Directory UMM :Data Elmu:jurnal:B:Brain Research:Vol887.Issue1.Dec2000:

(1)

www.elsevier.com / locate / bres

Research report

Regulation of benzodiazepine receptor binding and GABA subunit

mRNA expression by punishment and acute alprazolam administration

*

Min Liu, John R. Glowa

Department of Pharmacology and Therapeutics, Louisiana State University Health Sciences Center in Shreveport, 1501 Kings Highway,

P.O. Box 33932, Shreveport, LA 71130-3932, USA Accepted 12 September 2000

Abstract

Quantitative autoradiography of benzodiazepine (BZ) receptors and competitive reverse transcription–polymerase chain reaction were used to characterize changes in BZ binding and GABA_A receptor subunit transcription levels associated with the anxiolytic effects of alprazolam. Effects were assessed on punished and non-suppressed water consumption using a lick suppression (Vogel) paradigm.

Alprazolam had no effect on non-suppressed licking, [ H]Ro 15-1788 binding or receptor subunit transcript levels, compared to non-drug controls. When each fifth lick produced a shock (0–0.5 mA), responding was suppressed in an intensity-related manner. The highest

intensity significantly decreased licking (85%), [ H]Ro 15-1788 binding (12%) anda1 transcript levels (63%) in the basolateral nucleus 3

of the amygdala, and [ H]Ro 15-1788 binding in the mediodorsal thalamic nucleus (15%), compared to non-punished controls. Punishment increased the ratio ofg2L / S transcripts in the basolateral nucleus of the amygdala. Alprazolam blocked or reversed each of these effects. These results show that punishment has similar effects on BZ binding and GABAA receptor subunit expression and that alprazolam can block or reverse those effects. Such changes may be related to the anxiolytic effects of alprazolam.  2000 Elsevier Science B.V. All rights reserved.

Theme: Neural basis of behavior

Topic: Motivation and emotion

Keywords: Benzodiazepine; Alprazolam; GABA receptor; Receptor subunit; Punished responding; AnxietyA

1. Introduction g2 subunit is determined by the presence or absence of an eight amino acid sequence, respectively [38]. The g2L

g-Aminobutyric acid (GABA) is the principal inhibitory subunit encodes a sequence that can be phosphorylated by 21

neurotransmitter in the vertebrate central nervous system. protein kinase C [37] and by a Ca / calmodulin-depen-Its actions on GABAA receptors mediate a bicuculline- dent protein kinase II [21]. The g2S subunit most likely

2 3

sensitive Cl ion channel that is thought to play a major binds to theb subunit; site-directed mutagenesis and [ H] role in the neurochemistry of stress and anxiety. Native muscimol binding studies suggest two homologous do-GABAA receptors are most likely heteropentameres, co- mains of this subunit are critical for activation of the assembled from a variety of possible subunits (e.g.,a1–6, GABAA receptor [5]. Receptors containing different

b1–3, g1–3, d, e, p and r1–3) [4,23,26]. While co- combinations are topographically distributed, predominant-expression ofa-,b-, andg-subunits is a likely requirement ly in cortical, limbic and cerebellar structures.

for a fully functional GABAA receptor, alternative splice Benzodiazepines (BZs) pharmacologically modulate variants further increase possible receptor configurations. GABA receptors through an allosteric binding site. TheyA For example, a ‘long (g2L)’ or ‘short (g2S)’ variant of the are the principal pharmacological means of treating anxiety and stress. BZ binding is thought to require both a andg

subunits, and different a subunits can determine the

*Corresponding author. Tel.: 11-318-675-4803; fax: 1

1-318-675-affinity of different BZs for the GABA complex. While

7857. A

E-mail address: [email protected] (J.R. Glowa). diazepam does not discriminate among GABAA receptors

(2)

composed of a1–3, or a5 subunits, the imidazoben- 2. Materials and methods

zodiazepine Ro 15-4513 prefers receptors constructed from

a4 or a6 subunits. g2 subunits can confer further spe- 2.1. Materials cificity for BZs. Diazepam-sensitive sites are primarily

located in the cerebral cortex, cerebellum, amygdala, Alprazolam (Upjohn Co., Kalamazoo, MI) was dis-hippocampus, and hypothalamus. These sites have been solved in 10% alcohol, 10% alkamuls EL-620, and 80%

further distinguished as BZ1 and BZ2, based on their saline (vehicle). [ H]Ro 15-1788 (87.0 Ci / mmol) was pharmacology [26]. purchased from New England Nuclear (Boston, MA). The While the role of GABA and BZ receptors in stress is GABAA receptor a1, b2, g2S and g2L subunit internal well accepted, there is growing evidence to suggest that standards, cloned in pGEM 1 and containing targeted stress, and possibly anxiety, can affect GABA physiology. restriction enzyme cleavage sites (Bgl II), were obtained For example, early reports showed that stressful situations from Dr Dennis R. Grayson. Sph I and Bgl II were can down-regulate GABA receptor density [2]. BZ bind-A purchased from Promega Co. (Madison, WI). Polymerase ing can also undergo rapid changes after exposure to stress chain reaction (PCR) primer pairs were synthesized by [37]. This modulation can depend on several factors Life Technologies (Gaithersburg, MD). Ready-To-Go RT– including the type of site, the nature of the stressful event, PCR beads, DNA and the gel band Purification kit were the duration of stress, as well as psychological factors such purchased from Pharmacia Biotech (Piscataway, NJ). All as escapability or specificity of conditioning [8,9,40]. As other chemicals used in this study were obtained from few reports have explored whether anxiety-related situa- Sigma Chemical Co. (St Louis, MO).

tions affect binding through actions on specific GABAA

subunits, the current study pursued this possibility using 2.2. Subjects the high-affinity triazolobenzodiazepine alprazolam [6]. As

methods to assess such effects in humans are not yet Seventy-two male Sprague–Dawley rats, weighing 250– available, a preclinical model was used to study the 300 g, were used. The animals were kept individually anxiolytic effects of this drug. under standard controlled conditions (temperature |228C;

The preclinical anxiolytic effects of BZs are often humidity|55%; normal phase 12-h light–dark cycle) for at

studied on punished (suppressed) responding, because least 1 week after arrival, and during the experiments. increases in punished responding can distinguish an an- Food and water were freely available prior to beginning xiolytic effect from other types of drug effects (e.g., the experimental procedures.

anticonvulsant, sedative, hypnotic, amnesic, appetite

stimulating). The potencies with which different BZs 2.3. Procedure exhibit anti-punishment effects, as well as their affinities at

BZ receptors, are well correlated with their clinical poten- Conflict testing was carried out according to the method cies [20]. Increases in punished responding can also be of Vogel [36], with minor modifications. Animals were obtained in humans [1], allowing for follow-up studies water-restricted for 36 h before the experiment. On the first when appropriate methods are developed. A number of two days, water-restricted subjects were placed in the studies in animals have shown that direct injections of BZs testing chamber (28320320 cm) with a stainless steel grid or GABA receptor agonists into limbic sites can increaseA floor and a metal drinking spout connected to a constant punished responding [17,30,33]. In addition, intra- current shock generator (Model E53-13, Coulbourn Instru-amygdala injections of the BZ antagonist Ro 15-1788 can ments, Lehigh Valley, PA). Rats were allowed to find the block BZ-induced increases in punished responding [34]. drinking spout and consume water without shock for 10 These studies suggest a role for limbic sites in the min. The number of licks was detected through a drin-anxiolytic effects of BZs. A preliminary study found that kometer circuit. After each session, rats were allowed to the anxiolytic effects of alprazolam were also associated drink water for 60 min in their home cages but otherwise with changes in GABAA receptor subunit composition in remained water-restricted. During subsequent experimental the amygdala of the rat [19]. As such, the current study sessions the rats were placed into the apparatus and focussed on that structure. Quantitative receptor au- allowed access to water without shock for 5 s, then a shock toradiography was used to confirm the topographic dis- circuit was activated. A constant current shock generator tribution of BZ sites and to assess changes in binding in connected to the floor grids and the drinking spout. Shock response to punishment, alprazolam, and their combina- was delivered at each fifth lick, and the apparatus recorded tion. Then, a quantitative, competitive reverse transcrip- the number of shocks delivered. Session length was always tion–polymerase chain reaction (RT–PCR) assay was used 10 min. All experiments were carried out between 9.00 to assess the expression of genes associated with a1, b2, a.m. and 11.00 a.m. Initial experiments assessed the effects

g2S and g2L subunits of the GABAA receptor in the of shock intensity (0.0–0.5 mA) and then at 0.5 mA, amygdala under the same conditions. alprazolam dose (0.3–4.8 mg / kg). For subsequent

(3)

experi-3 ments, animals were divided into six groups (n56 / group): standards (Amersham). The non-specific binding of [ H]Ro saline control without shock, vehicle-treated without 15-1788 was less than 5% of the total binding. The

shock, alprazolam-treated without shock, saline control analyses were performed on total [ H]Ro 15-1788 binding. with shock, vehicle-treated with shock, and

alprazolam-treated with shock. A shock intensity of 0.5 mA was used. 2.5. Competitive RT–PCR: basolateral amygdaloid Saline, vehicle and alprazolam (1.2 mg / kg) were given i.p. nucleus

in a volume of 1 ml / kg body weight, 30 min before the

test session. Immediately following the last test session, Competitive RT–PCR reactions using internal standards animals were removed to an adjacent room and decapitated specific for GABAA receptor subunits were conducted without anesthesia. Two separate experiments were con- according to methods described previously [12]. Plasmids ducted (n536 each), one for the autoradiographic evalua- containing mutant cDNA specific for a1, b2, 2gS, and

tion of [ H]Ro 15-1788 binding and one for competitive 2gL subunits were transformed into JM109 competent RT–PCR. cells, grown in LB medium with ampicillin, and extracted by alkaline lysis plasmid Midipreps. For in vitro transcrip-3

2.4. Autoradiographic evaluation of [ H]Ro 15-1788 tion, these plasmids were linearized by Sph I, and were binding in selected brain sites transcribed by T7 RNA polymerase according to the manufacturer’s (Promega Co.) instructions. Concentrations The rat brains were rapidly removed, frozen in dry of cRNA of each subunit were quantified at A260 by UV ice-chilled isopentane, wrapped in aluminum foil, and spectrophotometry and used as an internal standard. stored at2868C. Coronal sections (10mm) were cut from Tissue was micropunched from basolateral amygdaloid selected brain areas in a cryostat-microtome, maintained at nucleus (the only region studied) by using an 18-gauge

2198C, and mounted onto gelatin–chrome–alum-coated stainless-steel tube made from a hypodermic needle. RNA slides at room temperature. At each brain level studied was extracted and isolated using RNAgents Total Isolation (16.7 mm and 14.2 mm, interaural), two sections were System according to the manufacturer’s protocol (Promega taken: one for total binding and one for non-specific Co.), briefly described below. Tissue was homogenized in binding. The slides were dried in a stream of air for 1 h, denaturing solution (26 mM sodium citrate, pH 4.0, 0.5% packed into boxes containing silica gel and stored at N-lauryl sarcosine, 0.125 M b-mercaptoethanol, 4 M

2868C until required for binding. On the day of the aguanidine thiocyanate), mixed with sodium acetate (2 M, analysis, the slides were allowed to reach room tempera- pH 4.0) and phenol: chloroform: isoamyl alcohol ture in the boxes. The brain sections were subjected to (25:24:1), and centrifuged at 10,000 g for 20 min at 48C. osmotic shock to eliminate endogenous GABA [22] by a RNA was precipitated from the aqueous phase by the 3-min wash in room temperature distilled deionized water, addition of isopropanol, washed with 75% ethanol, and followed by two 5-min rinses in ice-cold buffer, then dried dissolved in DEPC-treated water. The yield of total RNA for 1 h in a stream of cold, dry air. was determined by measuring the absorbance at 260 / 280

BZ receptors were visualized using [ H]Ro 15-1788 nm. Removal of contaminating DNA was confirmed by under standard autoradiographic conditions [39]. Briefly, PCR analysis of total RNA samples without reverse slide-mounted tissue sections were incubated for 40 min at transcription. The RNA was stored at 2868C until the

48C with 4 nM [ H]Ro 15-1788 (87 Ci / mmol, New competitive RT–PCT assay was run.

England Nuclear, Boston, MA) in 0.17 M Tris–HCl (pH Various amounts of cRNA prepared from the appropriate 7.4 at 48C). Non-specific binding was estimated with cold standard template were added to a constant amount of total

Ro 15-1788 (10 M Ro 15-1788 in the cold incubation RNA (1mg / tube). Reverse transcription and PCR amplifi-solution). After incubation, the slides were washed for 2 cation were performed in a single tube, which contained a min in cold buffer to reduce non-specific binding. The Ready-To-Go RT–PCR bead. Each reaction (50 ml final slides were then dipped briefly in ice-cold distilled water volume) contained 10 mM Tris–HCl (pH 9.0), 60 mM and dried immediately under a stream of cool, dry air. KCl, 1.5 mM MgCl , 2002 mM of each dNTP, Moloney Slides were affixed to a mounting board, placed in X-ray Murine Leukemia Virus (M-MuLV) reverse transcriptase, cassettes with radioactive standards (Amersham, Arlington 2.0 units of Taq DNA polymerase, ribonuclease inhibitor

Heights, IL) and apposed to tritium-sensitive film ( H- (porcine) and stabilizers, including RNasa / DNasa-free Hyperfilm; Amersham). After a 3-week exposure, the films BSA. Each reaction also contained 1mM each of 59(sense) were developed using D19, according to the manufactur- and 39 (antisense) subunit-selective primers, described in er’s instructions (Kodak, Rochester, NY). Table 1. The reaction was overlaid with mineral oil and The autoradiograms were quantified using computer- placed in a Perkin–Elmer 2400 thermocycler at 428C for assisted microdensitometry. Optical density measurements 30 min. At the end of the reverse transcription reaction, the were determined with an image analyzer (NIH Image 1.57) thermocycler was programmed to increase temperature to

(4)

Table 1

GABA receptor subunit-selective RT–PCR primersA

Subunit Primer sequence (59to 39) Position Product size

a1 sense AGCTATACCCCTAAC 1178–1482 304

TTAGCCAGG

a1 antisense AGAAAGCGATTCTC

AGTGCAGAGG

b2 sense TGAGATGGCCACAT 1201–1518 317

CAGAAGCAGT

b2 antisense TCATGGGAGGCTGG

AGTTTAGTTC

g2S sense AAGAAAAACCCTGCCCCTACAATT 1156–1492 336

g2S antisense TTCGTGAGATTCAGCGAATAAGAC

g2L sense CTTCTTCGGATGTTTTCCTTCAAG 1144–1534 390

g2L antisense CATAGGGTATTAGATCGTTGGACT

to completely denature the template. The thermocycler was applied to the drinking tube, responding decreased (P,

then programmed for 32 cycles, with each cycle consisting 0.001) as a function of increasing shock intensity (Fig. 1a), of a temperature of 958C for 45 s, 558C for 45 s, and 728C demonstrating that responding was punished. Intensities for 45 s, followed by a final elongation step (728C for 6 greater than 0.2 mA significantly decreased responding min). PCR products were digested overnight with 10 units (P,0.001). When the shock intensity was 0.5 mA (the Bgl II and separated on a 1.8% agarose gel in 0.53Tris / intensity used for all subsequent studies) the number of Borate / EDTA buffer, stained with ethidium bromide and shocks was 28.863.94 for non-injection controls and photographed under UV illumination. Adjacent lanes with 30.062.88 for vehicle controls (Fig. 1b). Fig. 1b also control PCR samples (no template) were always included shows that increasing doses (up to 1.2 mg / kg) of al-to determine background. prazolam dose-dependently increased (P,0.01) punished Data are presented as the log ratio of density of the responding. Doses higher than 1.2 mg / kg increased amplified cRNA internal standards to the density of target punished responding less than 1.2 mg / kg, possibly due to GABA subunit mRNA amplification product and plottedA their mild ataxic effects. Although significant increases against the log of known amounts of internal standard were obtained at all doses from 0.6–4.8 mg / kg (P,

cRNA added to the test sample to generate a competitive 0.001), 1.2 mg / kg was used for all subsequent studies PCR linear regression curve. The absolute amount of target because it produced maximal increases (208.8611.08 GABA subunit mRNA was calculated from the curve asA shocks / session). Fig. 1c compares the effects of saline, the point of equivalency (see arrows, Fig. 3), where the vehicle and alprazolam on punished and non-punished ratio of internal standard to target RNA was equal to 1. responding. The number of shocks taken under the punish-ment compared to the no punishpunish-ment conditions was 2.6. Statistical analyses significantly different for both saline and vehicle. Al-prazolam significantly (P,0.0001) increased punished All data (behavioral, binding and RT–PCR) were ana- responding compared to both saline and vehicle controls. lyzed using a two-way analysis of variance with Neuman–

Keuls post hoc tests. Differences were considered

signifi-cant if P-values less than 0.05 were obtained. All data are 3.2. Receptor autoradiography expressed as the mean6S.E.M. Data for licking are

characterized as the number of shocks per session, as five Fig. 2 shows that [ H]Ro 15-1788 binding was topog-licks always produced a shock, regardless of intensity. raphically distributed in the sections that were studied. Table 2 shows that among the 20 brain regions studied, the

greatest density of specific [ H]Ro 15-1788 binding was

3. Results found in the cerebral cortex. Moderately high levels of binding were observed in CA1 and dentate gyrus of the 3.1. Behavior hippocampus, basolateral amygdaloid nucleus and medial amygdaloid nucleus. The CA3 and CA2 areas of the Without shock, water-restricted animals responded al- hippocampus, central amygdaloid nucleus, several nuclei most without interruption resulting in 203.567.34 shocks of the thalamus and hypothalamus, medial mammillary (0 mA) per 10 min session (5 licks51 shock). Vehicle nucleus, ventral tegmental area and substantia nigra

dis-3

(204.367.94 shocks / session) and alprazolam played moderate levels of [ H]Ro 15-1788 binding. The (208.8367.27 shocks / session) had no effect on non- caudate–putamen and laterodorsal thalamic nucleus

ex-3

(5)

Fig. 1. Effects of alprazolam and punishment of responding in rats. Water-restricted rats were trained to lick a tube attached to a water bottle. The top frame (A) illustrates the effects of shock intensity on licking, when each fifth lick produced a shock. The middle frame (B) illustrates the effects of vehicle and different doses of alprazolam (0.3–4.8 mg / kg) on responding suppressed by 0.5 mA shock. The bottom frame compares the effects of saline, vehicle or alprazolam (1.2 mg / kg) on responding during non-punished conditions and that occurring when each fifth response produced a 0.5 mA shock

(punished). These animals were the same as those used to assess the effects of punishment and alprazolam on [ H]Ro 15-1788 binding and GABAA

receptor subunit transcription. Significant differences denoted by: *P,0.001, compared to vehicle or nonpunished control; **P,0.0001, compared to punished control or vehicle.

(6)

Fig. 2. Representative autoradiograms of midbrain coronal sections for three conditions of this study: (A) control; (B) punishment; (C) punishment plus alprazolam. Each of the regions identified, the cerebral cortex (CC), basolateral amygdaloid nucleus (B), medial amygdaloid nucleus (M), mediodorsal

thalamic nucleus (MD), and ventrolateral thalamic nucleus (V), exhibited decreased levels of [ H]Ro 15-1788 binding during punishment compared to

controls. However, only the changes in [ H]Ro 15-1788 binding in the basolateral amygdaloid nucleus and mediodorsal thalamic nucleus exhibited significant changes during punishment. Regardless, all of these effects were reversed by alprazolam, compared to punished vehicle.

Alprazolam had no effect on [ H]Ro 15-1788 binding punishment, punishment plus vehicle and punishment plus 3

under the non-punished condition. alprazolam. Punishment significantly decreased [ H]Ro 15-3

Table 2 also shows the changes in [ H]Ro 15-1788 1788 binding in the basolateral amygdaloid nucleus (12%) binding in the same brain regions of rats exposed to and the mediodorsal thalamic nucleus (15%), compared to

Table 2

3 a

Changes in [ H]Ro 15-1788 binding in brain regions of rats as a function of treatment condition

Brain region Non-punished responding Punished responding

Saline Vehicle Alprazolam Saline Vehicle Alprazolam

Cerebral cortex 260.368.5 263.667.6 259.266.4 247.466.9 248.268.3 258.966.6

Hippocampus

CA1 222.063.4 219.864.4 224.964.3 218.765.2 220.167.1 225.065.9 CA2 170.465.2 165.565.4 168.266.3 171.465.6 169.967.8 175.064.0 CA3 187.865.4 191.766.2 187.065.4 179.966.3 183.368.7 187.664.7

Dentate gyrus 233.265.7 228.967.4 225.965.8 223.068.2 224.168.0 235.065.9

Caudate–putamen 83.063.1 81.664.6 79.564.2 80.862.7 83.763.3 78.862.8

Amygdala

Central amygdaloid nucleus 144.966.2 142.064.7 146.665.4 137.266.0 141.066.3 153.765.5 [ Basolateral amygdaloid nucleus 240.968.0 236.464.8 234.766.6 206.65.8* 212.268.6* 231.667.0 Medial amygdaloid nucleus 207.268.1 209.765.7 206.965.7 188.466.6 191.667.3 212.865.1

Thalamic nucleus

Centromedial thalamic nucleus 183.8610.0 178.669.5 176.6610.1 181.1611.1 173.569.3 180.6610.2 [ Mediodorsal thalamic nucleus 171.667.3 168.765.6 169.566.1 142.666.0* 146.065.1 165.167.2 Ventrolateral thalamic nucleus 150.067.3 152.967.4 147.566.2 124.666.0* 128.766.9 140.565.3 Ventroprosterior thala nucleus 118.266.4 122.665.3 116.165.3 107.365.8 113.265.4 111.764.0 Laterodorsal thalamic nucleus 77.162.3 73.463.2 79.463.7 73.862.0 78.962.8 74.862.7

Hypothalamic nucleus

Ventromedial hypothalamic nu. 173.765.3 174.864.3 177.364.8 170.965.2 175.465.9 178.165.3 Anterior hypothalamic nucleus 167.166.6 159.864.3 164.666.2 166.365.3 165.966.7 172.466.2 Lateral hypothalamic area 145.366.4 149.266.7 147.163.9 139.266.1 142.166.7 147.866.0

Medial mammillary nucleus 131.167.8 124.667.8 126.066.8 129.667.7 128.867.8 122.867.0

Ventral tegmental area 113.163.0 116.963.8 110.564.3 114.364.5 108.864.2 109.964.6

Substantia nigra 107.568.0 111.165.8 106.964.1 105.866.8 102.565.5 99.065.2

a 3

[ H]Ro 15-1788 binding was measured using quantitative autoradiography as described in the text. Values are the mean (6S.E.M.) fmol / mg, specific

[ H]Ro 15-1788 binding per wet weight of tissue (n56 per condition). Significant (P,0.05) differences between punished and non-punished groups are indicated by an asterisk (*), while significant differences between treated and control punished groups are indicated by a pound ([_{) sign.}

(7)

(average of saline / saline and vehicle / vehicle) controls. In ratio of g2L mRNA to g2S mRNA for alprazolam plus contrast to its effects on non-punished responding, al- punishment did not statistically differ from that of any

prazolam significantly increased [ H]Ro 15-1788 binding non-punished responding condition. above vehicle and control levels in all regions in which

punishment had decreased it (basolateral amygdaloid

nu-cleus, F5, 13854.808, P50.014; mediodorsal thalamic nu- 4. Discussion

3 cleus, F5,13854.829, P50.009). The result was that [ H]Ro

15-1788 binding during punishment with alprazolam was The current study found that punishment down-regulated no different than non-punished responding, similar to the BZ binding sites in the basolateral nucleus of the amygdala behavioral results. and the mediodorsal thalamic nucleus. These results are similar to those of previous studies, which found that acute 3.3. Quantitative RT–PCR determination exposure to stress [25] or repeated exposure to punishment [14] decreased BZ binding in limbic brain. The current Competitive RT–PCR was effective in resolving signifi- study also found a parallel decrease in the expression ofa1 cant differences in the absolute amounts of GABAA GABAA receptor mRNA transcripts in the basolateral receptor subunit mRNA in the basolateral nucleus of the nucleus of the amygdala with punishment. These effects amygdala (BLA) as a function of exposure to punishment may be related, as a specific change in subunit composition and alprazolam plus punishment. Fig. 3 illustrates repre- of a GABA receptor would be expected to affect binding.A sentative gels and linear regression curves for control Both effects were either prevented or reversed by treatment amounts of individual GABA receptor subunit transcriptsA with alprazolam, while alprazolam alone had no effect. in the BLA. The point of equality (arrow) represents the These results are consistent with those of recent in situ absolute amount of mRNA (pg /mg total RNA) for each hybridization studies. One study showed that punishment subunit. In control BLA (Table 3), the most abundant specifically decreased expression ofa1 subunits compared GABA receptor subunit wasA a1, with progressively lesser to yoked (shocked), and non-shocked control animals [40]. amounts of b2, g2S and g2L, respectively. The same Another [19] replicated the down-regulation ofa1 GABAA method was used to determine amounts of subunit mRNA receptor subunits with punishment and showed that al-transcript in each of the treatment groups. Compared to prazolam could prevent that effect. Together these studies either saline- or vehicle-treated animals, alprazolam had no confirm that punishment down-regulates the a1 GABAA effect on the amount of GABAA receptor subunit expres- receptor subunit in the amygdala and that alprazolam sion. Punishment significantly decreased the expression of counter-regulates this change. Less clear is whether these

a1 mRNA in both control groups compared to the same effects mediate the anxiolytic effect of BZ’s.

control group for non-punished responding, to about 37% Punishment also increased, and alprazolam decreased, of control levels. Alprazolam significantly increased the the ratio ofg2L / S mRNA, in the basolateral nucleus of the expression of a1 mRNA compared to vehicle or saline amygdala. A recent study identified two regions on theg2 when responding was punished. As alprazolam plus pun- subunit that appear to distinguish BZ binding from allo-ishment produced absolute amounts ofa1 mRNA that did steric coupling of BZ and GABA binding sites [3]. not statistically differ from those in any of the non- Decreases in theg2L / S ratio could alter the phosphoryla-punished conditions (saline, vehicle or alprazolam), it tion state of the GABA receptor, conformational stability,A appeared as if alprazolam reversed the decrease in a1 or trafficking of theg2 subunit to cell membranes [18,35]. mRNA produced by punishment. This, in turn, may result in a decrease in the ability of Punishment decreased level ofg2S transcript to 83–85% GABA or other agonists to enhance GABAA receptor-of control levels and increased level receptor-of g2L transcript to mediated chloride flux. Alterations in theg2L / S ratio may 116–125% of control levels, but neither effect alone also affect regulation of the spliceosome. These protein / obtained statistical significance. Each of these effects was RNA / ribo-nucleoprotein particle complexes are involved reversed by pretreatment with alprazolam. Neither punish- in the splicing of precursor mRNA to mature mRNA [7]. ment nor alprazolam significantly altered the expression of They most likely play a role in regulation of the inclusion

b2 subunit transcripts. or exclusion of exons, like the exon found in the g2L In order to assess whether changes in expression ofg2S mRNA [15]. However, the effects of alprazolam on and g2L transcripts might be due to altered alternative spliceosome regulation have not been studied.

splicing of g2 transcripts, the relative abundance of g2S GABAA receptor function is also influenced by post-andg2L mRNAs was directly compared across the differ- translational receptor modifications, including phosphoryl-ent treatmphosphoryl-ent groups. While alprazolam had no effect on ation [27]. For example, a number of protein kinases, the ratio ofg2L mRNA tog2S mRNA for non-punished including PKA and PKC, influence GABAA receptor-me-responding, punishment alone non-significantly increased diated chloride uptake. Most GABAA receptor subunits this ratio and alprazolam significantly decreased this ratio, contain phosphorylation sites, some of which may exist when compared to the punishment control conditions. The endogenously in a phosphorylated state [37]. Although the

(8)

Fig. 3. Representative gels and linear regression plots ofa1,b2,g2S, andg2L mRNA transcripts for GABAA receptor subunits from rat basolateral amygdaloid nuclei generated by competitive RT–PCR. A series of concentrations of internal standard cRNAs were added to each tube containing 1mg of total RNA. The RT–PCR products are shown in triplicate for each subunit. Top bands are PCR products of target mRNA. Bottom bands are Bgl II-digested internal standard PCR products. Note that increasing concentrations of internal standards compete with target mRNA for amplification. Linear regression analysis of the log-transformed ratios (cRNA / total RNA) versus the amount of internal standard cRNA added to the reaction generates the point of equivalent amplification (p.o.e., arrow) where the ratio is 1. This represents the absolute concentration of target GABA receptor subunit mRNA.A

time-course for the effects presently found was rapid, the Tolerance can develop to many of the behavioral effects present study does not rule out alterations in post-transla- of BZs, resulting in changes in CNS substrates different tional processing as a mechanism for down-regulating than those presently described. In particular, tolerance to GABAA receptors after punishment and up-regulating the anticonvulsant effects of diazepam has been associated GABA receptors after acute alprazolam treatment. Altera-A with decreased a1 message in the frontoparietal motor tions in phosphorylation states of particular subunits, as cortex and hippocampus [13]. In contrast, tolerance does well as subunit assembly, may be important mechanisms not occur to the anti-punishment effects of BZs or to their underlying the influence of punishment and alprazolam. clinic effects on anxiety. As such, these changes in cortex

(9)

Table 3

Quantification of mRNA levels for GABA receptor subunits in rat basolateral amygdaloid nucleusA

Subunit Non-punished responding Punished responding

Saline Vehicle Alprazolam Saline Vehicle Alprazolam

[[

a1 63.067.0 62.266.5 62.864.7 23.363.8* 23.263.4* 65.065.4

b2 45.266.0 46.867.0 43.766.9 48.364.3 48.565.2 46.165.3

g2S 21.362.3 21.262.0 21.062.3 17.761.7 18.062.0 24.461.3

g2L 12.861.3 12.261.3 12.161.5 14.961.1 15.261.2 11.760.9

[

g2L /g2S 60.865.9 58.466.8 59.169.9 85.566.4 85.666.2 48.265.3

Data are presented as the mean6S.E.M. for 12 individual pairs across three independent experiments. [ [[

*P,0.05 vs. non-punished saline control, P,0.05, P,0.01 vs. punished vehicle control.

and hippocampus with repeated administration may not be stimulation of the amygdala in humans under local anes-associated with anxiolytic effects of BZs. This may thesia elicits feelings of fear and anxiety [11]. Likewise, support the role of limbic receptors, by exclusion. Perhaps electrical stimulation of the amygdala in several mam-more importantly, the changes currently found occurred malian species elicits an anxiogenic response [16]. Previ-rapidly. The relatively short period in which they occurred ous studies have shown that injections of BZs or the make it unlikely that changes in receptor protein synthesis GABA agonist muscimol directly into the amygdala canA and / or assembly mediate the anxiolytic effects of al- increase punished responding [17,28,30,33]. In addition, prazolam. However, a rapid change in binding could increases in punished responding produced by systemic BZ influence allosteric interactions with the GABA receptor,A administration can be blocked by administering an

antago-2

interacting with Cl flux. nist into this area [30]. Surprisingly, however, greater BZ binding and / or theg2L / S ratio changes may have changes in binding were found in the basolateral and depended upon treatment effects on different forms of medial nuclei than in the central nucleus of the amygdala ‘native’ GABA receptor(s) in specific brain regions. TheA in the current studies. These results suggest that increased sensitivity of the BZ binding sites to different agonists, attention should be placed on the function of the basolater-inverse receptor agonists and antagonists, are thought to be al nucleus of the amygdala in anxiety.

determined by unique configurations of GABAA subunits The current studies leave several unresolved questions. in different regions of the brain [26]. The ability of stress For example, detailed time-course studies may be able to to affect mRNA levels of specific subunits in the current resolve if BZs actually reverse the effects seen in control study may have changed binding profiles for endogenous (punishment) groups, or prevent them. Additional studies ligands as well as drugs. Likewise, even though alprazolam should be directed at whether alterations of a1 mRNA appeared to block punishment-induced changes in subunit subunits are associated (and if so then required) to produce

mRNA levels and [ H]Ro 15-1788 binding, it is not clear the anti-punishment effects of other types of subunit-whether these effects are necessary for an anti-anxiety selective BZs (e.g., BZ1 vs. BZ2). This line of reasoning effect. The possible involvement of a1 subunits in an- could be extended to anxiolytics that do not bind to BZ xiolysis may contrast with the conclusions of two recent sites (e.g., barbiturates). Regardless, the current findings reports [24,32]. They showed that a histidine-to-arginine show that punishment can produce highly specific changes substitution in thea1 subunit (rendering it an a4 subunit in BZ binding and the expression of GABAA receptor and thus, BZ-insensitive) attenuated the sedative, but not subunits. They also show that the anxiolytic effects of the anxiolytic, effects of BZ treatment in these genetically alprazolam are associated with the prevention or reversal altered mice. Studies designed to characterize anxiety- of these changes. Should the later effect be shown to be related changes in subunit composition / expression with necessary in order to obtain anxiolysis, this would suggest and without anxiolytic drugs in normal and / or anxious that the efficacy of an anxiolytic might depend upon the strains may help resolve these differences. In addition, the level of anxiety. Although speculative, this raises the current findings could have obtained through other central possibility that one reason that some CNS drugs have nervous system effects. For example, alprazolam can situationally specific effects is that the environmental stimulatea2 adrenoceptors [10]. Some GABAergic nerve conditions in which they are effective may alter the terminals in the rat brain containa2 receptors which, when substrates upon which they act.

stimulated, might enhance GABA release [31]. Increased release could affect BZ binding via allosteric modifications

of the GABA -BZ receptor complex.A Acknowledgements

The amygdala has long been implicated in the anxiolytic

effects of BZs, and as such was a focus of the current The authors wish to thank Dr Dennis R. Grayson for studies. In humans, lesions of the amygdala have been providing the internal standards, the Upjohn Co. for shown to have a calming effect [29], whereas electrical providing the alprazolam and Dr Nancy Leidenheimer for

(10)

donald, Enhancement of recombinant a1b1g2L g-aminobutyric

comments on this manuscript. These studies were

sup-acid receptor whole-cell currents by protein kinase C is mediatedA

ported by a developmental grant issued by LSUMC-S.

through phosphorylation of both b1 and g2L subunits, Molec. Pharmacol. 50 (1996) 185–195.

[19] A.S. Lippa, C.A. Klepner, L. Yunger, M.C. Sano, W.V. Smith, B. Beer, Relationship between benzodiazepine receptors and

ex-References _{perimental anxiety in rats, Pharmacol. Biochem. Behav. 9 (1978)}

853–856.

[20] M. Liu, J.R. Glowa, Alterations of GABA receptor subunit mRNAA

[1] B. Beer, B. Migler, Effects of diazepam on galvanic skin response

levels in rat brain associated with increases in punished responding and conflict in monkeys and humans, in: A. Sudilvsky, S. Gerson, B.

by acute alprazolam administration: an in situ hybridization study, Beer (Eds.), Predictability in Psychopharmacology, Raven Press,

Brain Res. 882 (1999) 8–16.

New York, 1975, pp. 143–157. ₂₁

[21] T.K. Machu, J.A. Firestone, M.D. Browning, Ca / calmodulin-[2] G. Biggio, A. Concas, M. Serra, M. Salis, M.G. Corda, V. Nurchi, C.

dependent protein kinase II and protein kinase C phosphorylate a Crisponi, G.L. Gessa, Stress and b-carbolines decrease the density

synthetic peptide corresponding to a sequence that is specific for the of low-affinity GABA binding sites: an effect reversed by diazepam,

g2L subunit of the GABAA receptor, J. Neurochem. 61 (1993) Brain Res. 305 (1984) 13–18.

375–377. [3] A.J. Boileau, A.M. Kucken, A.R. Evers, C. Czajkowski, Molecular

[22] R.T. McCabe, R.W. Olsen, J.P. Yezuita, J.K. Wamsley, Osmotic dissection of benzodiazepine binding and allosteric coupling using

shock: a method to eliminate endogenousg-aminobutyric acid and chimeric gamma-aminobutyric acidA receptor subunits, Mol. Phar- _{account for the influence on benzodiazepine binding affinity in} macol. 53 (1998) 295–303.

autoradiographic studies, J. Pharmacol. Exp. Ther. 245 (1988) 342– [4] J. Bormann, The ‘ABC’ of GABA receptors, Trends Pharmacol. Sci. _349.

245 (2000) 16–19. _{[23] R.M. McKernan, P.J. Whiting, Which GABA -receptor subtypes}

[5] S.O. Casalotti, F.A. Stephenson, E.A. Barnard, Separate subunits for _{really occur in the brain?, Trends Neurosci. 19 (1996) 139–143.} agonist and benzodiazepine binding in the gamma-aminobutyric acid _{[24] R.M. McKernan, T.W. Rosahl, D.S. Reynolds, C. Sur, K.A. Wafford,} A receptor oligomer, J. Biol. Chem. 261 (1986) 15013–15016. _{J.R. Atack, S. Farrar, J. Myers, G. Cook, P. Ferris, L. Garrett, L.} [6] G.W. Dawson, S.G. Jue, R.N. Brogden, Alprazolam: a review of its _{Bristow, G. Marshall, A. Macaulay, N. Brown, O. Howell, K.W.} pharmacodynamic properties and efficacy in the treatment of anxiety _{Moore, R.W. Carling, L.J. Street, J.L. Castro, C.I. Ragan, G.R.} and depression, Drugs 27 (1984) 132–147. _{Dawson, P.J. Whiting, Sedative but not anxiolytic properties of} [7] D.E. Draper, Protein-RNA recognition, A. Rev. Biochem. 64 (1995) _{benzodiazepines are mediated by the GABA(A) receptor alpha 1}

593–620. _{subtype, Nat. Neurosci. 3 (2000) 587–592.}

[8] R.C. Drugan, A.S. Basile, J.H. Ha, R.J. Ferland, The protective [25] J.H. Medina, M.L. Novas, C.N. Wolfman, M. Levi de Stein, E. De effects of stress control may be mediated by increased brain levels Robertis, Benzodiazepine receptors in rat cerebral cortex and of benzodiazepine receptor agonists, Brain Res. 661 (1994) 127– hippocampus undergo rapid and reversible changes after acute

136. stress, Neuroscience 9 (1983) 331–335.

[9] R.C. Drugan, A.L. Morrow, R. Weizman, A. Weizman, S.I. Deutsch, [26] A.K. Mehta, M.K. Ticku, An update on GABAA receptors, Brain J.N. Crawley, S.M. Paul, Stress-induced behavioral depression in the Res. Rev. 29 (1999) 196–217.

rat is associated with a decrease in GABA receptor-mediated [27] A.L. Morrow, Regulation of GABAA receptor function and gene chloride ion flux and brain benzodiazepine receptor occupancy, expression in the central nervous system, in: R.J. Bradley, R.A. Brain Res. 487 (1989) 45–51. Harris (Eds.), International Review of Neurobiology, Academic [10] E. Eriksson, M. Carlsson, C. Nilsso, B. Soderpalm, Does al- Press, New York, 1995, pp. 1–41.

prazolam, in contrast to diazepam, activate alpha-2 adrenoceptors [28] J. Nagy, K. Zambo, L. Desci, Anti-anxiety action of diazepam after involved in the regulation of rat growth hormone secretion?, Life intra-amygdaloid application in the rat, Neuropharmacology 18

Sci. 38 (1986) 1491–1498. (1979) 573–576.

[11] W. Feindel, W. Penfield, Localization of discharge in temporal lobe [29] H. Narabayashi, T. Nagao, Y. Saito, M. Yoshida, M. Nagahata, automatism, Arch. Neurol. Psych. 72 (1954) 605–630. Stereotaxic amygdalotomy for behavior disorders, Arch. Neurol. 9 [12] D.R. Grayson, P. Bovolin, M.R. Santi, Absolute quantification of (1963) 1–16.

g-aminobutyric acid A receptor subunit mRNAs by competitive [30] E.N. Petersen, C. Braestrup, J. Scheel-Kruger, Evidence that the¨ polymerase chain reaction, Meth. Neurosci. 12 (1993) 191–208. anticonflict effect of midazolam in amygdala is mediated by the [13] F. Impagnatiello, C. Pesold, P. Longone, H. Caruncho, J.M. specific benzodiazepine receptors, Neurosci. Lett. 53 (1985) 285–

Fritschy, E. Costa, A. Guidotti, Modifications of gamma-amino- 288.

butyric acid A receptor subunit expression in rat neocortex during [31] A. Pittaluga, M. Raiteri, GABAergic nerve terminals in rat hip-tolerance to diazepam, Molec. Pharmacol. 49 (1996) 822–831. pocampus possess a2 adrenoceptors regulating GABA release, [14] S. Izenwasser, M.J. Blake, N.E. Goeders, S.I. Dworkin, Punishment Neurosci. Lett. 76 (1987) 363–367.

modifies the effects of chlordiazepoxide and benzodiazepine re- [32] U. Rudolph, F. Crestani, D. Benke, I. Brunig, J.A. Benson, J.M. ceptors, Pharmacol. Biochem. Behav. 32 (1989) 743–748. Fritschy, J.R. Martin, H. Bluethmann, H. Mohler, Benzodiazepine

¨ ¨

[15] A. Kanopka, O. Muhlemann, G. Akuslarvi, Inhibition by SR actions mediated by specific gamma-aminobutyric acid(A) receptor proteins of splicing of a regulated adenovirus pre-mRNA, Nature subtypes, Nature 401 (1999) 796–800.

381 (1996) 535–538. [33] S.K. Sanders, A. Shekhar, Blockade of GABAA receptors in the [16] B.S. Kapp, M. Gallagher, M.D. Underwood, C.L. McNall, D. region of the anterior basolateral amygdala of rats elicits increase in

Whitehorn, Cardiovascular responses elicited by electrical stimula- heart rate and blood pressure, Brain Res. 576 (1991) 101–110. tion of the amygdala central nucleus in the rabbit, Brain Res. 234 [34] S. Shibata, K. Yamashita, E. Yamamoto, T. Ozaki, S. Ueki, Effects (1982) 251–262. of benzodiazepine and GABA antagonists on anti-conflict effects of antianxiety drugs in injected into the rat amygdala in a water-lick [17] Y. Kataoka, K. Shibata, K. Yamashita, S. Ueki, Differential

mecha-suppression test, Psychopharmacology 98 (1989) 38–44. nisms involved in the anticonflict action of benzodiazepines injected

[35] S.L. Swope, S.J. Moss, C.D. Blackstone, R.L. Huganir, Phosphoryl-into the central amygdala and mammillary body, Brain Res. 416

ation of ligand-gated ion channels: a possible mode of synaptic (1987) 243–247.

plasticity, FASEB J. 6 (1992) 2514–2523. [18] Y.F. Lin, T.P. Angelotti, E.K. Dudek, M.D. Browning, R.L.

(11)

Mac-[36] J.R. Vogel, B. Beer, D. Clody, A simple and reliable conflict a protein kinase C phosphorylation site, Proc. Natl. Acad. Sci. USA procedure for testing anti-anxiety agents, Psychopharmacology 21 87 (1990) 9966–9970.

(1971) 1–7. [39] W.S. Young, D.L. Niehoff, M.J. Kuhar, B. Beer, A.S. Lippa, [37] R. Weizman, A. Weizman, K.A. Kook, F. Vocci, S.I. Deutsch, S.M. Multiple benzodiazepine receptor localization by light microscopic Paul, Repeated swim stress alters brain benzodiazepine receptors radiohistochemistry, J. Pharmacol. Exp. Ther. 216 (1981) 425–430. measures in vivo, J. Pharmacol. Exp. Ther. 340 (1990) 701–707. [40] L. Zhang, T. Tatham, W. Ma, A.N. Feldman, J.L. Barker, D.R. [38] P. Whiting, R.M. McKernan, L.L. Iversen, Another mechanism for Rubinow, GABA Receptor subunit mRNA expression in brain of creating diversity ing-aminobutyric acid A receptors: RNA splicing conflict, yoked control and control rats, Mol. Brain Res. 58 (1998) directs expression of two forms ofg2 subunit, one of which contains 16–26.

(1)

thalamic nucleus (MD), and ventrolateral thalamic nucleus (V), exhibited decreased levels of [ H]Ro 15-1788 binding during punishment compared to 3

Alprazolam had no effect on [ H]Ro 15-1788 binding

punishment, punishment plus vehicle and punishment plus

under the non-punished condition.

alprazolam. Punishment significantly decreased [ H]Ro

15-3

Table 2 also shows the changes in [ H]Ro 15-1788

1788 binding in the basolateral amygdaloid nucleus (12%)

binding in the same brain regions of rats exposed to

and the mediodorsal thalamic nucleus (15%), compared to

Table 2

3 a

Changes in [ H]Ro 15-1788 binding in brain regions of rats as a function of treatment condition

Brain region Non-punished responding Punished responding

Saline Vehicle Alprazolam Saline Vehicle Alprazolam

Cerebral cortex 260.368.5 263.667.6 259.266.4 247.466.9 248.268.3 258.966.6

Hippocampus

CA1 222.063.4 219.864.4 224.964.3 218.765.2 220.167.1 225.065.9

CA2 170.465.2 165.565.4 168.266.3 171.465.6 169.967.8 175.064.0

CA3 187.865.4 191.766.2 187.065.4 179.966.3 183.368.7 187.664.7

Dentate gyrus 233.265.7 228.967.4 225.965.8 223.068.2 224.168.0 235.065.9

Caudate–putamen 83.063.1 81.664.6 79.564.2 80.862.7 83.763.3 78.862.8

Amygdala

Central amygdaloid nucleus 144.966.2 142.064.7 146.665.4 137.266.0 141.066.3 153.765.5

[

Basolateral amygdaloid nucleus 240.968.0 236.464.8 234.766.6 206.65.8* 212.268.6* 231.667.0 Medial amygdaloid nucleus 207.268.1 209.765.7 206.965.7 188.466.6 191.667.3 212.865.1

Thalamic nucleus

Centromedial thalamic nucleus 183.8610.0 178.669.5 176.6610.1 181.1611.1 173.569.3 180.6610.2

[

Mediodorsal thalamic nucleus 171.667.3 168.765.6 169.566.1 142.666.0* 146.065.1 165.167.2 Ventrolateral thalamic nucleus 150.067.3 152.967.4 147.566.2 124.666.0* 128.766.9 140.565.3 Ventroprosterior thala nucleus 118.266.4 122.665.3 116.165.3 107.365.8 113.265.4 111.764.0 Laterodorsal thalamic nucleus 77.162.3 73.463.2 79.463.7 73.862.0 78.962.8 74.862.7

Hypothalamic nucleus

Medial mammillary nucleus 131.167.8 124.667.8 126.066.8 129.667.7 128.867.8 122.867.0

Ventral tegmental area 113.163.0 116.963.8 110.564.3 114.364.5 108.864.2 109.964.6

Substantia nigra 107.568.0 111.165.8 106.964.1 105.866.8 102.565.5 99.065.2 a 3

[ H]Ro 15-1788 binding was measured using quantitative autoradiography as described in the text. Values are the mean (6S.E.M.) fmol / mg, specific 3

(2)

(average of saline / saline and vehicle / vehicle) controls. In

ratio of

g

2L mRNA to

g

2S mRNA for alprazolam plus

contrast to its effects on non-punished responding, al-

punishment did not statistically differ from that of any

prazolam significantly increased [ H]Ro 15-1788 binding

non-punished responding condition.

above vehicle and control levels in all regions in which

punishment had decreased it (basolateral amygdaloid

nu-cleus, F

5, 138

5 4.808, P

5 0.014; mediodorsal thalamic nu-

4. Discussion

cleus, F

5,138

5 4.829, P

5 0.009). The result was that [ H]Ro

15-1788 binding during punishment with alprazolam was

The current study found that punishment down-regulated

no different than non-punished responding, similar to the

BZ binding sites in the basolateral nucleus of the amygdala

behavioral results.

and the mediodorsal thalamic nucleus. These results are

similar to those of previous studies, which found that acute

3.3. Quantitative RT–PCR determination

exposure to stress [25] or repeated exposure to punishment

[14] decreased BZ binding in limbic brain. The current

Competitive RT–PCR was effective in resolving signifi-

study also found a parallel decrease in the expression of

a

1 cant differences in the absolute amounts of GABA

GABA

receptor mRNA transcripts in the basolateral

receptor subunit mRNA in the basolateral nucleus of the

nucleus of the amygdala with punishment. These effects

amygdala (BLA) as a function of exposure to punishment

may be related, as a specific change in subunit composition

and alprazolam plus punishment. Fig. 3 illustrates repre-

of a GABA receptor would be expected to affect binding.

sentative gels and linear regression curves for control

Both effects were either prevented or reversed by treatment

amounts of individual GABA receptor subunit transcripts

with alprazolam, while alprazolam alone had no effect.

in the BLA. The point of equality (arrow) represents the

These results are consistent with those of recent in situ

absolute amount of mRNA (pg /

m

g total RNA) for each

hybridization studies. One study showed that punishment

subunit. In control BLA (Table 3), the most abundant

specifically decreased expression of

a

1 subunits compared

GABA receptor subunit was

a

1, with progressively lesser

to yoked (shocked), and non-shocked control animals [40].

amounts of

b

2,

g

2S and

g

2L, respectively. The same

Another [19] replicated the down-regulation of

a

1 GABA

method was used to determine amounts of subunit mRNA

receptor subunits with punishment and showed that

al-transcript in each of the treatment groups. Compared to

prazolam could prevent that effect. Together these studies

either saline- or vehicle-treated animals, alprazolam had no

confirm that punishment down-regulates the

a

1 GABA

effect on the amount of GABA

receptor subunit expres-

receptor subunit in the amygdala and that alprazolam

sion. Punishment significantly decreased the expression of

counter-regulates this change. Less clear is whether these

a

1 mRNA in both control groups compared to the same

effects mediate the anxiolytic effect of BZ’s.

control group for non-punished responding, to about 37%

Punishment also increased, and alprazolam decreased,

of control levels. Alprazolam significantly increased the

the ratio of

g

2L / S mRNA, in the basolateral nucleus of the

expression of

a

1 mRNA compared to vehicle or saline

amygdala. A recent study identified two regions on the

g

2 when responding was punished. As alprazolam plus pun-

subunit that appear to distinguish BZ binding from

allo-ishment produced absolute amounts of

a

1 mRNA that did

steric coupling of BZ and GABA binding sites [3].

not statistically differ from those in any of the non-

Decreases in the

g

2L / S ratio could alter the

phosphoryla-punished conditions (saline, vehicle or alprazolam), it

tion state of the GABA receptor, conformational stability,

appeared as if alprazolam reversed the decrease in

a

1 or trafficking of the

g

2 subunit to cell membranes [18,35].

mRNA produced by punishment.

This, in turn, may result in a decrease in the ability of

Punishment decreased level of

g

2S transcript to 83–85%

GABA or other agonists to enhance GABA

receptor-of control levels and increased level receptor-of

g

2L transcript to

mediated chloride flux. Alterations in the

g

2L / S ratio may

116–125% of control levels, but neither effect alone

also affect regulation of the spliceosome. These protein /

obtained statistical significance. Each of these effects was

RNA / ribo-nucleoprotein particle complexes are involved

reversed by pretreatment with alprazolam. Neither punish-

in the splicing of precursor mRNA to mature mRNA [7].

ment nor alprazolam significantly altered the expression of

They most likely play a role in regulation of the inclusion

b

2 subunit transcripts.

or exclusion of exons, like the exon found in the

g

2L

In order to assess whether changes in expression of

g

2S

mRNA [15]. However, the effects of alprazolam on

and

g

2L transcripts might be due to altered alternative

spliceosome regulation have not been studied.

splicing of

g

2 transcripts, the relative abundance of

g

2S

GABA

receptor function is also influenced by

post-and

g

2L mRNAs was directly compared across the differ-

translational receptor modifications, including

phosphoryl-ent treatmphosphoryl-ent groups. While alprazolam had no effect on

ation [27]. For example, a number of protein kinases,

the ratio of

g

2L mRNA to

g

2S mRNA for non-punished

including PKA and PKC, influence GABA

receptor-me-responding, punishment alone non-significantly increased

diated chloride uptake. Most GABA

receptor subunits

this ratio and alprazolam significantly decreased this ratio,

contain phosphorylation sites, some of which may exist

when compared to the punishment control conditions. The

endogenously in a phosphorylated state [37]. Although the

(3)

time-course for the effects presently found was rapid, the

Tolerance can develop to many of the behavioral effects

present study does not rule out alterations in post-transla-

of BZs, resulting in changes in CNS substrates different

tional processing as a mechanism for down-regulating

than those presently described. In particular, tolerance to

GABA

receptors after punishment and up-regulating

the anticonvulsant effects of diazepam has been associated

GABA receptors after acute alprazolam treatment. Altera-

with decreased

a

1 message in the frontoparietal motor

tions in phosphorylation states of particular subunits, as

cortex and hippocampus [13]. In contrast, tolerance does

well as subunit assembly, may be important mechanisms

not occur to the anti-punishment effects of BZs or to their

underlying the influence of punishment and alprazolam.

clinic effects on anxiety. As such, these changes in cortex

(4)

Table 3

a Quantification of mRNA levels for GABA receptor subunits in rat basolateral amygdaloid nucleusA

Subunit Non-punished responding Punished responding

Saline Vehicle Alprazolam Saline Vehicle Alprazolam

[[

a1 63.067.0 62.266.5 62.864.7 23.363.8* 23.263.4* 65.065.4

b2 45.266.0 46.867.0 43.766.9 48.364.3 48.565.2 46.165.3

g2S 21.362.3 21.262.0 21.062.3 17.761.7 18.062.0 24.461.3

g2L 12.861.3 12.261.3 12.161.5 14.961.1 15.261.2 11.760.9

[

g2L /g2S 60.865.9 58.466.8 59.169.9 85.566.4 85.666.2 48.265.3

Data are presented as the mean6S.E.M. for 12 individual pairs across three independent experiments.

[ [[

*P,0.05 vs. non-punished saline control, P,0.05, P,0.01 vs. punished vehicle control.

and hippocampus with repeated administration may not be

stimulation of the amygdala in humans under local

anes-associated with anxiolytic effects of BZs. This may

thesia elicits feelings of fear and anxiety [11]. Likewise,

support the role of limbic receptors, by exclusion. Perhaps

electrical stimulation of the amygdala in several

mam-more importantly, the changes currently found occurred

malian species elicits an anxiogenic response [16].

Previ-rapidly. The relatively short period in which they occurred

ous studies have shown that injections of BZs or the

make it unlikely that changes in receptor protein synthesis

GABA agonist muscimol directly into the amygdala can

and / or assembly mediate the anxiolytic effects of al-

increase punished responding [17,28,30,33]. In addition,

prazolam. However, a rapid change in binding could

increases in punished responding produced by systemic BZ

influence allosteric interactions with the GABA receptor,

administration can be blocked by administering an

antago-2

interacting with Cl

flux.

nist into this area [30]. Surprisingly, however, greater

BZ binding and / or the

g

2L / S ratio changes may have

changes in binding were found in the basolateral and

depended upon treatment effects on different forms of

medial nuclei than in the central nucleus of the amygdala

‘native’ GABA receptor(s) in specific brain regions. The

in the current studies. These results suggest that increased

sensitivity of the BZ binding sites to different agonists,

attention should be placed on the function of the

basolater-inverse receptor agonists and antagonists, are thought to be

al nucleus of the amygdala in anxiety.

determined by unique configurations of GABA

subunits

The current studies leave several unresolved questions.

in different regions of the brain [26]. The ability of stress

For example, detailed time-course studies may be able to

to affect mRNA levels of specific subunits in the current

resolve if BZs actually reverse the effects seen in control

study may have changed binding profiles for endogenous

(punishment) groups, or prevent them. Additional studies

ligands as well as drugs. Likewise, even though alprazolam

should be directed at whether alterations of

a

1 mRNA

appeared to block punishment-induced changes in subunit

subunits are associated (and if so then required) to produce

mRNA levels and [ H]Ro 15-1788 binding, it is not clear

the anti-punishment effects of other types of

subunit-whether these effects are necessary for an anti-anxiety

selective BZs (e.g., BZ1 vs. BZ2). This line of reasoning

effect. The possible involvement of

a

1 subunits in an-

could be extended to anxiolytics that do not bind to BZ

xiolysis may contrast with the conclusions of two recent

sites (e.g., barbiturates). Regardless, the current findings

reports [24,32]. They showed that a histidine-to-arginine

show that punishment can produce highly specific changes

substitution in the

a

1 subunit (rendering it an

a

4 subunit

in BZ binding and the expression of GABA

receptor

and thus, BZ-insensitive) attenuated the sedative, but not

subunits. They also show that the anxiolytic effects of

the anxiolytic, effects of BZ treatment in these genetically

alprazolam are associated with the prevention or reversal

altered mice. Studies designed to characterize anxiety-

of these changes. Should the later effect be shown to be

related changes in subunit composition / expression with

necessary in order to obtain anxiolysis, this would suggest

and without anxiolytic drugs in normal and / or anxious

that the efficacy of an anxiolytic might depend upon the

strains may help resolve these differences. In addition, the

level of anxiety. Although speculative, this raises the

current findings could have obtained through other central

possibility that one reason that some CNS drugs have

nervous system effects. For example, alprazolam can

situationally specific effects is that the environmental

stimulate

a

2 adrenoceptors [10]. Some GABAergic nerve

conditions in which they are effective may alter the

terminals in the rat brain contain

a

2 receptors which, when

substrates upon which they act.

stimulated, might enhance GABA release [31]. Increased

release could affect BZ binding via allosteric modifications

of the GABA -BZ receptor complex.

Acknowledgements

The amygdala has long been implicated in the anxiolytic

effects of BZs, and as such was a focus of the current

The authors wish to thank Dr Dennis R. Grayson for

studies. In humans, lesions of the amygdala have been

providing the internal standards, the Upjohn Co. for

shown to have a calming effect [29], whereas electrical

providing the alprazolam and Dr Nancy Leidenheimer for

(5)

donald, Enhancement of recombinant a1b1g2L g-aminobutyric

comments on this manuscript. These studies were

sup-acid receptor whole-cell currents by protein kinase C is mediatedA

ported by a developmental grant issued by LSUMC-S.

through phosphorylation of both b1 and g2L subunits, Molec. Pharmacol. 50 (1996) 185–195.

[19] A.S. Lippa, C.A. Klepner, L. Yunger, M.C. Sano, W.V. Smith, B. Beer, Relationship between benzodiazepine receptors and

ex-References

_{perimental anxiety in rats, Pharmacol. Biochem. Behav. 9 (1978)}

853–856.

[20] M. Liu, J.R. Glowa, Alterations of GABA receptor subunit mRNAA [1] B. Beer, B. Migler, Effects of diazepam on galvanic skin response