Directory UMM :Data Elmu:jurnal:I:Insect Biochemistry and Molecular Biology:Vol30.Issue11.Nov2000:

(1)

www.elsevier.com/locate/ibmb

Binding of Bacillus thuringiensis

d-endotoxins Cry1Ac and

Cry1Ba to a 120-kDa aminopeptidase-N of Epiphyas postvittana

purified from both brush border membrane vesicles and

baculovirus-infected Sf9 cells

R.M. Simpson

_{, R.D. Newcomb}

Horticulture and Food Research Institute of New Zealand Limited, Private Bag 92-169, Auckland, New Zealand

Received 10 November 1998; received in revised form 15 March 2000; accepted 27 March 2000

Abstract

A 120-kDa protein was purified from brush border membrane vesicles of the tortricid moth Epiphyas postvittana (Walker) based both on its activity as an aminopeptidase and the ability to bind the Bacillus thuringiensisd-endotoxin Cry1Ac. The purified enzyme had a pI of 5.6 and was a leucine aminopeptidase, with some isoleucine, phenylalanine and tryptophan aminopeptidase activity. Further characterisation showed that the protein was also able to bind Cry1Ba. During purification, the molecular weight of the protein decreased from 120 to 115 kDa due to the loss of a glycophosphatidinyl anchor. The protein was N-terminally sequenced and, using this information and conserved regions within other insect aminopeptidase-N (APN) sequences, redundant primers were designed to amplify the aminopeptidase coding sequence from E. postvittana midgut cDNA. The predicted protein sequence from the full-length cDNA was most closely related to the APN protein sequence from Heliothis virescens (61% identity) and shared other features of insect APNs including a Zn2+_{binding site motif and four conserved cysteines. The E. postvittana was expressed}

in Sf9 cells using baculovirus, yielding a protein of molecular weight 130 kDa, but with unchanged N-terminal sequence. Purified recombinant protein bound both Cry1Ac and Cry1Ba by ligand blot assays. However, despite the protein being expressed on the external surface of the Sf9 cells, it bound neither Cry1Ac nor Cry1Ba in vivo. 2000 Elsevier Science Ltd. All rights reserved.

Keywords: Aminopeptidase-N; Bacillus thuringiensis; Cry1Ac binding protein; Cry1Ba Cry1Ac binding protein; Baculovirus-induced protein

expression; Epiphyas postvittana (Walker)

1. Introduction

During sporulation, the Gram-positive bacteria,

Bacil-lus thuringiensis forms crystalline protein incBacil-lusions,

which possess insecticidal activity. The mode of action of these inclusion proteins ord-endotoxins has been par-tially elucidated (Gill, 1995). The crystals are solubilised within the alkaline midgut of certain insects and cleaved by proteases to release an active toxin. This activated toxin then binds to specific high-affinity receptors on the surface of the midgut epithelia. After binding, the toxin is thought to undergo a conformational change leading to formation of ion pores within the membrane of epithelial

* Corresponding author. Fax:+64-6-354-6731.

E-mail address: [email protected] (R.M. Simpson).

cells, eventually causing the death of the insect (Knowles and Dow, 1993).

Proteins which bind to one or more of the d -endo-toxins Cry1Aa, Cry1Ab, Cry1Ac and Cry1C have been purified and characterised from the midguts of Manduca

sexta (Knight et al., 1994; Valdamudi et al., 1995;

Denolf et al., 1997), Heliothis virescens (Gill et al., 1995, Luo et al., 1997a), Lymantria dispar (Valaitis et al., 1995), Plutella xylostella (Denolf et al., 1997; Luo et al., 1997b) and Bombyx mori (Yaio et al., 1997). In all but one case, these proteins were found to be members of the aminopeptidase-N (APN) family (EC 3.4.11.2), the exception being a cadherin-like protein which bound Cry1Aa in M. sexta (Valdamudi et al., 1995; Francis and Bulla, 1997; Keeton and Bulla, 1997). APN is a 120- or 170-kDa glycoprotein, with a glycosylphosphatidylinos-itol (GPI) anchor. It has been shown that incorporating

(2)

a mixture of APN and an alkaline phosphatase into phos-pholipid vesicles enhances Cry1Ac-mediated efflux of

86_Rb+_{up to 1000-fold (Sangadala et al., 1994). In} Trich-oplusia ni brush border membrane vesicles (BBMVs),

Cry1Ac pore-forming activity is dependent on the amount of APN activity present on the surface of the BBMV (Lorence et al., 1997). A 170-kDa APN from H.

virescens has been shown by surface plasmon resonance

to bind Cry1Aa, Cry1Ab and Cry1Ac, and when the pro-tein was reconstituted in phospholipid vesicles, Cry-toxin-mediated86_Rb+_{efflux was related to toxicity of the}

endotoxin (Luo et al., 1997a).

There remains some debate over the role of APN as the key binding site for endotoxin activity (Francis and Bulla, 1997). It is a highly abundant protein, yet com-petitive binding assays suggest that a much lower amount of the binding proteins is present (van Rie et al., 1989; Garczynski et al., 1991). There are also inconsist-encies between competitive binding assays and ligand blotting experiments, the latter being used to assay bind-ing protein purification (Lee and Dean, 1996). The cadherin-like receptor from M. sexta has also been expressed in Sf9 cells, and the expressed protein has the same ligand blotting and competitive binding assay characteristics as the native protein, not only for Cry1Ab, but also for Cry1Aa and Cry1Ac (Francis and Bulla, 1997; Keeton and Bulla, 1997). This has not yet been shown for APN.

The tortricid moth Epiphyas postvittana (Walker) is a polyphagous pest mainly affecting horticultural pro-duction and export from Australia and New Zealand (Wearing et al., 1991). Cry1Ac is an effective toxin against E. postvittana, while Cry1Ba has moderate insec-ticidal activity (Gleave et al., 1992; Simpson et al., 1997). Competitive binding studies have shown that each of these toxins interact via two binding sites in the midgut (Simpson et al., 1997). Here we report the characterisation of Cry1Ac-binding proteins of E.

post-vittana and the purification of one of them, revealing it

to be an APN. Furthermore, we describe the isolation of the gene encoding this APN and characterise the pro-tein’s d-endotoxin binding capacity, comparing endogenous and baculovirus-expressed APN.

2. Materials and methods

2.1. Insects

Epiphyas postvittana were collected from Nelson,

New Zealand, in 1975 and maintained in the Insect Rear-ing Facility, Mt Albert Research Centre, usRear-ing con-ditions described previously (Singh, 1974; Clare et al., 1987). The midguts of fifth instar larvae were dissected into liquid nitrogen and stored at 280°C.

2.2. Assays

Cry1Ac and Cry1Ba were prepared as described in Simpson et al. (1997). The ligand blot assay used to detect endotoxin binding was based on a western transfer protocol as described by Sanchis and Ellar (1993), modi-fied to include alkaline phosphatase-linked secondary antibody, and colour development by NBT/BCIP (Gibco BRL). Alkaline phosphatase (AP) and leucine amino-peptidase (LAP) assays were performed as described by Christeller et al. (1989). Aminopeptidase activity using various amino acid amide substrates was determined using the method described by Himmelhoch (1970).

Radiolabelled Cry1Ac and Cry1Ba were prepared as described by Simpson et al. (1997). Competitive binding assays were performed as described by van Rie et al. (1989), except that Sf9 cells were used instead of using BBMVs. The optimal number of Sf9 cells for competi-tive binding assays was determined by a set of initial experiments varying the number of control Sf9 cells. These were infected with baculovirus-containing pnlb, an external membrane-bound pectin lyase.

2.3. Protein purification

Brush border membrane vesicles (BBMVs) were pre-pared by the method of Wolfersberger et al. (1987). Approximately 1 ml of BBMV suspension was centri-fuged in a bench-top centrifuge at 14,000g for 5 min, then resuspended in 200 µl of 1% w/v octylglucoside (OG) in 0.9% sodium chloride in 9.8 mM sodium phos-phate buffer, pH 7.4 (PBS) and briefly vortexed. This was incubated at 4°C overnight, then centrifuged again. The supernatant was diluted to 1.2 ml using PBS, left at 4°C for 2 h, then recentrifuged to remove any precipi-tate, and applied to a gel filtration column (Superose-12 HR10/30; Pharmacia, Uppsala, Sweden; 300 mm long, 10 mm i.d.), using 20 mM Tris–Hcl, 100 mM sodium chloride, 0.15% w/v OG, pH 7.4. Fractions (200µl) con-taining a single Cry1Ac-binding protein were combined and separated by anion exchange chromatography (Mono Q HR5/5; Pharmacia; 50 mm long, 5 mm i.d.), equilibrated with 20 mM Tris–HCl, 100 mM NaCl, 0.15% OG, pH 7.4, and eluted with a gradient of 0.1 to 1 M NaCl in 20 mM Tris–HCl, 0.15% OG, pH 7.4 in 30 ml.

Sf9 cells expressing recombinant E. postvittana APN, prepared as described below, were briefly centrifuged, and an equal volume of PBS was added. The cells were resuspended and 10% w/v OG added to give a final detergent concentration of 0.8%. This was left at 4°C overnight, and then recentrifuged. The supernatant was diluted to give a final OG concentration of 0.15% using PBS, left at 4°C for 2 h, then centrifuged to remove any precipitate. The remainder of the purification scheme for recombinant APN was as that used for the APN from BBMVs.

(3)

2.4. PCR template preparation

Total RNA was prepared from midguts using a modi-fied protocol of Chirgwin et al. (1979). Approximately 200 E. postvittana midguts were thoroughly homogen-ised in liquid nitrogen using a mortar and pestle. The resulting powder was resuspended in 15 ml of 4 M guan-idinium thiocyanate, 25 mM sodium citrate pH 7.0, 0.5% sarkosyl and 0.1 M b-mercaptoethanol (solution D) and 6 ml layered over 5 ml of 4.8 M CsCl, 10 mM EDTA, pH 8. The RNA was separated by centrifugation at 150,000g for 16 h at 15°C. The RNA pellet was resus-pended in 400 µl of diethylpyrocarbonate (DEPC)-treated dH2O. It was then precipitated by the addition of

800 µl of ethanol and 10 µl of 4 M sodium chloride and stored under ethanol at₂20°C. The RNA pellet was washed in 75% ethanol and air dried before resuspension in DEPC-treated dH2O. PolyA+ RNA was prepared by

affinity chromatography on oligo-dT cellulose (Sambrook et al., 1989) using a QuickPrep Micro mRNA purification kit (Pharmacia). cDNA was made from 10 of the 400µl of polyA+mRNA using reverse transcriptase (Superscript II, BRL) as per the manufacturer’s instruc-tions in a 20 µl reaction volume using RoRidT16(Ma et

al., 1994) as a primer.

2.5. PCR and sequencing

cDNA encoding the 120-kDa Cry1Ac-binding protein was amplified from midgut cDNA using Boehringer Mannheim Taq DNA polymerase following the manu-facturer’s instructions. Fifty-µl amplification reactions included 2.5 U Taq DNA polymerase, 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl, 0.2 mM dNTPs

and 100 pmol of each primer. All amplification reactions were conducted in a Progene Thermal Cycler and included single primer and negative controls. Redundant PCR primers were designed from the N-terminal amino acid sequence (APNf1) and conserved regions of other insect aminopeptidases (APNr1, APNr2) to amplify a central region of the Cry1Ac-binding protein gene. The sequences of all primers used in this study are given in Table 1. Amplification using 2/20 µl of E. postvittana midgut CDNA included a “hot start” of 94°C 3 min after which the Taq DNA polymerase was added followed by 30 cycles of 94°C 1 min, 50°C 1 min, 72°C 2 min. The 3₉end of the gene was amplified using a nested approach with primers designed from sequence of the APNf1– APNr2 fragment (APNf2, APNf3) and primers (Ro, Ri;

Ma et al., 1994) that bound within the cDNA synthesis primer region (RoRidT16). Conditions for the PCR from

midgut cDNA (2/20µl) using the Roand APNf2 primers

included a hot start of 94°C 3 min followed by 35 cycles of 94°C 1 min, 58°C 1 min, 72°C 3 min. Twoµl of this reaction was used in the second round of PCR which included a hot start of 94°C 3 min followed by 35 cycles

of 94°C 1 min, 65°C 30 s, 72°C 1 min. The major pro-duct (1.4 kb) was gel purified using Qiagen’s QIAquick Gel Extraction Kit and cloned into a t-tailed pBluescript SK2 _{plasmid vector (Stratagene, Marchuk et al., 1991)} using standard techniques (Sambrook et al., 1989). A Rapid Amplification of cDNA Ends (RACE) procedure was employed to amplify the 59end of the coding region using a modified version of Clonetech’s CapFinder PCR cDNA Library Construction Kit. cDNA was syn-thesised as above using the primer APNr3 in the pres-ence of 10 pmol of a primer that binds to the cap region of mRNA (CAP). PCR using primers CAPCR and APNr4 (Table 1) was then used to amplify the 5₉region of the APN gene. Conditions included a hot start of 94°C 2 min followed by 35 cycles of 94°C 10 s, 60°C 30 s, 72°C 1 min. The resulting PCR products were isolated and cloned as above.

Primers designed to the extreme 5₉and 3₉ends of the APN coding region (EpAPN5₉and EpAPN3₉) were used to amplify the entire coding region of the E. postvittana APN gene from 2 µl of the midgut cDNA preparation using High Fidelity Taq DNA polymerase (Boehringer Mannheim) according to the manufacturer’s instructions. This was cloned into pBSK2 _{as described above. Four} clones (pEpAPN1–4) were characterised on the basis of restriction enzyme cleavage sites. EpAPN1–2 contains a single internal BamHI site while pEpAPN3–4 contains two BamHI sites.

PCR products and cloned fragments (e.g. EpAPN1) were sequenced using dye-terminator chemistry and reactions run on an ABI 377 automatic sequencer according to the manufacturer’s instructions (Applied BioSystems). Sequencing primers included those men-tioned above as well as APNf2, APNf4, APNf5, APNf6, APNr5, APNr6, APNr7 and APNr8, see Table 1. Sequence data were analysed using the GCG package, version 6 (Devereux et al., 1984) and Sequencher, ver-sion 3.0, 1995 (Gene codes Corporation, Inc.).

2.6. Baculovirus expression

The entire APN coding region of PEpAPN1 was sub-cloned into the SalI/XbaI sites of pFastbac of the Bac-to-Bac system (Life Technologies). A region containing the APN coding region downstream of the baculovirus polyhedrin promotor within pFastBac was transposed into the baculovirus genome and used to transfect Sf9 cells maintained in Sf900 II media (Life Technologies) according to the manufacturer’s instructions. Protein was expressed in 75-cm2_{static culture vessels containing 15}

ml of SF900 II media seeded with 2 million cells and infected with 2 million pfu of virus. Cultures containing baculovirus expressing pnlb (a fungal pectin lyase) and no virus (cells only) were also raised as controls. Cells were harvested 3–4 days after infection and collected by low-speed centrifugation at 500g for 5 min.

(4)

Recombi-Table 1

Listing of primers used in amplification, cDNA synthesis and RACE reactions

Primer Primer sequence (59to 39) 59Position

APNf1 AAYGTIGAYCCIGCIYTITAYMGNYTMCC 157

APNr1 CKRTAIGTIARIARCCCCARTTYTCCAT 1046

APNf2 ACGCCTATAATGTCAACGTACCTCTT 757

APNr2 TYRTCRTARTTNACNCKRTARAANCC 1880

APNf3 ATTGAGGTCGCCAACACTAAGCC 1747

APNr3 CTGGAACTGAGTAGTGGCCATCCA 585

APNf4 AGCTAGCTCCAATCATGT 2231

APNr4 CCCCCCAAAGAACGTCGTAGT 226

APNf5 CTTCCCATCAACCTCTTCGAA 1489

APNr5 AGGTGAAGACATCAGCAGTA 2392

APNf6 AGGTTAACGCTTATCTCCAAT 2696

APNr6 CAGGACGGCAGCGTTGCTGTT 2742

APNr7 CAGCAGTCCCCAGTTTTCCAT 1038

APNr8 GTAGTTAACTCTGTAGTAAC 1875

CAP TACGGCTGCGAGAAGACGACAGAAGGG

CAPCR TACGGCTGCGAGAAGACGACAGAA

Ro ATCGATGGTCGACGCATGCGGATCC

Ri GGATCCAAAGCTTGAATTCGAGCTC

RoRidT16 ATCGATGGTCGACGCATGCGGATCCAAAGCTTGAATTCGAGCTCT16

nant E. postvittana APN protein purification is described in the protein purification section.

3. Results

3.1. Binding protein purification

The d-endotoxin ligand blot assay revealed three major Cry1Ac binding proteins in E. postvittana BBMVs of molecular weights 120, 180 and 200 kDa (Fig. 1b, Lane 1); binding of Cry1Ac was not altered in the

pres-Fig. 1. Silver stained 7.5% SDS–polyacrylamide gel (a), ligand blot (b) and IEF (c) analysis of purification of APN. In both gels Lane 1 is BBMV proteins, Lane 2 solubilised BBMV proteins, Lane 3 after gel filtration and Lane 4 after anion exchange chromatography. The ligand blot was probed with Cry1Ac. For the IEF gel, a pH 3–10 Bio-Rad ReadyGel was used, and only the fully purified protein was focused.

ence of 200 mM N-acetylgalactosamine (data not shown). All three major Cry1Ac-binding proteins were also able to bind Cry1Ba. The binding proteins were solubilised using 1% OG (Fig. 1a, Lane 2), although on solubilisation the molecular weight of the 120-kDa bind-ing protein decreased to 115 kDa. Purification of the 115-kDa protein by gel filtration followed by ion exchange chromatography yielded a single peak with both Cry1Ac-binding and leucine aminopeptidase activity. IEF and SDS–PAGE showed that the protein was purified to homogeneity (Fig. 1a, Lane 4 and Fig. 1c, Lane 1). The pI of the protein was 5.6 as determined

(5)

from the IEF gel. The N-terminal amino acid sequence was determined by gas-phase sequencing as XXNVDPALYRLPT (single letter amino acid code, X as any amino acid). Ligand blot assays demonstrated that this protein was able to bind Cry1Ba toxin in addition to Cry1Ac (Fig. 4). This contains the YRLPT sequence, which is conserved in all Cry1Ac-binding APNs (Medof et al., 1996).

The relative rates of hydrolysis of amino acid amides by the enzyme are given in Table 2. The enzyme was most active with leucinamide, but also was able to hydrolyse isoleucinamide, tryptophanamide, phenylalan-inamide, valinamide and histidinamide to a lesser extent. There was no significant hydrolysis of serinamide, proli-namide, alaniproli-namide, glycinamide and argininamide.

3.2. cDNA sequence analysis

EposAPN for protein localisation by PSORT predicts

with p=0.919 possibility that the protein is located in the plasma membrane (Nakai and Kanehisa, 1992). The inferred protein contains a putative signal peptide (MAALKLLVFALACYCASS, residues 1–18) and a GPI anchor including a GPI signal sequence (GSA, resi-dues 985–987, Fig. 3) and GPI anchor hydrophobic tail (SMTLLGLAALFNFVL, residues 993–1007). Epos-APN contains four cysteine residues which are

con-Table 2

Relative rates of amino acid amide hydrolysis

Amino acid amide Relative rate of hydrolysis (Leu=100)

Alaninamide 5

Argininamide 0.1

Glycinamide 0.2

Histidinamide 6

Isoleucinamide 16

Leucinamide 100

Phenylalaninamide 12

Prolinamide 0.1

Serinamide 0.1

Tryptophanamide 18

Valinamide 6

served in all insect APNs isolated to date (residues 750, 757, 785, 821). The inferred EposAPN protein contains no predicted N-linked glycosylation sites, but has many possible O-linked glycosylation sites. It has a predicted molecular weight of 108 kDa once the predicted signal and other leader peptides are removed (amino acids 51– 990) and assuming no glycosylation. Blast searches using protein sequence against the NCBI database reveal that EposAPN is most similar to other insect glutamyl aminopeptidases from H. virescens (61% identical; Gill et al., 1995) and M. sexta APN1 (42% identical; Knight et al., 1995). EposAPN is less related to M. sexta APN2 and P. xylostella APN (Denolf et al., 1997). EposAPN shares conserved Zn2+ _{binding and catalytic residues}

with other metallopeptidases (amino acid residues 374, 375, 378, 397; Rawlings and Barrett, 1995).

3.3. Baculovirus expressed EposAPN

Sf9 cells infected by baculovirus expressing EposAPN from the clone pEposAPN1 had significantly increased APN activity compared to uninfected and pnlb-infected Sf9 cells (Table 3). When the cells were lysed, there was no significant increase in APN activity, suggesting that nearly all the enzyme was expressed on the surface of the cells. EposAPN was purified from Sf9 cells using a method that was essentially the same as the purification of APN from midgut material. The purified recombinant

EposAPN protein had a molecular weight of 130 kDa,

and was able to bind both Cry1Ac and Cry1Ba in ligand blot assays (Fig. 4). The N-terminal amino acid sequence was determined by gas-phase sequencing as XDNVDPALYRLPTT.

The results of competitive binding assays of Sf9 cells are shown in Fig. 5. Cells expressing the pectin lyase, pnlb, were able to saturably bind both Cry1Ac and Cry1Ba (filled symbols). Using Sf9 cells expressing recombinant EposAPN showed no change in the binding of either Cry1Ac or Cry1Ba as compared to cells expressing the pectin lyase pnlb (the hollow symbols).

4. Discussion

Competitive binding assays using 125_I-labelled _d

-endotoxins of B. thuringiensis show that E. postvittana BBMVs possess at least two binding sites for Cry1Ac and Cry1B (Simpson et al., 1997). One binding site had a high affinity with both Cry1Ac and Cry1Ba (dissociation constant in the high pM range) while there was a distinct low-affinity site (dissociation constants in the high nM range) for each toxin. Ligand blot binding assays revealed three binding proteins from E. postvittana BBMVs with molecular weights 120, 180, and 200 kDa which all bound both Cry1Ac and Cry1Ba. The 120-kDa Cry1Ac/Cry1Ba-binding protein was purified, using the

(6)

Fig. 2. Nucleotide and inferred amino acid (below) sequence of EposAPN. The amino acid sequenced N-terminus is marked by the single underlining and the putative polyadenylation signal is doubly underlined. Potential O-linked glycosylation sites are marked by plus signs. ligand blot assay to follow purification. During

purifi-cation the molecular weight, by SDS–PAGE, dropped to 115 kDa. This decrease in size is probably due to the loss of a glycosylphosphatidylinositol (GPI) anchor. Further evidence for the presence of a GPI anchor was our obser-vation of ethanolamine in low molecular weight gel fil-tration fractions (data not shown, Ferguson and Willi-ams, 1988). The purified binding protein has aminopeptidase activity and the gene encoding the bind-ing protein is most similar to other lepidopteran APN genes isolated to date.

The inferred protein contains conserved features of aminopeptidases such as the conserved Zn2+_-binding

cysteines and catalytic residues. Similar to the lepidop-teran APNs from H. virescens and M. sexta (Lu and Adang, 1996; Luo et al., 1997b), EposAPN contains a GPI anchor; during membrane solubilisation this is cleaved resulting in the 115-kDa protein. In contrast, it

has no sites for N-linked glycosylation, although there are many potential sites for O-linked glycosylation, includ-ing a large number of serine and threonine residues near the C-terminus. If these C-terminal sites are glycosylated, the carbohydrate chains are probably involved in holding the enzyme proud from the membrane.

After purification, baculovirus-expressed recombinant

EposAPN retained its aminopeptidase activity. The

recombinant EposAPN had a higher molecular weight than BBMV-purified protein (130 kDa compared with 120 kDa); a result similar to the findings of Denolf et al. (1997), who found evidence for altered glycosylation on the expressed protein. N-terminal sequencing con-firmed the identity of the recombinant protein as Epos-APN, thus the higher molecular weight could be due to either the lack of cleavage of the GPI anchor, extra gly-cosylation of the protein or a combination of both in Sf9 cells as compared with BBMVs.

(7)

Fig. 3. Alignment of the amino acid sequence of aminopeptidase-N from E. postvittana (this study), H. virescens (Gill et al., 1995), M. sexta APN1 (Knight et al., 1995), M. sexta APN2 (Denolf et al., 1997) and P. xylostella (Denolf et al., 1997). Amino acids with dark backgrounds are conserved residues of the Zn2+_{binding motif, potential signal peptide sequences are underlined, sequenced N-terminus of EposAPN is boldly} underlined, highly conserved residues have a grey background, and residues potentially part of the GPI anchor signal sequence and hydrophobic core sequence are boxed.

Unlike the APN expressed by Denolf et al. (1997), ligand blot assays with recombinant EposAPN showed that it was able to bind both Cry1Ac and Cry1Ba. How-ever, in competitive binding assays using radiolabelled toxins Sf9 cells expressing EposAPN showed no differ-ence in the ability to bind either Cry1Ac or Cry1Ba as compared to control Sf9 cells. Inconsistencies between

ligand blot and competitive binding assays have been reported previously (Lee and Dean, 1996), but this result is more distinct: a protein which binds endotoxins by the ligand blot assay does not bind at all in competitive bind-ing assay. This suggests that bindbind-ing to aminopeptidase that is not bound to a lipid bilayer is artifactual. There are a number of possible explanations for the difference

(8)

Table 3

Leucine aminopeptidase activities in Sf9 cells

Cells APN activity (nmol min21_mg

cell protein21₎

Uninfected cells 9

pnlb-infected cells 11

EposAPN-infected cells 1720 Lysed EposAPN-infected cells 1744

Fig. 4. Ligand blot analysis of BBMV-purified EposAPN and recom-binant EposAPN. The BBMV-purified protein is in Lanes 1 and 3, the recombinant protein from Sf9 cells in Lanes 2 and 4. Lanes 1 and 2 were probed with Cry1Ac, Lanes 3 and 4 with Cry1Ba.

between the two assay results. The d-endotoxin binding site on the APN may lie close to the GPI anchor or be one of the C-terminal O-linked carbohydrate side chains, and when the APN is attached to a membrane, the site is sterically protected. Or the binding site may consist of two carbohydrate or peptide motifs within a certain distance of each other, and the native structure of APN does not produce this while the various denaturing steps of the ligand blot mean that an artifactual binding site is formed. Alternatively, the binding seen in the ligand blot may be due to nonspecific interactions between the toxins and sugar groups on the APN, which are not seen in the competitive binding assay.

APN has been implicated in the mode of action of B.

thuringiensis d-endotoxins. Initial evidence came from Sangadala et al. (1994) who showed that a mixture of

Fig. 5. Competitive binding curves for Sf9 cells infected with baculo-virus containing the gene EposAPN1 (hollow symbols) and pnlb (filled symbols) using radiolabelled Cry1Ac (squares) and Cry1Ba (circles).

APN and alkaline phosphatase increased Cry1Ac-induced efflux of Rb2+_{from phospholipid vesicles.}

Mas-son et al. (1995) showed, using surface plasmon reMas-son- reson-ance, that M. sexta APN was able to specifically bind Cry1Ac with a KD approximately the same as that

determined by competitive binding assay. However, the study showed the existence of two binding sites on APN, whereas competitive binding studies showed only one (van Rie et al., 1989). These results have been criticised as being inconsistent and unqualitative (Schuck and Minton, 1996). Lee et al. (1996) showed that adding pur-ified APN inhibited binding of Cry1Ac to L. dispar BBMV, but again free APN was used. Other studies have tried to show the role of APN by indirect methods, such as showing that pore-forming activity is related to the amount of APN activity, which was varied by cleav-age of the GPI anchor (Lorence et al., 1997), or that binding of radiolabelled toxin decreases with incubation with enzymes that cleave GPI anchors or N-linked carbohydrate side chains (Denolf et al., 1997). These studies only show that the binding protein probably has a GPI anchor, and that binding involves N-linked carbo-hydrates, not that APN is the binding protein.

The competitive binding assay results suggest that the

E. postvittana 120-kDa APN is not the specific receptor

ford-endotoxins. Other evidence which suggests that the 120-kDa APN does not act as a specific endotoxin recep-tor is given by Luo et al. (1997b), who found that the ligand blot binding of Cry1Ac to APN from P. xylostella was essentially unchanged between susceptible larvae and ones with over one thousand-fold resistance to Cry1Ac. In contrast, the cadherin-like receptor from M.

sexta has been expressed in Sf9 cells, and both ligand

blot and competitive binding assay results of the recom-binant protein gave the same results as native protein (Francis and Bulla, 1997). This shows that expression of putative receptors tod-endotoxins in Sf9 cells is able to

(9)

yield proteins able to bind the toxins. Thus the lack of binding seen by Denolf et al. (1997) and in this study is likely to be caused by an inherent lack of specific binding by APN rather than problems caused by expression within the Sf9 cells.

The role APN plays in the mode of action of endo-toxin toxicity remains questionable. Although it is clear thatd-endotoxins do bind to at least some APNs in the gut of Lepidoptera it is not obvious whether this binding results in pore formation. APN might be part of a more complex array of proteins that together allow binding and pore formation, or perhaps the endotoxins are trans-ferred to and bind other less-abundant proteins after first being associated with the carbohydrate side chains of APN. Or possibly APN has no role at all in the mode of action of B. thuringiensis d-endotoxins.

Acknowledgements

We thank the University of Waikato DNA sequencing facility for DNA sequencing, Catriona Knight at Auck-land University for N-terminal amino acid sequencing and David Greenwood and Andrew Gleave for their comments on the manuscript.

References

Cavener, D.R., Ray, S.C., 1991. Eukaryotic start and stop translation sites. Nucleic Acids Res. 19, 3185–3192.

Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J., Rutter, W.J., 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294–5299.

Christeller, J.T., Shaw, B.D., Gardiner, S.E., Dymock, J., 1989. Partial purification and characterization of the major midgut proteases of grass grub larvae (Costelytra zealandica, Coleoptra: Scaribaeidae). Insect Biochem. Mol. Biol. 19, 221–231.

Clare, G.G., Ochieng-Odero, J.P.R., Dalzell, S.J., Singh, P., 1987. A practical rearing method for leafroller (Lepidoptera: Tortricidae). N. Z. J. Zool. 14, 597–601.

Denolf, P., Hendrickx, K., van Damme, J., Jansens, S., Peferoen, M., Degheele, D. et al., 1997. Cloning and characterization of Manduca

sexta and Plutella xylostella midgut aminopeptidase-N enzymes

related to Bacillus thuringiensis toxin-binding proteins. Eur. J. Biochem. 248, 748–761.

Devereux, J., Haeberli, P., Smithies, O., 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12, 387–395.

Ferguson, M.A.J., Williams, A.F., 1988. Cell-surface anchoring of pro-teins via glycosyl-phosphatidylinositol structures. Annu. Rev. Biochem. 57, 285–320.

Francis, B.R., Bulla, L.A. Jr., 1997. Further characterisation of BT-R1, the cadherin-like receptor for Cry1Ab toxin in tobacco hornworm (Manduca sexta) midguts. Insect Biochem. Mol. Biol. 27, 541–550. Garczynski, S.F., Crim, H.W., Adang, M.J., 1991. Identification of putative insect brush border membrane-binding molecules specific to Bacillus thuringiensisd-endotoxin by protein blot analysis. Appl. Environ. Microbiol. 57, 2816–2820.

Gill, S.S., 1995. Mechanism of action of Bacillus thuringiensis toxins. Mem. Inst. Oswaldo Cruz 90, 69–74.

Gill, S.S., Cowles, E.A., Francis, V., 1995. Identification, isolation, and cloning of a Bacillus thuringiensis Cry1Ac toxin-binding pro-tein from the midgut of the lepidopteran insect Heliothis virescens. J. Biol. Chem. 270, 27277–27282.

Gleave, A.P., Hedges, R.J., Broadwell, A.H., Wigley, P.J., 1992. Clon-ing and nucleotide sequence of an insecticidal crystal protein from

Bacillus thuringiensis DSIR732 active against three species of

leaf-roller (Lepidoptera: Tortricidae). N. Z. J. Crop Hort. Sci. 20, 27–36. Himmelhoch, S.R., 1970. Leucine aminopeptidase from swine kidney.

Methods Enzymol. XIX, 508–521.

Keeton, T.P., Bulla, L.A. Jr., 1997. Ligand specificity and affinity of BT-R1, the Bacillus thuringiensis Cry1A toxin receptor from

Man-duca sexta, expressed in mammalian and insect cell cultures. Appl.

Environ. Microbiol. 63, 3419–3425.

Knight, P.J.K., Crickmore, N., Ellar, D.J., 1994. The receptor for

Bacil-lus thuringiensis CryIA(c) delta-endotoxin in the brush border

membrane of the lepidopteran Manduca sexta is aminopeptidase M. Mol. Microbiol. 11, 429–436.

Knight, P.J.K., Knowles, B.H., Ellar, D.J., 1995. Molecular cloning of an insect aminopeptidase-N that serves as a receptor for Bacillus

thuringiensis CryIA(c) toxin. J. Biol. Chem. 270, 17765–17770.

Knowles, B.H., Dow, J.A.T., 1993. The crystald-endotoxins of

Bacil-lus thuringiensis: models of their mechanism of action on the insect

gut. BioEssays 15, 469–476.

Lee, M.K., Dean, D.H., 1996. Inconsistencies in determining Bacillus

thuringiensis toxin binding sites relationship by comparing

compe-tition assays with ligand blotting. Biochem. Biophys. Res. Com-mun. 220, 575–580.

Lee, M.K., You, T.H., Young, B.A., Cotrill, J.A., Valaitis, A.P., Dean, D.H., 1996. Aminopeptidase N purified from gypsy moth brush border membrane vesicles is a specific receptor for Bacillus

thurin-giensis CryIAc toxin. Appl. Environ. Microbiol. 62, 2845–2849.

Lorence, A., Darszon, A., Bravo, A., 1997. Aminopeptidase dependent pore formation of Bacillus thuringiensis Cry1Ac toxin on

Tricho-plusia ni membranes. FEBS Lett. 414, 303–307.

Lu, Y.-J., Adang, M.J., 1996. Conversion of Bacillus thuringiensis Cry1Ac-binding aminopeptidase to a soluble form by endogenous phosphatidylinositol phospholipase C. Insect Biochem. Mol. Biol. 226, 33–40.

Luo, K., Sangadala, S., Masson, L., Mazza, A., Brousseau, M., Adang, M.J., 1997a. The Heliothis virescens 170 kDa aminopeptidase func-tions as “Receptor A” by mediating specific Bacillus thuringiensis Cry1Ad-endotoxin binding and pore formation. Insect Biochem. Mol. Biol. 27, 735–743.

Luo, K., Tabashnik, B.E., Adang, M.J., 1997b. Binding of Bacillus

thuringiensis Cry1Ac toxin to aminopeptidase in susceptible and

resistant diamondback moths (Plutella xylostella). Appl. Environ. Microbiol. 63, 1024–1027.

Ma, P.W.K., Knipple, D.C., Roelofs, W.L., 1994. Structural organiza-tion of the Helicoverpa zea gene encoding the precursor protein for pheromone biosynthesis-activating neuropeptide and other neu-ropeptides. Proc. Natl. Acad. Sci. USA 91, 6506–6510.

Marchuk, D., Drumm, M., Saulino, A., Collins, F.S., 1991. Construc-tion of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19, 1154. Masson, L., Lu, Y.-J., Mazza, M., Brousseau, R., Adang, M.J., 1995.

The CryIA(c) receptor purified from Manduca sexta displays mul-tiple specificities. J. Biol. Chem. 270, 20309–20315.

Medof, M.E., Nagarajan, S., Tykocinski, M.L., 1996. Cell-surface engineering with GPI-anchored proteins. FASEB J. 10, 574–586. Nakai, K., Kanehisa, M., 1992. A knowledge base for predicting

pro-tein localization sites in eukaryotic cells. Genomics 14, 897–911. Rawlings, N.D., Barrett, A.J., 1995. Evolutionary families of

metallo-peptidases. Methods Enzymol. 248, 183–228.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York.

(10)

Sanchis, V., Ellar, D.J., 1993. Identification and partial purification of a Bacillus thuringiensisd-endotoxin binding protein from

Spodop-tera littoralis gut membranes. FEBS Lett 316, 264–268.

Sangadala, S., Walters, F.S., English, L.H., Adang, M.J., 1994. A mix-ture of Manduca sexta aminopeptidase and phosphatase enhances

Bacillus thuringiensis insecticidal CryIA(c) toxin binding and

86_Rb+_–K+_{efflux in vitro. J. Biol. Chem. 269, 10088–10092.} Schuck, P., Minton, A.P., 1996. Kinetic analysis of biosensor data:

elementary tests for self-consistency. Trends Biol. Sci. 21, 458– 460.

Simpson, R.M., Burgess, E.P.J., Markwick, N.P., 1997. Bacillus

thur-ingiensisd-endotoxin binding sites in two Lepidoptera, Wiseana spp. and Epiphyas postvittana. J. Invert. Pathol. 70, 136–142. Singh, P., 1974. A chemically-defined medium for rearing Epiphyas

postvittana (Lepidoptera: Tortricidae). N. Z. J. Zool. 1, 241–243.

Valaitis, A.P., Lee, M.K., Rajamohan, F., 1995. Brush border mem-brane aminopeptidase-N in the midgut of the gypsy moth serves as the receptor for the CryIA(c)d-endotoxin of Bacillus thuringiensis. Insect Biochem. Mol. Biol. 25, 1143–1151.

Valdamudi, R.K., Weber, E., Ji, I., Ji, T.H., Bulla, L.A. Jr., 1995.

Cloning and expression of a receptor for an insecticidal toxin of

Bacillus thuringiensis. J. Biol. Chem. 270, 5490–5494.

van Rie, J., Jansens, S., Ho¨fte, H., Degheele, D., van Mellaert, H., 1989. Specificity of Bacillus thuringiensis d-endotoxins. Impor-tance of specific receptors on the mid-gut of target insects. Eur. J. Biochem. 186, 239–247.

Wearing, C.H., Thomas, W.P., Dugdale, J.S., Danthanarayana, W., 1991. Tortricid pests of pome and stone fruits, Australian and New Zealand species. In: van der Greet, L.P.S., Evenhuis, H.H. (Eds.). Tortricid Pests: Their Biology, Natural Enemies and Control, vol. 5. Elsevier, Amsterdam, pp. 453–472.

Wolfersberger, M., Luethy, P., Maurer, A., Parenti, P., Sacchi, F.V., Giordana, B., Hanozet, G.M., 1987. Preparation and partial charac-terization of amino acid transporting brush border membrane ves-icles from the larval midgut of the cabbage butterfly (Pieris

brassicae). Comp. Biochem. Physiol. 86A, 301–308.

Yaio, K., Kadotani, T., Kuwana, H., Shinkawa, A., Takahashi, T., Iwa-hana, H., Sato, R., 1997. Aminopeptidase N from Bombyx mori is a candidate for the receptor of Bacillus thuringiesis Cry1Aa toxin. Eur. J. Biochem. 246, 652–657.

(1)

from the IEF gel. The N-terminal amino acid sequence

was determined by gas-phase sequencing as

XXNVDPALYRLPT (single letter amino acid code, X as any amino acid). Ligand blot assays demonstrated that this protein was able to bind Cry1Ba toxin in addition to Cry1Ac (Fig. 4). This contains the YRLPT sequence, which is conserved in all Cry1Ac-binding APNs (Medof et al., 1996).

Sequencing of pEposAPN and the 5₉ and 3₉ RACE products were aligned to form a contig of 3450 bp in length (Fig. 2); GenBank accession number AF276241). This sequence contained an open reading frame of 1007 amino acids (EposAPN) and includes the N-terminal amino acid sequence attained from the purified 115-kDa Cry1Ac-binding protein described above. The predicted start codon is embedded in a consensus Kozac trans-lation initiation sequence (UCAACUCAAGAUGGC, nts -10-5, Fig. 2) Cavener and Ray, 1991). There is a putative polyadenylation signal (AAUAAA) 14 bp before the polyA tail. Analysis of the predicted protein EposAPN for protein localisation by PSORT predicts with p=0.919 possibility that the protein is located in the plasma membrane (Nakai and Kanehisa, 1992). The inferred protein contains a putative signal peptide (MAALKLLVFALACYCASS, residues 1–18) and a GPI anchor including a GPI signal sequence (GSA, resi-dues 985–987, Fig. 3) and GPI anchor hydrophobic tail (SMTLLGLAALFNFVL, residues 993–1007). Epos-APN contains four cysteine residues which are

con-Table 2

Relative rates of amino acid amide hydrolysis

Amino acid amide Relative rate of hydrolysis (Leu=100)

Alaninamide 5 Argininamide 0.1 Glycinamide 0.2 Histidinamide 6 Isoleucinamide 16 Leucinamide 100 Phenylalaninamide 12 Prolinamide 0.1 Serinamide 0.1 Tryptophanamide 18 Valinamide 6

with other metallopeptidases (amino acid residues 374, 375, 378, 397; Rawlings and Barrett, 1995).

3.3. Baculovirus expressed EposAPN

was determined by gas-phase sequencing as

XDNVDPALYRLPTT.

4. Discussion

Competitive binding assays using 125_I-labelled _d

(2)

The inferred protein contains conserved features of aminopeptidases such as the conserved Zn2+_-binding

After purification, baculovirus-expressed recombinant EposAPN retained its aminopeptidase activity. The recombinant EposAPN had a higher molecular weight than BBMV-purified protein (130 kDa compared with 120 kDa); a result similar to the findings of Denolf et al. (1997), who found evidence for altered glycosylation on the expressed protein. N-terminal sequencing con-firmed the identity of the recombinant protein as Epos-APN, thus the higher molecular weight could be due to either the lack of cleavage of the GPI anchor, extra gly-cosylation of the protein or a combination of both in Sf9 cells as compared with BBMVs.

(3)

underlined, highly conserved residues have a grey background, and residues potentially part of the GPI anchor signal sequence and hydrophobic core sequence are boxed.

(4)

Table 3

Leucine aminopeptidase activities in Sf9 cells

Cells APN activity (nmol min21_mg

cell protein21₎

Uninfected cells 9

pnlb-infected cells 11

EposAPN-infected cells 1720

Lysed EposAPN-infected cells 1744

APN has been implicated in the mode of action of B. thuringiensis d-endotoxins. Initial evidence came from Sangadala et al. (1994) who showed that a mixture of

APN and alkaline phosphatase increased Cry1Ac-induced efflux of Rb2+_{from phospholipid vesicles.}

Mas-son et al. (1995) showed, using surface plasmon reMas-son- reson-ance, that M. sexta APN was able to specifically bind Cry1Ac with a KD approximately the same as that

The competitive binding assay results suggest that the E. postvittana 120-kDa APN is not the specific receptor ford-endotoxins. Other evidence which suggests that the 120-kDa APN does not act as a specific endotoxin recep-tor is given by Luo et al. (1997b), who found that the ligand blot binding of Cry1Ac to APN from P. xylostella was essentially unchanged between susceptible larvae and ones with over one thousand-fold resistance to Cry1Ac. In contrast, the cadherin-like receptor from M. sexta has been expressed in Sf9 cells, and both ligand blot and competitive binding assay results of the recom-binant protein gave the same results as native protein (Francis and Bulla, 1997). This shows that expression of putative receptors tod-endotoxins in Sf9 cells is able to