeny W idiastuti, Nyoman Adiasmara Giri, and Ketut Sugama

A number of contrains including disease infect ions and significant mort alit y have been occurring in lobst er aquacult ure. The aim of t his research was to obser ve t he immune response of juvenile lobst er P. homarus cult ure fed by moist pellet supplemented wit h probiot ic . Experimental juveniles were reared in individual system (one juvenile/basket). The experiment was conduct ed for t hree mont hs. The t reat ment s comprised (A) whole cell of yeast Saccharomyces cerevisiae, (B) combinat ion of probiot ics Alteromonas sp. BY-9 and Bacillus sp. BC, and (C) wit hout probiot ic as cont rol. Init ial weight of juveniles were 0.37 ± 0.05 g. Immunit y responses were analyzed using seven immunit y relat ed genes expression by RT-qPCR. The result s showed t hat t he sur vival rat e of juvenile for t reat ment s A, B, and C were 32.22%, 29.63%, and 33.33% respect ively. The weight and lengt h gain of t he juvenile were not significant ly different (P> 0.05) among treatments. Based on immunit y related gene expression analysis, it revealed that A and B t reat ment s have shown differences in t he increament of immunit y responses. Expressions of ALFHa-1 genes were increased on (A) t reat ment

wit h average of 3.44 fold and (B) t reat ment (3.25 fold) and higher t han C t reat ment (2.03 fold). Prophenoloxidase

(ProPO) expression was increase average up t o 5.27 fold on A (yeast supplement at ed) t reat ment and B (combinat ion of probiot ic) were 12.92 fold. Gene expression on Clot t ing syst em (t ransglut aminase, clot t ing prot ein) and ant ioxidant

defense mechanism (glut at hione peroxidase/GPO ) was increased on A and B treat ment s.

KEYW ORDS:

puerulus; probiotics; Panulirus homarus; immunity - related gen expression

Ko r esp o n d e n si: Balai Be sar Riset Bu d id aya Lau t d an Pe n yu lu h an Pe r ikan an . Jl. Br. Go n d o l, Ke c. Ge ro kg ak Kab . Bu le le n g , Ko t ak Po s 1 4 0 , Sin g ar aja, Bali 8 11 0 1 , In d o ne sia. Te l. + (0 3 6 2 ) 9 2 2 7 8 E-m ail:

haryant i @ i ndosat .net .i d

Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i)

PENDAHULUAN

Info rmasi t ent ang penambahan dan penggunaan imunost imulan pada pemeliharaan benih lobster dalam

Lo b s t e r m e r u p a k a n k o m o d it a s e k s p o r ya n g dieksplo it asi dari penangkapan di laut . Hingga kini

b u d id aya m as ih t e rb at as. Ko m p o n e n yan g se rin g digunakan pada up aya peningkat an kesehat an d an

b e lu m a d a h a t ch e r i d i In d o n e s ia ya n g b e r h a s il p e n c e g a h a n p e n ya k it p a d a k r u s t a s e a a d a la h m e m p ro d u k si la r va (p u e r u lu s ) a t au b e n ih (p o s t

puerulus). Di samping meto de pembenihan yang belum imuno stimulan (  -glucan). Kemampuan imuno stimulan

d a la m m e n in g k a t k a n r e s p o n s k e k e b a la n t u b u h dikuasai, juga diperlukan wakt u yang panjang unt uk

memelihara lar va (6-9 bulan) sehingga dirasakan t idak n o n s p e s ifik m e m p e r lih a t k a n h a s il p o s it if p a d a krustasea. Kerentanan t erhadap infeksi mikro ba sangat

e k o n o m is . Tin g g in ya p e r m in t a a n e k s p o r b e n ih lo bst e r, m en ye babkan p en an gkap an b en ih d i alam

i m m u no kompetensi dan kemampuan unt uk meno lak mikro o rganisme t ersebut

berhubungan dengan

dilakukan secara int ensif. (Haut o n et al ., 2013 , Jimenez-Vega et al ., 2004).

Budidaya lobster dengan keramba jaring apung (KJA) St r at e gi u n t u k m e n gk o n t ro l p e n ya k it in fe ks i t e lah d ilaku kan d i b eb e rap a d ae rah d i In d o n e sia: meliput i peningkat an kondisi lingkungan, penggunaan Lo m b o k, Bim a , Sa p e , Su law e si Se lat an , Su law e si

Tenggara, dan Aceh (Ujung Bat ee) dengan ko nt ribusi benih sehat , sert a peningkat an daya t ahan t erhadap penyakit dengan menggunakan pro bio t ik. Zo kaeifar

seb esar 2 ,6 7% (30 8 t o n/t ah un ) dari t o t al p ro du ksi

bu did aya (Priyam bo d o , 201 4). Se men t ara, Viet n am et al . (2012), Karla . (2011), dan Li . (2009), menyat akan bahwa penggunaan pro bio t ik pada udang

et al

et al

merupakan negara dengan perkembangan budidaya

d a p a t m e n in g k a t k a n p e r fo r m a lobst er yang pesat sejak t ahun 2005. Pro duksi tahunan pert umbuhan, enzim pencenakan, resistensi penyakit , lo bst er dihasilkan secara ko nsist en mencapai 1.500

L. va nn a m ei

, d an m en gu ran gi p re vale nsi t o n dengan bo bo t 300-500 g/eko r (

immune gene expession

P. ornat us

) (Anh &

Jo nes, 2014). infeksi virus at au bakt eri. Hasil uji t ant ang t erhadap Vibrio fluvialis pada Homarus americanus menunjukkan

Tingkat keberhasilan pemeliharaan lo bst er di In- n ila i t r a n s k r ip s i r e s p o n s p r o t e in a n t im ik r o b a do nesia masih rendah, t erut ama pemeliharaan pada

meningkat 17 kali (ClEark, 2013; Beale et al ., 2009). t in g kat p u e r u lu s h in gga m e n jad i ju ve n il d e n g an sint asan hanya sekit ar 20%-50% (Shanks et al ., 2014).

Efek pro t ekt if dan mengunt ungkan dari mikro ba at a u p ro b io t ik d isin ya lir d ap at b e rp e ran se b a gai

Hal yang sama juga dialami dalam pemeliharaan dari im uno st imulan, im uno st im ulat o r, supleme n p akan, juvenil hingga ukuran ko nsumsi. Lo bst er P. homarus

yang dipelihara dari ukuran juvenil 2 cm hingga 200 g dan bahan aditif. Manfaat mikro ba atau probiotik sudah banyak dilaporkan antara lain untuk mencegah penyakit

selama enam bulan, hanya dipero leh sint asan < 50%. Namun, pembudidaya lo bst er P. ornat us di Viet nam

infeksi pada pemeliharaan krust asea dari st adia lar va, juvenil hingga ukuran ko nsumsi, sert a unt uk menjaga

selama delapan bulan pemeliharaan dari juvenil 2 cm kualit as air (Fu et al ., 2011; Luis-Villaseno r et al ., 2011; hingga 350 g dapat mempero leh sint asan hingga 90%,

b ila s is t e m p e m e lih a r a a n d a n n u t r is in ya b a ik Zho u et al ., 2009; Balcazar et al ., 2007; Ro driguez et al. , 2007).

(Priyam bo do & Sarifin , 20 09 ; An h & Jo ne s, 2 01 4). Mort alitas yang masih tinggi tersebut disebabkan o leh

O le h k a r e n a it u , p o la e k s p r e s i g e n ya n g s ifa t k a n ib a lis m e a t a u in fe k s i p e n ya k it , s t r e s

berhubungan dengan imunit as merupakan t ranscrip- transpo rt asi, kualitas air, dan manajemen pemeliharaan

t ional respo ns t erhadap infe ksi penyakit . Pe ngaruh yan g belum st andar. Be berapa pe nyakit pada sp iny

bahan suplemen (imuno st imulan) akan berhubungan lo bst er di ant aranya adalah milky hemolymph disease

d e n gan sifat ge n o t ip e d a n t e re ksp re si p ad a sifat

feno t ipe, yait u dengan menun jukkan ko ndisi sehat ease , black gill disease , red t ail disease (Sields, 2011),

(Ano nymo us, 2007, Nunan et al ., 2010), red body dis-

at au sakit .

dan WSSV ( Whit e Spot Syndrome Virus ) (Clark et al ., Be r d a s a r k a n u r a ia n d i a t a s , p e n e lit ia n ya n g

2 01 3). Beb e rap a p en e lit ian t e lah dilaku kan u n t u k berhubungan dengan respo ns imunit as lobster menjadi mencegah t erjadinya in feksi penyakit , di ant aranya p ilih a n u n t u k m e n d a p a t k a n b e n ih ya n g s e h a t . dengan perbaikan mut u lingkungan dan penyediaan Penelitian ini bert ujuan unt uk mendapat kan info rmasi p a k a n d e n g a n fo r m u la s i ya n g m e m a d a i. Ha s il t en t ang respo ns imun it as ben ih lo bst er P. homar us penelit ian pengaruh paramet er lingkungan dan lama yang diberi pakan moist pelet dengan penamb ahan penampungan t erhadap respo ns imun pada P. homarus p r o b io t ik. Has il p e n e lit ia n in i d ih a ra p k an d ap at dan P. cygnus menunjukkan bahwa perubahan ekst rem digunakan unt uk peningkat an produksi lo bster melalui lingkungan dan efek penampungan (empat hari) dapat penyediaan benih lo bst er yang sehat pada perikanan menginduksi perubahan imunit as lo bst er (Verghese budidaya yang dikembangkan di Indo nesia. et al ., 2007).

Co p yright @ 2 017 , Jurnal Riset Akuakultu r, e-ISSN 250 2-65 34

Jurnal Riset Akuakult ur, 12 (1), 2017, 85-97

BAHAN DAN M ETODE

dilakukan dengan mengambil hemolim (10 µL) dan

d ih it u n g m e n ggu n ak an h e m o sit o m e t e r d i b awah

Pemeliharaan Benih P. homarus

mikro sko p cahaya dengan perbesaran 400x. Ben ih lo b st e r d ib eri pakan moist pe le t d e ngan

Stat us Im unitas

perlakuan penambahan whole cell (A) ragi, S. cerevisiae ;

Pe n g a m a t a n s t a t u s im u n d ila k u k a n d e n g a n cillus cereus BC), dan (C) t anpa probiot ik. Masing-masing

(B) ko mbinasi pro bio t ik ( Alt eromonas sp. BY-9 dan Ba-

membandingkan tingkat ekspresi mRNA pada hemo sit bahan pro bio tik dicampurkan dalam pakan moist pelet .

benih lo bst er pada awal dan akhir perlakuan. Analisis Ukuran rat a-rat a bo bo t benih yang digunakan adalah

e k s p r e s i g e n im u n it a s m e n g g u n a k a n RTq -PCR. 0,37 ± 0,0 5 g dan panjan g t o t al 2,34 ± 0,25 cm.

Pengamatan respons imun dilakukan dengan uji tantang Pemeliharaan benih lo bst er dilakukan secara individu

V. har veyi p enye bab red body disease secara (1 eko r/keranjang), setiap perlakuan menggunakan satu

dengan

kohabit asi. Uji tantang dilakukan selama 96 jam dengan s e t r a n g k a ia n k e r a n ja n g (t e r d ir i a t a s s e m b ila n

int er val wakt u pengambilan hemo lim set iap 24 jam. keranjang) dan diulang dua kali. Keranjang berbent uk bulat (diamet er 20 cm, t inggi 30 cm) dan diapungkan

Ekspresi Gen Terkait Im unit as

d alam b ak b e t o n vo lu m e 5 m 3 . Se t iap ke ran jan g

shelt er diberikan Isolasi Total RNA dan Sintesis cDNA berupa pipa PVC dan waring yang dibent uk sep ert i kipas unt uk persemb unyian benih

He m o lim ya n g t e la h d ik o le k s i, k e m u d ia n lo bst er. Benih lo bst er dipelihara selama t iga bulan.

disent rifugasi dengan kecepat an 12.000 rpm pada suhu Pe r co b a an d e n ga n r a n ca n g a n a ca k le n g k ap d a n

4°C selama 10 menit . Pelet hemo sit yang dipero leh

d ia n a lis is d e n g a n ANOVA. Se la m a p e m e lih ar aa n dicuci sat u kali dengan larut an ant icoagulant dingin dilakukan pembersihan sisa-sisa makanan, pergant ian

dan dise nt rifugasi kem bali dengan ke cepat an yang air dengan sist em mengalir. Pengamat an pert umbuhan

sam a . Se la n ju t n ya d ilaku kan e k st raksi t o t al RNA panjang dan bo bo t , sert a sint asan dilakukan set iap

d e n gan bulan, dan penghit ungan hemo sit dilakukan pada awal

m e n ggu n akan laru ran lysis RNA ext r act ion

met o de IQ-2000 yang t elah dimo difikasi. dan akhir pemeliharaan.

Sin t e sis cDNA ( com plement ar y DNA ) d ila ku k an

Pem buatan Pakan M oist Pelet

dengan menggunakan Agilent Affinit y Script qPCR cDNA Synt hesis kit. Volume reaksi 20 µL yang terdiri atas

Persent ase bahan baku unt uk pembuat an pakan 10,0 µL first st rand 2x mast er mix ; 3,0 µL oligo (dT) moist adalah tepung pelet udang (24,77%); tepung rebon

primer ; 1,0 µL affinit y script RT ; dan 3,0 µg total RNA. (2 4 ,7 7 %); cu m i d an u d an g s e g a r m a s in g m as in g

Larutan dalam mikro tub diinkubasi berturut-t urut pada (24,77%); sert a perekat (CMC) (0,74%); dan vitamin mix

suhu 25°C selama lima me nit , 42°C (15 menit ) dan (0,19%). Campuran t ersebut dit ambahkan mikroba ragi (100 m L, kepadat an 10 11

95°C selama lima men it . Laru t an cDNA selanju t nya

d ile t a kkan d a lam e s u n t u k m e n gh e n t ikan re ak si perlakuan ko mbinasi pro bio t ik ( Alt eromonas sp. BY-9

sel/mL), sed angkan u nt uk

sint esis dan disimpan pada suhu -20°C unt uk analisis

d an Bacillus cer eus BC), p akan moist

d it am b ah kan

berikut nya.

p ro b io t ik t e rse b u t m asin g-m asin g 5 0 m L d e n gan kep ad at an 1 0 12 sel/m L). Set e lah t e rcam p ur, b ah an

Analisis RT-qPCR pada Gen yang Terkait

digiling unt uk menghasilkan moist pelet . Hasil pakan

dengan Im unitas P. homarus

moist t ersebut selanjut nya dikeringanginkan selama Analisis pro fil st at us imun menggunakan met o de t iga jam dan disimpan di dalam lemari pendingin pada ekspresi t ranskripsi gen yang t erkait dengan imunit as suhu 5-6°C. Pembuat an pakan moist dilakukan secara secara kuant itat if dengan RT-qPCR dan primer spesifik berkala unt uk menghindari t erjadinya penurunan nilai

mengikut i Wang et al . (2010) dan Clark (2013). Analisis nut risi. Kompo sisi pro ksimat pakan moist t ert era pada Pro PO , Glut at hione Peroxidase (GPo ), Clot t ing Prot ein Tabel 1. dengan met o de Wang et al . (2010), sedangkan ALFHa-

Penghitungan Hem osit

1, ALFHa-2, SAA-Serum Amylo id Pro t ein A mengikut i Clark (20 13) sepe rt i t ert era pad a Tab el 2. Int e rn al

Hem o lim diko leksi p ada b enih lo b st er dari ven- ko n t ro l m en ggu n akan 18 SrRNA. An alisis RT-q PCR t ral-sinus cavit y menggunakan jarum 25 gauge dan sy-

d ilaku k an m e n gg u n ak an ABI PRISM 7 5 0 0 sis t e m ringe

1 mL yang berisi senyawa ant icoagulant dingin det eksi sequens dengan 5x Hot Firepol Evagreen qPCR (2% NaCl; 0,1 M gluco se; 30 mM Na cit rat ; 26 mM

mix ROX ( ). Vo lu me reaksi u n t u k am p lifikasi cDNA asam citrat; 10mM EDTA). Pengambilan hemo sit hanya

sebanyak 20,0 µL dengan final konsentrasi 1x hot M aster dilakukan pada awal dan akhir perlakuan sebanyak t iga

mix ( Rox ), p asan gan p rim e r F/R 1 0 p m o l (Tab e l 2 ) eko r set iap perlakuan. Pe nghit ungan t o t al he mo sit

masing-masin g 25 0 n M, NFW Nuclease Free Wat er ( )

Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i)

Tabel 1. Ko mpo sisi pro ksimat pakan mo ist yang digunakan unt uk pemeliharaan benih lo bst er P. homarus Table 1. Proximat e composit ion of moist diet used for rear ing j uvenile of lobst er

P. homarus

Kom posisi proksim at

Perl akuan ( Treatments )

Pr oximate composition

Air ( M oist ure )

Pr otein

Lemak ( Fat )

ditambahkan hingga volume 20 µL dan cDNA (0,01 diuji) -  Ct (e ksp re si awal). Rep resen t asi kelipat an ng/uL). Ko ndisi suhu cycling unt uk RT-qPCR terdiri at as

re lat if yang be rbe da t e rhadap e ksp resi awal d ap at suhu awal denat urasi 95°C (15 menit ) diikut i dengan

dihit ung dengan 2 -  Ct

95°C (15 det ik) dan suhu annealing 60°C (3 0 det ik) se ban yak 4 0 siklus d an su hu e kst e n si akhir 60 °C

HASIL DAN BAHASAN

selama sat u menit .

Perform a Pert um buhan dan Sint asan Benih

Pen ghit ungan  Ct dari t hreshold siklu s PCR (Ct )

Lobst er P. homarus

gen yang diuji dino rmalisasi secara relat if t erhadap Ha s il ya n g d ip e r o le h m e n u n ju k k a n b a h w a Ct 18sRNA (int ernal ko nt ro l) pada sampel yang sama. Nilai P. homarus  Ct dihit ung dari  Ct (kelo mpo k sampel yang pemeliharaan benih lo bst er, secara individu

Tabel 2. Sekuens primer yang digunakan untuk analisis gen t erkait dengan imunit as benih lobst er P. homarus dengan RT-qPCR

Table 2. Primer sequence t hat were used for immune – relat ed gen analysis of j uvenile P. homarus by RT-qPCR

Sist em i m un

Target gen

Nam a

Bank gen

Sequence (5"-3") Imm une system

Prim er

Gene tar get

Nam e

Gene bank

p r o PO F:GAGATCGCAAGGGAGAACTG

EF 5 6 5 4 6 9 activatin g system

Pr o p hen o lo xid ase p r o PO p r o PO-F/R

R:CGTCAGTGAAGTCGAGACCA F:CCTCAGGATCTCCTTCACCA

Clo ttin g System

Tr an sg lu tamin ase Tgase

Tgase-F/R

EE 5 7 2 3 0 5 R:TTGGGAAAACCTTCATTTCG

An timicr o b ial F:TCTTTGCGCAGTTGGTGATC

DQ9 8 4 1 8 2 p ep tid e system

Clo tting pr o tein

CP

CP-F/R

R:TGAGGTGACCGAGTGCAAAA An tio xid ant d efen se

Glu tath ion e

F:TTTTTCCGTGCAAAAAGGAC

AY 9 7 3 2 5 2 mech an ism

Gp o

GPO-F/R

R:TAATACGCGATGCCCCTAAC An ti-Lip op o ly-

p er o xid ase

F:CAGTCGTTCTGGTGTTGTTGGGAA sach ar id e

ALFHa-1 ALFHa-1F/R

EU6 2 5 5 16 R:TTGTTGGGCATCCCTCTCGGTTAT

F:AGACTACCACTGACTTCGTGAGGA

ALFHa-2 ALFHa-2F/R

FC5 5 6 43 0 R:TCTCGGGATGATCCGTTAACACCT

Ser um amylo id F:TACCACTACCAGCACTCATCACCT p r o tein

EH1 1 6 0 55 R:TCAAACACAGAGAATAGGCACGGG

F:AGCAGGCTGGTTTTTGCTTA In ter nal con tro l

18 s RNA

18s

1 8 s-F/R

AF 1 8 6 2 5 0 R:AGCAGGCTGGTTTTTGCTTA

Co p yright @ 2 017 , Jurnal Riset Akuakultu r, e-ISSN 250 2-65 34

Jurnal Riset Akuakult ur, 12 (1), 2017, 85-97

memberikan laju pertumbuhan bobot dan panjang yang (2013) dan Daniel et al . (2010) menjelaskan t ent ang t idak berbeda (P> 0,05) sepert i t erlihat pada Gambar

st u d i m e n g o m b in as ika n p ro b io t ik d an p r e b io t ik

1. Hasil pengamat an bo bo t akhir benih lo bst er yang ( synbiot ic ), d an t e rlihat ad an ya p eru bahan sp esifik

ko mpo sisi akt ivit as mikro flo ra dalam gast roint est inal ko m b in as i p ro b io t ik (B), d an t an p a p ro b io t ik (C)

d ib e ri p ak an moi st

d e n gan p e n am b ah an ragi (A),

yang memberikan keuntungan pada host (lo bster) dan masing-masing sebesar 3,77 ± 1,72 g; 3,29 ± 2,06 g;

kesehat an. Aksi sinergit ik t ersebut dit unjukkan dari dan 3,47 ± 1,4 g. Semen t ara, pert ambah an bo bo t

ko m binasi Bacillus sp p. dan M annan oligosacchar ida benih lo bst er selama t iga bulan pemeliharaan adalah

yang merupakan prebio t ik dalam pemeliharaan lar va (A) 3,4 g; (B) 2,92 g; dan (C) 3,1 g.

H om m a r u s g a m m a r us L. d a n d a p a t Bila dilihat dari ko mpo sisi pro ksimat pakan mo ist

lo b s t e r

meningkat kan perfo rma pert umbuhan dan sint asan. p e le t , p e n a m b ah an ra gi S. cer evisiae m e m p u n ya i

Besarnya sin t asan be nih lo b st er yan g dipelihara kandungan pro t ein 50,35% dibandingkan pakan mo ist

secara individu pada pemberian pakan moist dengan yang dit ambahkan ko mbinasi pro bio t ik (49,41%) dan

pen ambah an ragi (A), ko mbin asi p ro bio t ik (B), dan t anpa pro bio t ik (48,87%). Perbedaan kandungan pro -

t anpa pro bio t ik (C), masing-masing sebesar 32,22%; t e in yan g r e lat if ke cil (0 ,5 %-1 ,5 %), ke m u n gk in an

2 9 ,6 3 %; d a n 3 3 ,3 3 %. Ha l in i t id a k m e n u n ju k ka n menyebabkan t idak adanya perbedaan pert umbuhan

perbedaan nyat a (P> 0,05). Mo rt alit as t erjadi karena

b o b o t d an p an jang p ad a be n ih lo b st er. Se lain it u , k e g a g a la n p a d a s a a t b e n ih lo b s t e r m e n g a la m i diduga efek mode of act ion pro bio t ik yang diberikan

pe rgant ian kulit . Sifat karn ivo r p ada be nih lo bst er t idak t erekspresi t erhadap perfo rma pertumbuhan dan

sa n g at d o m in an s e s u a i d e n ga n ko n d is i d i a la m . sint asan, namun t erlihat pada imunit as. Oelschlaeger

Kebiasaan memangsa hewan hidup (ikan atau krustasea (201 0) menyat akan bahwa di ant ara mode of act ion

ke cil) m en jadikan be nih lo b st er relat if sulit u nt uk pro bio t ik dapat unt uk memo dulasi pert ahanan usus

dialihkan ke makanan buat an ( art ificial diet ). ho st (lo bst er) meliput i innat e maupun acquired sist em imun dan aksi ini sangat pent ing unt uk mencegah dan

Total Hemosit

t erapi infeksi penyakit dan t reat men inflamasi sist em Ha s il p e n g a m a t an t o t a l h e m o s it p a d a b e n ih pencernakan. Hasil penelit ian Jayakumar et al . (2011)

lo bst ers t erlihat bahwa pemberian moist pelet dengan m en yat akan b ah wa fo rmu lasi p akan p ele t de n gan

p e n am b ah a n p r o b io t ik m au p u n t an p a p ro b io t ik, perbedaan t ingkat variasi pro t ein yang relat if t inggi

m e m b e rikan ju m lah h e m o sit yan g b e rb e d a. Pad a (54,9%; 45,92%; dan 35,88%) menghasilkan perfo rma

p e r la k u a n A (p a k a n m oi st ya n g d it a m b a h r a g i p e t u m b u h a n ya n g b e r b e d a p a d a ju ve n il lo b s t e r

S. cerevisiae ) t e rt inggi dalam m enghasilkan hem o sit

P. homarus . Sement ara, hasil penelit ian Daniel et al .

(196,5 x 10 4 sel/mL) (Gambar 3), sedangkan jumlah

I II III Initial

Wakt u p em eliharaan (b ulan) Wakt u pe me liharaan (bulan)

Cult ure period (mont hs)

Cult ure period (mont hs)

Gambar 1. Keragaan (A) pert umbuhan bo bo t (g) dan (B) panjang t o t al (cm) benih lo bst er P. homarus yang dipelihara secara individu dengan pakan moist yang dit ambah (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

Figure 1. Growt h performance of body weight (g) and t ot al lengt h (cm) j uvenile of spiny lobst er P. homarus reared wit h individually syst em and fed moist diet s supplement ed wit h (A) yeast S. cerevisiae (B) combinat ion of probiot ic, and (C) wit hout probiot ic

Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i)

Initial Wakt u pe me liharaan (bulan)

Cult ure period (mont hs) Gambar 2. Sint asan (%) benih lo bst er P. homarus yang dipelihara secara individu

de ngan p akan mo ist yan g dit amb ahkan (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

Figure 2. Sur vival rat e (%) of j uvenile spiny lobst er, P. homarus reared wit h indi- vidual syst em and fed wit h moist diet s supplement ed wit h (A) yeast S. cerevisiae (B) combinat ion of probiot ic, and (C) wit hout probiot ic

hemo sit t erendah pada perlakuan C (tanpa pro bio t ik). pengukurannya akan lebih kompleks dengan perbedaan Pe ra n ra gi S. cer evi si ae

jenis kelamin dan ukuran lo bst er yang diamat i (Huu & men gandun g  (1 ,3 dan 1,6 ) glu kan dapat sebagai

d e n g an d in d in g s e l yan g

Jo nes, 2014). Pada krust asea, hemo sit t erlibat dalam imunomodulat or u n t u k m e n in g kat k an ju m lah d an

reaksi pert ahanan t ubuh ( immediat e defense react ion ), kemampuan sel T, sel B (pada ikan), sel hemo sit (pada

sepert i mo dulasi, enkapsulasi, dan fago sit o sis. Selain krust asea) dan makro fag dalam rangka melawan infeksi

it u, hemo sit membant u pada perbaikan jaringan yang penyakit . Hemo sit berperan pent ing dalam meregulasi

ru sa k p ad a t u b u h m e lalu i p ro s e s re ge n e rasi d an r e s p o n s im u n p a d a k r u s t a s e a , w a la u p u n

penyembuhan.

Awal (Init ial) Awal ( Initial)

Akhir (Final) Akhir ( Final)

m l/ 151.5 /m ll

A B C Gambar 3. To t al h e m o sit (x 1 0 4 se l/m L) b e n ih P. homar us

d e n g a n p e m b e r ia n p a k a n m oi st p e le t ya n g dit ambahkan (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

Figure 3.

Tot al hemocyt es (x 10 4 cell/mL) of j uvenile lobst er P.

homarus reared wit h fed of moist diet supplement ed wit h (A) yeast S. cerevisiae, (B) pr obiot ic, and (C) without probiot ic

Co p yright @ 2 017 , Jurnal Riset Akuakultu r, e-ISSN 250 2-65 34

Jurnal Riset Akuakult ur, 12 (1), 2017, 85-97

Status Imun Benih Lobster P. homarus

pada empat t arget gen lainnya menunjukkan ekspresi imunit as yang rendah yait u ALFHa-2 ( 0,06 kali), Pro

Hasil analisis ekspresi gen yang t erkait imunit as dengan t arget gen ALF-1, ALF-2, SAA, Pro PO, Tgase,

PO (0,08 kali), Tgase (0,02 kali), dan GPO (0,03 kali). Sementara, pada benih lobst er yang diberi pakan moist

CP, dan GPO pada benih lo bst er sebelum diuji t ant ang t anpa pro bio t ik (C), kelipat an imun it as p ada t ujuh

V. har veyi t e rt e ra pada Gamb ar 4. An alisis ekspresi gen dilakukan pada akhir penelit ian.

d en gan

t arget gen hanya berkisar ant ara 0,02-0,13 kali. S. Pada Gambar 4 menunjukkan bahwa hasil analisis cereviceae adalah ragi yang t ergo lo ng eukaryot e ,

mempunyai dinding sel dengan kandungan  (1,3 dan

e k s p r e s i g e n ya n g t e r k a it im u n it as p a d a b e n ih 1,6) glukan, kit in, dan mano pro t ein.  (1,3 dan 1,6) lo bst er set elah t iga bulan pemeliharaan (sebelum uji

glukan meru pakan subst an si esen sial d an memiliki t ant an g) pada perlakuan A (ragi

S. cerevisiae

) dan B

kemampuan menst imulasi secara nonspesifik terhadap ko m b in a s i p ro b io t ik (

Al t er om on as

s p . BY-9 d a n

Bacillus cereus BC), t erlihat lebih t inggi st at us imunnya respo ns imun (imuno st imulan). Ko mpo sisi kimia ragi S. cer evi ceae t e rd ir i at as p ro t e in kasar (5 0 %-5 2 %),

pada t arget gen ALFHa-1, ALFHa-2, SAA, Pro PO, dan karbohidrat (30%-37%), lemak (4%-5%), dan mineral (7%- CP dibandingkan dengan perlakuan t anpa penambahan

8 %) (Ah m ad, 2 0 0 5 ). pro bio t ik. Tingkat ekspresi mRNA sebagai indikat o r S. cer eviceae ju ga m e m p u n yai beberapa enzim dan berfungsi pent ing di ant aranya

im u n it as p ad a b e n ih lo bst e r se b e lu m u ji t an t an g

de ngan

V. har veyi m asih relat if ren dah . Pad a b en ih pe pt id ase , zimase, dan int er vase. Enzim pep t idase moist

mempunyai 92 gen dan enzim t ersebut yang homo lo g lobst er dengan pakan

inakt if sebanyak 32 gen. Adanya  (1,3 dan 1,6) glukan t erlihat kelipat an imunit as dari t arget gen ALF Ha-1 dapat meningkatkan fungsi imun t ermasuk fago sit o sis dan ALFHa-2 adalah sama (0,07 kali), sedangkan pada dan stimulasi RES ( Reticula Endot helial System ) dan enzim t a rge t ge n SAA, Pro PO, d an CP ad a p e n in gkat an

yang dit ambahkan ragi (A),

e kspresi masin g-masing 0 ,17 ; 0,19 ; dan 0 ,1 1 kali. dengan gen h o mo lo g akt if dapat men gekspresikan peningkat an imunit as (Ahmad, 2005).

Se m e n t a r a , p a d a t a r g e t g e n Tg a s e d a n GPO menun jukkan ekspresi yan g rendah (0,04 dan 0,01

Peran Alt eromonas sp. BY-9 adalah menekan adanya kali). Pada benih dengan perlakuan pakan moist pelet

infeksi Vibrio biological cont rol ( ) dalam pemeliharaan yang dit ambah ko mbinasi pro bio t ik (B) menunjukkan

ud ang dan kepit in g, sehingga m edia p eme lih araan ekspresi imunit as yang lebih tinggi pada ALFHa-1 (0,17

menjadi sehat. Sementara, Bacillus cereus BC merupakan kali), SAA (0,26 kali), dan CP (0,19 kali), sedangkan

pro bio t ik yang berperan dalam sist em pencernaan,

E ( 0.15 si

Gambar 4. Tingkat ekspresi mRNA dari ALFHa-1, ALFHa-2, SAA, Pro PO, Tgase, CP, dan GPO pada

hemo sit benih lo bst er P. homarus set elah t iga bulan pemeliharaan (sebelum uji t ant ang dengan

V. har veyi ). Benih lo bst er diberi pakan moist pelet dengan penambahan (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

Figure 4. Expression value mRNA of ALF-1, ALF-2, SAA, ProPO, Tgase, CP, and GPO on hemocyt es of j uvenile P. homarus aft er t hree mont hs reared (before challenge t est wit h V. harveyi) . Juvenile lobst er fed moist diet s supplement ed wit h (A) yeast S. cerevisiae, (B) probiot ic, and (C) without probiot ic

Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i)

s e h in g g a fu n g s i u s u s lo b s t e r m e n ja d i b a ik , ko mbinasi pro bio t ik) t erlihat ekspresi imunit as 1,18-

d im u n g k in k a n t in g k a t k e ce r n a a n le b ih e fis ie n . 3,32 kali (24-48 jam) dan 2,20 kali (96 jam), sedangkan Ko m b in asi p e ran in ilah yan g m e nye b ab kan b e n ih

p e rlak u a n C (t an p a p r o b io t ik) t e rlih at k e lip at an lo bst er yang selama pemeliharaannya menggunakan

ekspresi sebesar 2,3-2,9 kali (24-96 jam) set elah uji ko mbinasi dua jenis pro bio t ik t ersebut menunjukkan

V. har veyi (Gambar 5A). Pada ALFHa-2 ekspresi ekspresi imun yang lebih baik set elah melalui analisis

t ant ang

im un it as be nih lo bst e r pad a perlaku an (B) d an (C) ekspresi gen yang t erkait imunit as, walaupun belum

t erlihat lebih t inggi pada 24 jam set elah uji t ant ang diuji t ant an g de ngan

(Ga m b a r 5 B). Pe m b e r ia n p a k a n m oi st dengan disease .

V. har veyi p en ye bab red body

ko m b in as i p ro b io t ik (B) d an t a n p a p r o b io t ik (C) Se l he mo sit dalam he mo lim, b erim plikasi pada

masing-m asing menu njukkan t in gkat ekspresi 3 ,69 dan 3,09 kali pada 24 jam set elah uji t ant ang. Ant i

perbedaan respo ns kekebalan, di antaranya melanisasi Lipopolysacharide Fact or (ALF) merupakan bagian kecil dan co agulasi yang dimediasi o leh pelepasan efekt o r

h e m o s it , s e p e r t i p r o p h e n o lo xid a s e (p r o PO ) dari pro t ein dasar dan be rperan unt uk menet ralisir

lipo po lysaccharida (LPS). Peran lain dari ALF adalah

a ct iva t in g s is t e m , t r a n s g lu t a m in a s e a t a u microbial pept ida

anti

t erlibat dalam penghambat an infeksi fungi dan bahkan . Dalam sist em pada krust asea, dapat digambarkan sebagai et al clot t ing replikasi at au pert umbuhan virus (Wang ., 2010).

immune-relat ed prot ein

pro t ein, lysozyme , Lipopolysacharide aglut inin , dan  -

Dari hasil ekspresi imun ALFHa-2 pada benih lo bst er glucan-binding

d e n gan p e rlaku an A (p akan moist pro t ein. S. d e n gan ragi, cerevisiae ) menunjukkan nilai kuant it at if yang rendah. Me k a n is m e k e ke b ala n t u b u h p a d a k r u s t a se a

Hal ini diduga karena pakan moist dengan penambahan t e r m a s u k lo b s t e r t id a k s e p e r t i p a d a ik a n ya n g

ragi diberikan melalui o ral, sehingga peningkat an atau m em p u nyai sist e m im u no glo b u lin . Im un o glo b u lin

penurunan mekanisme pert ahanan t ubuh t ergant ung pada krust asea dikenal dengan Prophenoloxidase Act i-

pada jumlah ragi (dengan kandungan  glukan) yang

vat ing

e n zim (PPA). PPA m e r u p akan p ro t e in yan g diko nsumsi. Oleh karena it u, respo ns t erhadap hewan berlo kasi di sel granular hemo sit dan dapat diakt ifkan

uji sangat bervariasi t ergantung pada ada atau tidaknya o leh lipo po lysacharida (LPS) dan  1,3-Glucan; yang

resept o r yang dikenal o leh ko mpo nen gluko sa dari 

d a p a t m e r a n g s a n g p r o p h e n o lo xid a s e m e n ja d i

(1,3 dan 1,6) glukan.

phenolo xidase. Sebagai akibat dari perubahan ini akan dihasilkan semacam Prot eine Opsonin Factor yang dapat

Pro PO Activating System

m e n g in d u k s i s e l-s e l a g r a n u le r h e m o s it u n t u k Sist e m akt ivasi gen p ro PO (p ro p h en o lo xidase ) m e la ku ka n p r o s e s fag o s it o s is . Se l h e m o sit ju ga

t erlihat signifikan t erhadap peningkat an regulasi imun melakukan de granu lasi dan bebe rapa pro t e in akan

pada perlakuan A (pakan moist dengan ragi, S. cerevisiae ) dilepas sebagai respo ns imun (Van de Braak, 2002).

dan B (pakan moist dengan ko mbinasi pro bio t ik) dari

2 4 , 4 8 , d an 9 6 jam se t e la h u ji t an t a n g. Tin gk at

Ekspresi Gen yang Terkait Imunitas

t ranskripsio nal pro PO pada perlakuan A (pakan moist

Anti-Lipopolysacharida Fakt or

dengan ragi, S. cerevisiae ) mencapai 6,00 kali (24 jam); 8,59 kali (48 jam) dan 3,42 kali (96 jam), sedangkan

de n gan ko m bin asi m e n g g u n a k a n RT-q PCR p a d a b e n ih lo b s t e r

Pe n g u jia n e k s p r e s i g e n im u n it a s d e n g a n p ad a p e rlaku an B (p akan moist

pro bio t ik) dipero leh 24,53 kali (48 jam) dan 7,33 kali

d im a k s u d k a n u n t u k m e n g e t a h u i p e n g a t u r a n (9 6 ja m ). Se m e n t a r a , p a d a p e r la k u a n C (t a n p a t r a n s k r ip s i g e n s e la m a u ji t a n t a n g d e n g a n

pro b io t ik) t erlih at pada 24 dan 7 2 jam set e lah u ji menginfeksikan

V. har veyi mencapai t ingkat t ranskripsi 2,09 se cara in d ivid u al d ari b en ih lo b st e r din o rmalisasi

V. har veyi . Tingkat ekspresi gen mRNA

t ant ang

dan 4,7 kali (Gambar 6).

menggunakan 18srRNA sebagai reference endogenous (ko nt ro l int ernal), kemudian diekspresikan t erhadap

Sist em akt ivasi pro PO pada krust asea merupakan ekspresi dasar pada paparan no l (0) jam. Hasil yang

aspek pent ing dari innat e immunit y , dan t ahapan awal dipero leh disajikan dalam masing-masing pengat uran

dalam mengkatalisa melanisasi pada invertebrata. Wang mekanisme pert ahanan pada lo bst er.

et al. (2010) menyat akan bahwa t ingkat ekpresi proPO m e n in g k a t p a d a Fenn er op en aeus chi nensi s ya n g

Sist em akt ivasi gen ALFHa-1 dan ALFHa-2 (an t i- t erinfeksi Vibrio anguillar um . Pe nin gkat an re gu lasi lipo po lysacharida fact o r) t erlihat signifikan t erhadap

pro PO merupakan hal yang pent ing sebagai respo ns peningkat an regulasi imun pada perlakuan A (pakan

melawan infeksi Vibrio . Pro ses akt ivasi sist em Pro PO moist dengan ragi, S. cerevisiae ) dari 24 jam hingga 96

memerlukan part isipasi pro t ease dan mekanisme ini jam set elah uji tant ang. Tingkat transkripsional ALFHa-

memerlukan ket epatan pengontrolan untuk mencegah

1 mencapai 2,09 kali (24 jam), dan 4,79 kali (96 jam). kerusakan jaringan. Pheno lo xyd ase d ipro du ksi d ari Se ment ara, pada perlaku an B (p akan moist

d engan

pengakt ifan prophenoloxidase (proPO system) sebagai

Co p yright @ 2 017 , Jurnal Riset Akuakultu r, e-ISSN 250 2-65 34

Jurnal Riset Akuakult ur, 12 (1), 2017, 85-97

24 48 72 96 24 48 72 96 Wakt u (jam ) / Time (hours )

Wakt u (jam ) / Time (hours )

Gambar 5. Tingkat ekspresi mRNA dari ant i-lipopolysacharide fact or (ALFHa-1 (A) dan ALFHa-2 (B)) dalam

V. har veyi . Benih lo bst er diberi pakan moist pelet dengan penambahan (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, (C) t anpa pro bio tik Figure 5.

hemo sit lo bst er P. homarus set elah diuji t ant ang dengan

Expression value mRNA of ant i-lipopolysacharide fact or (ALFHa-1 (A) and ALFHa-2 (B)) in j uvenile lobst er P. homarus hemocyt es aft er V. harveyi challenge t est . Juvenile lobst er fed moist diet s supple- ment ed wit h (A) yeast S. cerevisiae, (B) combinat ion of probiot ic, and (C) wit hout probiot ic

fe n o me n a “ cascade ” d e n gan b e b e rap a cara u n t u k sist em pro pheno loxidase/pro PO, mekanisme clot t ing perfo rmansi fungsi o rgan.

hemolim , melanisasi respo ns imun ant imikro ba) dan Sistem imun pada benih lo bst er sebagaimana pada

p e r t a h a n a n s e lu le r (fa g o s it o s is , e n k a p s u la s i,

d e gr an u las i se lu le r, d an p e le p as an fak t o r-fa kt o r spesies invert ebrat a lain, t ergant ung pada I nnat e i m m uni t y munit y . Innat e immunit y t erbagi dalam pert ahanan hu-

innat e im-

p a d a in ve r t e b r a t a moral (mengaktifasi beberapa bagian proteolyt ic

p e r t a h a n a n ).

dimediasi o leh sel hemo sit yang bersirkulasi.

24 48 72 96 Wakt u (jam ) / Time (hours)

Gambar 6. Tingkat ekspresi mRNA dari proPO act ivat ing syst em (pro pheno lo xidase-

Pro PO) d alam he mo sit be nih lo b st er P. homar us se t e lah diuji t ant an g dengan

V. har veyi . Be n ih lo b st e r d ib e ri p aka n m oist p e le t d e n g a n penambahan (A) ragi S. cerevisiae , (B) ko mbnasi pro bio t ik, dan (C) t anpa

pro b io t ik

Figure 6. Expression value mRNA of proPO act ivat ing syst em (prophenoloxidase-ProPO) in j uvenile lobst er P. homarus hemocyt es aft er V. harveyi challenge t est . Juvenile lobst er fed moist diet s supplement ed wit h (A) yeast S. cerevisiae, (B) probiot ic, and (C) wit hout probiot ic

Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i)

Hemolymp Clott ing M echanism

V. penaecida ) dan virus (WSSV) pada udang P. j aponicus

(Maningas et al ., 2008).

Transglut aminase (Tgase) dan

clot t ing

pro t ein (CP)

b erpe ran d alam clot t ing sist e m kru st asea. Tin gkat

Ant ioxidant Defense M echanism

ekspresi gen Tgase benih lo bst er dengan pakan moist yang dit ambahkan ragi, S. cerevisiae relat if lebih t inggi

Gl ut a t hi on e p er ox i d ase (GPO) a d a la h e n z im 1,25-1,71 kali daripada perlakuan C (pakan moist tanpa

an t io ksid an yan g m e me d iasi ke ru sakan o ksid at if. probio tik) set elah 24-96 jam t erpapar hanya 0,84-1,45

Tingkat ekspresi imun dengan t argen gen GPO pada kali. Pada pakan moist dengan ko mbin asi pro bio t ik

perlakuan A (pakan moist dengan penambahan ragi, S. set elah t erpapar selama 24, 48, 72 jam hingga 96 jam

cerevisiae ) menunjukkan tingkat yang rendah yaitu 3,62 dengan

V. har veyi menunjukkan kelipatan ekspresi gen kali (24 jam); 1,15 kali (48 jam); 2,51 kali (72 jam); dan Tgase yang t inggi masing-masing sebesar 1,28; 2,37;

2 ,0 5 k a li (9 6 ja m ). Se m e n t a r a , p a d a p e r la k u a n 6,36; dan 16,24 kali (Gambar 7A).

ko mbinasi pro bio t ik t ingkat ekspresi dipero leh pada 48-96 jam set elah uji t ant ang dengan

V. har veyi yait u Ekspresi gen CP menunjukkan pengat uran imun

9,22 kali (48 jam); 13,00 kali (72 jam); dan 37,75 kali yang meningkat sejak 24, 48, 72, dan 96 jam set elah

(96 jam) (Gambar 8) . Pada perlakuan C (tanpa pro biotik) uji t ant ang dengan

e ks p re si im u n yan g t in ggi t e rlih at s e t e lah b e n ih moist yang dit ambahkan ragi S. cerevisiae (Gambar 7B).

V. har veyi pada pemberian pakan

24 jam (8,61 kali), 72 jam Kelipat an ekspresi imunit as yang mengko de gen CP

lo bst er t erpapar

V. har veyi

(1 9 , 9 k a li), d a n 9 6 ja m (1 5 ,6 1 k a li). Ge n GPO sebesar 11,06 kali (24 jam), 14,52 kali (48 jam), 2,30

ment ransfo rmasi hidro genpero ksida menjadi air dan kali (72 jam), dan 8,2 k,li (96 jam). Pada benih lo bst er

o ksigen dengan kat alisasi sebelum radikal hidro ksil yang diberi pakan mo ist dengan ko mbinasi pro bio t ik

dapat dihasilkan. Bila lo bst er terinfeksi penyakit , maka dan t anpa pro bio t ik, kelipat an ekspresi gen CP t idak

akan t erjadi st res o ksidat if.

berbeda nyat a. Pengujian ekspresi gen yang berhubungan dengan Pada lo bst er yang mengalami luka, sist em clot t ing

imun it as men ggunakan t arge t gen yang mengko de pro t ein berp eran cepat unt uk m encegah hilangnya

serum amyloid protein (SAA) menunjukkan ekspresi yang

h e m o lim . Sis t e m c l ot t i ng ju g a t e r lib a t d a la m ber variasi (Gamb ar 9). Pada paparan 24 jam, be nih memo bilisasi pencegahan tersebarnya pato gen melalui

lo bst er yang dipelihara dengan pakan moist pelet dan hemocoel . Sement ara, pada t ransglut aminase (Tgase)

penambahan ragi S. cerevisiae memberikan kelipat an berperan dalam memediasi koagulasi hemo lim dengan

ekspresi yang t inggi (5,07 kali), namun pada 48, 72, men- t riger po limerisasi clot t ing pro t ein. Penggunaan

d an 9 6 ja m , e k sp re si im u n it as m e n u ru n m asin g- RNA int er ferens m enu nju kkan b ahwa Tgase d an CP

masing sebe sar 2,90 ; 2,36; dan 3,91 kali. Ekspresi

be rpe ran dalam pert ah anan dan m encegah bakt e ri imunit as pada benih lo bst er yang diberi pakan moist

24 48 72 96 24 48 72 96 Wakt u (jam) / Time (hours)

Wakt u (jam ) / Time (hours) Gambar 7. Tingkat ekspre si mRNA dari t ransglut aminase (Tgase) (A) dan clot t ing prot ein (CP) (B) dalam

hemo sit benih lo bst er, P. homarus set elah diuji t ant ang dengan

V. har veyi . Benih lo bst er diberi pakan moist pelet dengan penambahan (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

Figure 7. Expression value mRNA of t ransglut aminase (Tgase) (A) and clot t ing prot ein (CP) (B) in j uvenile lobst er P. homarus hemocyt es aft er V. harveyi challenge t est . Juvenile lobst er fed moist diet s supplement ed wit h (A) yeast S. cerevisiae, (B) combinat ion of probiot ic, and (C) wit hout probiot ic

Co p yright @ 2 017 , Jurnal Riset Akuakultu r, e-ISSN 250 2-65 34

Jurnal Riset Akuakult ur, 12 (1), 2017, 85-97

24 48 72 96 Wakt u (jam ) / Time (hours)

Gambar 8. Tingkat ekspresi mRNA dari glut at hione peroxidase (GPO) pada hemo sit benih

lo bst er P. homarus set elah diuji t ant ang den gan

V. har veyi . Be nih lo b st er diberi pakan moist pelet dengan penambahan (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

Figure 8. Expression value mRNA of glut at hione peroxidase (GPO) in j uvenile lobst er, P. homarus hemocyt es aft er V. harveyi challenge t est . Juvenile lobst er fed moist diet s supplement ed wit h (A) yeast S. cerevisiae, (B) combinat ion of probiot ic, and (C) wit hout probiot ic

24 48 72 96 Wakt u (jam) / Time (hours)

Gambar 9. Tingkat ekspresi mRNA dari serum amyloid prot ein (SAA) pada hemo sit benih

lo bst er P. homarus set elah diuji t ant ang dengan

V. har veyi . Benih lo bst er diberi pakan moist pelet de ngan penambahan (A) ragi S. cerevisiae , (B) ko mbinasi pro bio t ik, dan (C) t anpa pro bio t ik

Figure 9. Expression value mRNA of serum amyloid prot ein (SAA) in j uvenile lobst er P. homarus hemocyt es aft er V. harveyi challenge t est . Juvenile lobst er fed moist diet s supple- ment ed wit h (A) yeast S. cerevisiae, (B) combinat ion of probiot ic, and (C) wit hout probiotic

den gan ko mb inasi pro bio t ik p ada 48 jam t erpapar Respo ns imun yang t erkait dengan gen imunit as

V. har veyi m enu njukkan nilai yang t inggi 9,2 9 kali. pada lo bst er t erhadap infeksi penyakit bakt erial akan Im unit as lo bst er yan g diberi moist t anp a p ro b io t ik

m e m b an t u m e n je las ka n p e n g at u ra n im u n in an g menunjukkan peningkat an imunnya set elah 96 jam

(lo b s t e r ) m e la w a n in fe k s i p e n ya k it t e r s e b u t . (3,7 kali).

Pe n g g u n a a n RT-q PCR u n t u k m e n g k ar a k t e r isa s i

Co p yright @ 201 7, Jurn al Rise t Akuakult ur, e-ISSN 25 02-6534

Respons imunitas benih lobster, Panulirus homarus dengan ..... (Haryant i)

perubahan ekspresi mRNA dari t ujuh gen t arget yang t io n and transcript io nal response t o Vibrio fluvialis t erkait imunit as set elah diuji t antang dengan

challenge. Comp. Biochem. Physiol Part D Genomic (penyakit bakt erial penyebab red body disease ) dapat

V. har veyi

Prot eomics , 3(4), 263-269.

me mb ukt ikan imp likasi fun gsi yang je las t erh ad ap Clark, K.F. (2013). Discover y of novel molecular immune peran penggunaan probio tik yang berasal dari mikroba

m ed i a t or s i n t h e Am er i ca n l ob st er (H om a r u s t e rhad ap peningkat an re spo ns imun it as. Dari hasil

americanus ) during bact erial, eukaryot ic parasitic and t ersebut t erbukt i bahwa penggunaan ragi, S. cerevisiae ,

viral challenges . Do cto r o f Philo so phy a t hesis. Uni- p ro b io t ik Al t eromonas s p . BY-9 d an

versit y o f Prince Edward Island. m e r u p a k a n s a t u d i a n t a r a m e t o d e p e n ce g a h a n

B. cereus BC)

Clark, K.F., Gre e nwo o d , S.J., Aco rn , A.R., & Byrne , penyakit infeksi (virus dan bakt eri) melalui peningkat an

P.J. (20 13 ). Mo lecular im mu ne respo nse o f t he imunit as dalam pro duksi lo bst er.

American lobster ( Homarus americanus ) t o the whit e spot syndrome virus . J. Invert ebr. Pat hol ., 114(3), 298-

KESIM PULAN

Pert umbuhan bo bo t , panjang, dan sint asan benih Daniels, C.L., Marrifield, D.L., Bo o t hro yd, D.P., Davies, lo bst er t idak bebeda nyat a ant ar perlakuan.Tingkat

S.J., Fact o r, J.R., & Arno ld, K.E. (2010). Effect o f

e k s p r e s i im u n it a s t e r h a d a p t u ju h g e n t a r g e t diet ar y Bacillus spp. and Mannan Oligo saccharides (ALFHa-1, ALFHa-2, Pro PO, Gpo , CP, SAA, dan GPo )

(MOS) o n Euro pean lo bst er ( Homarus gammarus

L) lar val gro wth perfo rmance, gut mo rpholo gy and p e le t d e n g an p e n am b a h an r ag i S. cer evi si ae dan

pada benih lo bst er P. homarus yang diberi pakan moist

gut micro bio t e. Aquacult ure , 304, 49-57. ko mbinasi pro bio t ik Alt eromonas sp. BY-9 dan

Daniels, C.L., Marrifield, D.L., Rin go , E., & Davies, BC me n galam i p e nin gkat an d iban d in gkan d en gan

B. cereus

S.J. (2013). Pro bio t ic, Prebio t ic, symbio t ic appli- t anpa pro bio t ik set elah uji t ant ang dengan

cat io n fo r t he impro vem ent o f lar val Eu ro pe an (penyebab red body disease ).

V. har veyi

lo bst e rs ( Homar us gammarus ) cult ure . Aquacult ., 416-417, 396-406.

UCAPAN TERIM A KASIH

Fu, L.L., Wang, Y., Wu, Z.C., & Li, W.F. (2011). In vivo Penelit ian ini dilaksanakan dengan pendanaan dari

assesment fo r o ral deliver y o f Bacillus subt ilis har- DIPA 2015 Balai Besar Penelit ian dan Pengembangan

bo ring a viral pro t ein (VP28) against whit e spo t Bud id aya Laut Go n do l, Ke m en t e rian Kelaut an dan

syndro me virus in Lit openaeus vannamei . Aquacul- Perikan an. Penu lis juga mengucapkan t erim a kasih

t ure , 322-323, 33-38.

k e p a d a s e m u a t e k n is i lit k a ya s a la b o r a t o r iu m Haut o n, C., Bro ckt o n, V., & Smit h, V.J. (2013). Changes

b io t e kn o lo gi dan lab o rat o riu m p akan -n u t risi at as in imm u n it y ge n e xpre ssio n and re sist ance t o bant uannya dalam pelaksanaan penelitian ini.

bact erial infectio n in lo bst er ( Homarus americanus ) po st -lar va st age VI fo llo wing acut e o r chro nic ex-

DAFTAR ACUAN

po sure t o immu nit y st im ulat in g co mp o un ds. J. Ahmad, R.Z. (2005). Pemanfaat an khamir S. cereviceae

Invert ebr. Pat hol ., 114(3), 289-297. unt uk t ernak. Wart azoa , 15(1), 49-55.

Huu , H.D., & Jo ne s, C.M. (2 0 14 ). Effe ct o f d iet ar y An h, T.L., & Jo n es,C. (201 4). St at us rep o rt o f Vie t -

mannan o ligo saccharide supplement at io n o n ju- nam lo bst er gro w-o ut . Proceeding of t he Int erna-

Lanjutkan membaca

Dokumen baru

PENGARUH PENERAPAN MODEL DISKUSI TERHADAP KEMAMPUAN TES LISAN SISWA PADA MATA PELAJARAN ALQUR’AN HADIS DI MADRASAH TSANAWIYAH NEGERI TUNGGANGRI KALIDAWIR TULUNGAGUNG Institutional Repository of IAIN Tulungagung

36 1018 16

PENGARUH PENERAPAN MODEL DISKUSI TERHADAP KEMAMPUAN TES LISAN SISWA PADA MATA PELAJARAN ALQUR’AN HADIS DI MADRASAH TSANAWIYAH NEGERI TUNGGANGRI KALIDAWIR TULUNGAGUNG Institutional Repository of IAIN Tulungagung

17 286 43

PENGARUH PENERAPAN MODEL DISKUSI TERHADAP KEMAMPUAN TES LISAN SISWA PADA MATA PELAJARAN ALQUR’AN HADIS DI MADRASAH TSANAWIYAH NEGERI TUNGGANGRI KALIDAWIR TULUNGAGUNG Institutional Repository of IAIN Tulungagung

13 228 23

PENGARUH PENERAPAN MODEL DISKUSI TERHADAP KEMAMPUAN TES LISAN SISWA PADA MATA PELAJARAN ALQUR’AN HADIS DI MADRASAH TSANAWIYAH NEGERI TUNGGANGRI KALIDAWIR TULUNGAGUNG Institutional Repository of IAIN Tulungagung

2 162 24

PENGARUH PENERAPAN MODEL DISKUSI TERHADAP KEMAMPUAN TES LISAN SISWA PADA MATA PELAJARAN ALQUR’AN HADIS DI MADRASAH TSANAWIYAH NEGERI TUNGGANGRI KALIDAWIR TULUNGAGUNG Institutional Repository of IAIN Tulungagung

14 223 23

KREATIVITAS GURU DALAM MENGGUNAKAN SUMBER BELAJAR UNTUK MENINGKATKAN KUALITAS PEMBELAJARAN PENDIDIKAN AGAMA ISLAM DI SMPN 2 NGANTRU TULUNGAGUNG Institutional Repository of IAIN Tulungagung

13 296 14

KREATIVITAS GURU DALAM MENGGUNAKAN SUMBER BELAJAR UNTUK MENINGKATKAN KUALITAS PEMBELAJARAN PENDIDIKAN AGAMA ISLAM DI SMPN 2 NGANTRU TULUNGAGUNG Institutional Repository of IAIN Tulungagung

10 281 50

KREATIVITAS GURU DALAM MENGGUNAKAN SUMBER BELAJAR UNTUK MENINGKATKAN KUALITAS PEMBELAJARAN PENDIDIKAN AGAMA ISLAM DI SMPN 2 NGANTRU TULUNGAGUNG Institutional Repository of IAIN Tulungagung

5 161 17

KREATIVITAS GURU DALAM MENGGUNAKAN SUMBER BELAJAR UNTUK MENINGKATKAN KUALITAS PEMBELAJARAN PENDIDIKAN AGAMA ISLAM DI SMPN 2 NGANTRU TULUNGAGUNG Institutional Repository of IAIN Tulungagung

7 293 30

KREATIVITAS GURU DALAM MENGGUNAKAN SUMBER BELAJAR UNTUK MENINGKATKAN KUALITAS PEMBELAJARAN PENDIDIKAN AGAMA ISLAM DI SMPN 2 NGANTRU TULUNGAGUNG Institutional Repository of IAIN Tulungagung

14 323 23