Brain Research 887 2000 80–89 www.elsevier.com locate bres
Research report
Human neurons generate C-reactive protein and amyloid P: upregulation in Alzheimer’s disease
Koji Yasojima, Claudia Schwab, Edith G. McGeer, Patrick L. McGeer
Kinsmen Laboratory of Neurological Research , Department of Psychiatry, University of British Columbia, Vancouver, BC, Canada V6T 1Z3
Accepted 12 September 2000
Abstract
C-reactive protein CRP and amyloid P AP are pentraxins which are associated with many pathological lesions, including the amyloid deposits and neurofibrillary tangles NFTs of Alzheimer disease AD. It has always been assumed that they are generated by
liver and delivered to their sites of action by serum. Here we report by in situ hydridization, reverse transcriptase–polymerase chain reaction analysis, Western blotting and immunohistochemistry that the mRNAs and proteins of both CRP and AP are concentrated in
pyramidal neurons and are upregulated in affected areas of AD brain. Controlling pentraxin production at the tissue level may be important in reducing inflammatory damage in AD.
2000 Elsevier Science B.V. All rights reserved.
Theme : Disorders of the nervous system
Topic : Degenerative disease: Alzheimer’s — other
Keywords : Pentraxin; Pyramidal neuron; Hippocampus; Entorhinal cortex; Liver; Cerebellum; Western blot; In situ hybridization; mRNA; Immuno-
histochemistry
1. Introduction these reactants, with serum levels rising as much as 1000-
fold following injury or infection. It is therefore intimately C-reactive protein CRP was named after it was
involved in all forms of damage to host tissue [35]. identified as a factor which binds to the C-polysaccharide
One of the important functions of these pentraxins is to of pneumococcus. Amyloid P AP was named for its
activate the classical complement pathway in an antibody- amyloid binding capacity. AP is an invariant component of
independent fashion [12,40]. Complement is also a phylo- all amyloid deposits, including those of Alzheimer’s
genetically ancient host defense mechanism which, like the disease AD brain. CRP and AP are referred to as
pentraxins, can be traced back to the horseshoe crab [21]. pentraxins because of their capacity to aggregate, in a
When activated, complement opsonizes targets for phago- non-covalent fashion, into flat pentameric discs. Pentraxins
cytosis and directly kills pathogens by insertion of the are highly conserved, being traced back as far as the
membrane attack complex MAC into their cell mem- horseshoe crab. They are hypothesized to be duplicated
branes. But the MAC can also insert itself into host cells, from a common ancestral gene as early as 200 million
causing autodestruction in a process called bystander lysis. years ago [35]. Their genes are located on band q2.1 of
The association of CRP [6,15] and AP [1,3,7] with chromosome 1 in a region rich in host protective genes.
activated complement fragments attached to host tissue in They are presumed to have great survival value and to be
such degenerative conditions as AD, myocardial infarction intimately associated with innate immune defense for
[20] and atherosclerosis [38] is suggestive of their partici- reviews see [8,9,35]. The proteins are also major acute
pation, with complement, in a negative, autodestructive phase reactants. In humans, CRP is the most sensitive of
role. It may therefore be important to learn methods of controlling pentraxin production at the cellular level.
It has always been assumed that CRP and AP are
Corresponding author. Tel.: 11-604-822-7377; fax: 11-604-822-
primarily, if not exclusively, produced by liver hepatocytes
7086. E-mail address
: mcgeerplinterchange.ubc.ca P.L. McGeer.
[8,9,35]. The presence of AP in AD brain has been taken
0006-8993 00 – see front matter
2000 Elsevier Science B.V. All rights reserved. P I I : S 0 0 0 6 - 8 9 9 3 0 0 0 2 9 7 0 - X
K . Yasojima et al. Brain Research 887 2000 80 –89
81
as evidence of impaired blood–brain barrier function in guanidium thiocyanate–phenol–chloroform method, and
AD [3,7,17], but direct measurement using tomographic single-strand cDNA synthesis performed on 5 mg of total
techniques has failed to demonstrate evidence of any RNA extract as previously described [42]. The cDNA 1
deficit [2,31]. ml was amplified in a 50 ml reaction buffer containing 20
Since innate immunity must function at a local level mM Tris–HCl pH 8.4, 50 mM KCl, 200 mM dNTPs and
[23], and complement proteins in brain have previously 2 mM MgCl . In addition to 0.5 mM of each specific
2
been shown to be generated mainly by neurons [33,37,42], oligonucleotide primer, 1 Tween 20, and 2 DMSO
it is logical to hypothesize that brain pentraxins might be were added as enhancers. The first amplification step
derived from a similar source. Identification of neurons as consisted of denaturation at 948C for 5 min, followed by a
a source of pentraxins would have implications for control hot start addition of 2.5 U Taq DNA polymerase at 808C
of inflammation not just in brain, but in chronic in- 1–3 min. This was followed by an annealing step at 558C
flammatory conditions in the periphery where production for 1 min and an extension step at 728C for 3 min, and then
by cells other than hepatocytes may be central to the by 35 cycles of a denaturation step at 948C for 1 min, an
inflammatory process. annealing step at 558C for 1 min, and an extension step at
728C for 1 min. The primers for AP GenBank Acc[X04608 were:
2. Methods forward CCTTTGCTCACACAGACCTCAGTGG, and re-
