1092 S. Marchese et al. Insect Biochemistry and Molecular Biology 30 2000 1091–1098
teins similar to OS-D from antennae and other chemo- sensory organs of insects of different orders, however,
supports the hypothesis that these could represent another class of proteins involved in chemoreception.
Our search for odorant-binding proteins in insect orders other than Lepidoptera first led to the isolation of
low molecular weight polypeptides highly expressed in the sensory organs antennae, tarsi and mouth structures
of several species of Phasmids Tuccini et al., 1996; Mameli et al., 1996 bearing a significant similarity to
Drosophila OS-D. Members of this class were later described in the Orthopteran species Schistocerca grega-
ria Angeli et al., 1999, in three species of Lepidoptera, Cactoblastis cactorum Maleszka and Stange, 1997,
Mamestra brassicae Bohbot et al., 1998 and Bombyx mori Picimbon et al., 2000, as well as in the honey bee
Danty et al., 1998 and in cockroaches Picimbon and Leal, 1999. Unlike lepidopteran OBPs and their putative
homologues of other orders, OS-D-like proteins are well conserved across evolution, with 40–50 of identical
residues even between most distant species.
The physiological function of these proteins is still to be identified, and even their role in olfaction has been
questioned. A proposed role in carbon dioxide sensing Maleszka and Stange, 1997 has not received experi-
mental evidence. On the other hand, their involvement in chemosensation is well supported by their specific
expression in chemosensory organs, such as antennae, tarsi and mouth apparatus Angeli et al., 1999. More-
over, electron microscopy experiments, have clearly shown that in S. gregaria these proteins are highly con-
centrated in the lymph of contact sensilla of antennae, tarsi and labial palpi, but are absent in olfactory sensilla
Angeli et al., 1999. A protein similar to Drosophila OS-D is expressed in the ejaculatory bulb of the same
species Dyanov and Dzitoeva, 1995. The presence in this organ of the sex pheromone suggested the idea that
such protein could be a carrier for the hydrophobic mol- ecule. This view was supported by recent experiments
demonstrating reversible binding of the Drosophila pheromone vaccenyl acetate to the OS-D-like protein of
the Lepidopteran species M. brassicae Bohbot et al., 1998. Another polypeptide of the same class, called
p10, has been isolated from the regenerating legs of the cockroach Periplaneta americana Kitabayashi et al.,
1998: the authors suggest a function in the regeneration of limbs during the larval stages.
To provide additional information on the structure of this class of proteins, we have cloned three members of
this family from the antennae of the Phasmid Eurycantha calcarata.
A comparison
with similar
sequences expressed in insects of different orders reveals highly
conserved regions, probably involved in a common func- tion.
2. Materials and methods
2.1. Materials
2.1.1. Insects Individuals of E. calcarata were reared on fresh bram-
ble and used for the experiments at their adult stage. Tissue samples of Carausius morosus and S. gregaria,
used in Western blot experiments, have been made avail- able in previous studies Tuccini et al., 1996; Angeli et
al., 1999
2.1.2. Chemicals The reagents and kits used for molecular biology
experiments are described in Section 2.2. Oligonucleot- ides for PCR amplification were synthesised by GIBCO
Brl and PRIMM, Milan, Italy. Labelled reagents for ligand binding assays
14
C-sodium bicarbonate and
3
H- glucose were obtained from the Radiochemical Center,
Amersham Life Science, UK, and had specific activities of 50 mCimmole and 26 Cimmole, respectively.
Solvents and reagents for amino acid sequence deter- mination were “sequencing grade”. All other reagents
were of analytical grade. 2.2. Methods
2.2.1. Purification of protein p14 from the tarsi and the cuticle of E. calcarata
The protein was purified by gel filtration and anion- exchange chromatography on Mono-Q, as previously
reported Mameli et al., 1996. The tarsi of 11 individ- uals afforded about 4 mg of protein, migrated as a single
broad band in SDS-PAGE. Samples were subjected to a final chromatographic step on a Vydac C
4
column 214TP54 250
× 4.6 mm, 5
µ m, 300 A
˚ pore size The Separation Group, USA. Proteins were dissolved in
0.1 TFA, loaded onto the column and eluted by a lin- ear gradient from 5 to 70 of acetonitrile in 0.1 TFA
over 30 min, at a flow rate of 1 mlmin.
The same procedure was used for the purification of protein p14 from the cuticle.
2.2.2. Amino acid sequence analysis Amino acid sequence was determined by direct
Edman degradation on a Milligen 6600 apparatus. Samples
of purified
protein 200–500
pmol in
ammonium bicarbonate were dried, solubilised in 5 vv N-methyl-morpholine, 50 vv aqueous isopro-
panol, immobilised on DITC-activated membranes and subjected to automatic sequential degradation. DITC
membranes were prepared as previously described Garibotti et al., 1997.
1093 S. Marchese et al. Insect Biochemistry and Molecular Biology 30 2000 1091–1098
2.2.3. Mass spectrometry Intact proteins were submitted to ESMS analysis,
using a Platform single quadrupole mass spectrometer Micromass, UK. Samples were dissolved in 1 vv
acetic acid and 2–10 µ
l of the liquid was injected into the mass spectrometer at a flow rate of 10
µ lmin. The
quadrupole was scanned from mz 500 to 1800 at 10 sscan and the spectra were acquired and elaborated
using the MassLynx software. Calibration was perfor- med by the multiply charged ions from a separate injec-
tion of myoglobin M.W. 16,951.5 Da. All mass values are reported as average masses.
2.2.4. Cloning and DNA sequencing 2.2.4.1. cDNA synthesis
Total RNA was extracted from the tarsi of one male E. calcarata, using the
Trizol
Reagent kit GIBCO BRL, a modified guani- dine isothiocyanatephenol procedure, along with the
manufacturer’s instructions. One microgram of total RNA was subjected to reverse transcription, using 200
units of the Moloney Murine Leukemia Virus M-MLV reverse transcriptase GIBCO BRL and 0.5
µ g of oligo
dT
12–18
Sigma in a 20 µ
l total volume. The mixture also contained 1 mM of each dNTP Pharmacia Biotech,
Uppsala, Sweden, 75 mM KCl, 3 mM MgCl
2
, 10 mM DTT and 0.1 mgml BSA in 50 mM TrisHCl, pH 8.3.
The reaction mixture was incubated at 42 °
C for 60 min and the products were directly used for PCR amplifi-
cation or stored at 220
° C.
2.2.5. Polymerase chain reaction Aliquots of 0.5
µ g of cDNA mixture were amplified
in a Bio-Rad Gene Cycler, or a MJ PTC-150 Min- iCycler, using 2.5 units of Thermus aquaticus DNA
Polymerase Promega, or of pfu DNA Polymerase, 1 mM of each dNTP Pharmacia Biotech, Uppsala,
Sweden, 1
µ M of each PCR primer, 50 mM KCl, 2.5
mM MgCl
2
and 0.1 mgml BSA in 10 mM TrisHCl, pH 8.3, containing 0.1 Triton X-100. At the 5
9 end we used the 17mer degenerated primer ACNAARTAY-
GAYAAYGT, designed on the amino acid sequence 7– 11 –TKYDNV–. At the 3
9 end a 15–18mer oligo-dT was employed. After a denaturing step at 95
° C for 2
min, the reaction was performed for 30 cycles 95 °
C for 20 s, 48
° C for 20 s, 72
° C for 1 min, followed by a final
step of 7 min at 72 °
C. The missing codons at the 5 9 end
of the genes were determined using the RACE method. The cDNA sample was incubated with Terminal deoxyn-
ucleotidyl transferase and dCTP for 10 min at 37 °
C. The product was then amplified by PCR, using the primer
GGCCACGCGTGGACGATCG
n
: at the 5 9 end, and
one of the two primers AACTGCATGGTGTCTT ATAAATGT and AAGATGCACGTCGTGAAGACA
GGG, complementary to the non-coding regions of pre- viously determined sequences, at the 3
9 end. 2.2.6. RACE
A RACE Rapid Amplification of cDNA Ends strat- egy was applied for determining the sequence at the 5
9 end and thus obtaining the complete cDNA sequence.
Accordingly a polyC was linked to the 5 9 end and the
cDNA was amplified by PCR using an oligo-dG and spe- cific primers, corresponding to already known sequences
following the stop codons.
2.2.7. Cloning of PCR products PCR products were separated on a 2 agarose gel.
The most prominent bands, corresponding to sizes of around 400–500 bp, were dissected and DNA was
extracted and purified using a gene clean kit Qiagen, following the manufacturer’s instructions. Amplified
DNA was ligated into a pCR-Script Stratagene plas- mid. E. coli Epicurian Coli XL-1 Blue MRF Supercom-
petent Cells Stratagene were transformed with the lig- ation products, using the manufacturer’s protocol and
plated. White colonies were assayed for the presence of the insert by PCR, using the plasmid primers M13R and
T7. Selected positive clones were grown in liquid LB medium and plasmids were extracted and purified, using
the QIAquick Purification Kit Qiagen. Nucleotide sequences of both strands of the cDNA clones were
determined from double stranded plasmid DNA using the Applied Biosystem Dye Deoxy Terminator Cycle
Sequencer Kit and an Applied Biosystem 310 auto- mated sequencer.
2.2.8. Preparation of polyclonal antibodies Antisera were obtained by injecting an adult rabbit
subcutaneously and intramuscularly with 400 µ
g of pur- ified protein E. calcarata CSP, C. morosus p19 and S.
gregaria CSP, followed by two additional injections of 250
µ g after 18 and 30 days. The protein was emulsified
with an equal volume of Freund’s complete adjuvant for the first injection and of incomplete adjuvant for further
injections. Animals were bled 10 days after the last injection and the serum was partially purified by precipi-
tation in 45 ammonium sulphate.
2.3. Western blot Protein samples and extracts were separated by
electrophoresis in denaturing conditions 12 SDS- PAGE and then electroblotted onto nitrocellulose mem-
brane, according to Kyhse-Andersen 1984. After treat- ment with 0.2 gelatin from porcine skin Sigma,
0.05 Tween 20 in PBS for 2 h, the membrane was incubated with the crude antiserum against the appropri-
ate protein at a dilution of 1:1000 and then with goat antirabbit
IgG-horseradish peroxidase
conjugate dilution 1:1000. Immunoreacting bands were detected
by treatment with 4-chloro-1-naphthol.
1094 S. Marchese et al. Insect Biochemistry and Molecular Biology 30 2000 1091–1098
3. Results
