K . Yasojima et al. Brain Research 887 2000 80 –89
81
as evidence of impaired blood–brain barrier function in guanidium thiocyanate–phenol–chloroform method, and
AD [3,7,17], but direct measurement using tomographic single-strand cDNA synthesis performed on 5 mg of total
techniques has failed to demonstrate evidence of any RNA extract as previously described [42]. The cDNA 1
deficit [2,31]. ml was amplified in a 50 ml reaction buffer containing 20
Since innate immunity must function at a local level mM Tris–HCl pH 8.4, 50 mM KCl, 200 mM dNTPs and
[23], and complement proteins in brain have previously 2 mM MgCl . In addition to 0.5 mM of each specific
2
been shown to be generated mainly by neurons [33,37,42], oligonucleotide primer, 1 Tween 20, and 2 DMSO
it is logical to hypothesize that brain pentraxins might be were added as enhancers. The first amplification step
derived from a similar source. Identification of neurons as consisted of denaturation at 948C for 5 min, followed by a
a source of pentraxins would have implications for control hot start addition of 2.5 U Taq DNA polymerase at 808C
of inflammation not just in brain, but in chronic in- 1–3 min. This was followed by an annealing step at 558C
flammatory conditions in the periphery where production for 1 min and an extension step at 728C for 3 min, and then
by cells other than hepatocytes may be central to the by 35 cycles of a denaturation step at 948C for 1 min, an
inflammatory process. annealing step at 558C for 1 min, and an extension step at
728C for 1 min. The primers for AP GenBank Acc[X04608 were:
2. Methods forward CCTTTGCTCACACAGACCTCAGTGG, and re-
verse AGGACTCCCAGCTCACACACAGATGTG. These 2.1. Cases studied
primers span the intron and are designed to yield a product of 309 bp. Endonuclease cut sites are present for Aci I
Fifteen autopsied cases were chosen for CRP and AP 228, 81 bp fragments and Spe I 191, 118 bp fragments.
mRNA analysis by RT–PCR. There were eight non-AD The primers for CRP GenBank Acc[M11725 were:
cases age 73.664.9; four males, four females and seven forward
TCGTATGCCACCAAGAGACAAGACA, and
AD cases age 69.662.5; two males and five females. reverse
AACACTTCGCCTTGCACTTCATACT. These
Post-mortem delay PMD in the AD cases varied from 6 primers were designed to yield a product of 440 bp with
to 16 h. PMD in the control cases varied from 8 to 96 h. endonuclease cut sites for Hae III 377, 63 bp fragments
For purposes of analysis, the control cases were grouped and Mse I 356, 84 bp fragments.
into short PMD four cases, average 14.2 h and long PMD The primers for cyclophilin GenBank Acc[Y00052
four cases, average 48 h. Due to the post-mortem were,
as previously
reported [42]:
forward stability of the mRNAs being analyzed, no significant
ATGGTCAACCCCACCGTGTTCTTCG, and
reverse differences were found between the two control groups
CGTGTGAAGTCACCACCCTGACACA. These primers see Results. Standard neuropathological analysis showed
were designed to yield a product of 206 bp with a Hae III that all the non-AD cases were free of typical AD lesions.
endonuclease cut site 153, 53 bp fragments. All of the AD cases had extensive pathology, easily
A linear relationship was found between the log of PCR meeting CERAD criteria for definite AD [25], and with
product intensity and cycle number for cyclophilin be- typical regional distribution of the lesions. The hippocam-
tween 20 and 29 cycles, for CRP between 26 and 37 pus and midtemporal gyrus were heavily affected with
cycles, and for AP between 24 and 32 cycles, after which classical senile plaques and NFTs. The cerebellum was
plateaus were reached. A linear relationship was also found free of such lesions. Intermediate pathology was found in
between the amount of cDNA product obtained and the the frontal cortex, while only moderate lesions were found
original cDNA added within the range corresponding to in the motor cortex. Blocks of tissue of 0.5–1 g weight
0.01 to 0.5 mg total RNA. Accordingly, standard con- were dissected from the fresh brains, and homogenized.
ditions were followed in which cDNA 1 ml corre- Aliquots were taken for extraction of RNA and protein.
sponding to 0.1 mg total RNA was added and the Adjacent areas were taken for standard neuropathology,
cyclophilin product amplified for 27 cycles and, in parallel immunohistochemistry, and in situ hybridization. In four of
experiments, the CRP product amplified for 35 cycles and the normal and four of the AD cases, other organs were
the AP amplified for 30 cycles. Each PCR product was available, permitting comparable analyses to be done on
electrophoresed through a 6 polyacrylamide gel and the liver specimens.
product visualized by incubation for 10 min in a solution containing 10 ng ml of ethidium bromide. Resulting gel
2.2. RNA extraction and reverse transcriptase– bands were imaged using a GDS 7600 image analyzer
polymerase chain reaction Ultra Violet Product, Uplands, CA. The relative inten-
sities of the bands, expressed as optical density units, were The previously described techniques [42] for total RNA
quantitatively analyzed using NIH image software 1.62. extraction and preparation of RT–PCR products were
The PCR products were of the expected size, and endonu- applied with minor modifications. Total RNA was ex-
clease digestion in each case gave fragments of the tracted from approximately 500 mg of tissue by the acid
predicted sizes.
82 K
In all experiments, the presence of possible contami- Hybridization was performed for 16 h at 508C in a
nants was checked by control reactions in which amplifica- humidified chamber. Test sections were hybridized with
tion was carried out for up to 35 cycles on samples in the antisense cRNA probes; and controls were probed with
which we omitted from the RT–PCR reaction mixture the sense cRNA probes. After hybridization, the sections
either i the reverse transcriptase or ii a template cDNA. were washed twice with 50 deionized formamide in
No product was obtained under these conditions. 23standard saline citrate SSC at 558C for 30 min,
followed by incubation with 20 mg ml RNase A Sigma 2.3. cRNA probe preparation and in situ hybridization
for 30 min at 378C. After being washed in 23SSC for 20 min and then in 0.23SSC for 20 min twice at 558C, the
AP and CRP cRNA probes were prepared starting with sections were incubated in a blocking buffer containing
the RT–PCR products. The 309 bp AP cDNA fragment 1.5 blocking reagent DIG Nucleic Acid Detection Kit,
was subcloned into the pGEM-T Easy plasmid vector Roche, Canada, 100 mM Tris pH 7.5, and 150 mM
Promega. The product was linearized with Nco I and Sal NaCl overnight at 48C. Alkaline phosphatase-conjugated
I NEB to produce sense and antisense DNA templates, anti-DIG antibody Roche, Canada diluted 1:1000 in
respectively. The AP cRNA probes were synthesized at blocking buffer was incubated with sections overnight at
378C for 3 h in a mixture composed of 1 mg linearized 48C. Before detection of alkaline phosphatase DIG-labeled
template DNA, 2 ml of ATP, CTP, GTP and digoxigenin RNAs, sections were prewashed in 100 mM Tris pH 9.5,
DIG-labeled UTP, 2 ml transcription buffer; and 20 U 100 mM NaCl and 50 mM MgCl , and then incubated for
2
RNase inhibitor with 20 U SP6 RNA polymerase for the 5 to 11 h in the dark at 48C in color substrates nitroblue
sense strand or 20 U T7 RNA polymerase for the antisense tetrazolium salt and 5-bromo-4-chloro-3-indolyl-phosphate
strand DIG RNA labeling Kit SP6 T7, Roche, Canada. toluidine salt in dimethylformamide diluted in the prewash
The 440 bp CRP cDNA fragment was similarly treated to buffer as described by the manufacturer. Once the desired
produce sense and antisense CRP cRNA probes. color intensity was attained, the color reaction was stopped
After labeling, the AP and CRP cRNA probes were by washing the sections in 10 mM Tris 1 mM EDTA pH
treated with 10 U RNase-free DNase I for 45 min at 378C, 8.0. The slides were photographed.
ethanol-precipitated, and resuspended in diethyl pyrocarbo- nate DEPC-treated distilled water containing 20 U RNase
2.4. Western blots inhibitor. The transcripts were analyzed on agarose gels
after ethidium bromide staining, and the yields were Western blots were performed on extracts of the soluble
estimated densitometrically by comparison with a control fraction of homogenates of control and AD hippocampus
RNA of known concentration. Immunohistochemical de- and liver, as well as on normal serum, following previous-
tection of DIG-labeled RNAs on nylon membranes ly reported methodology [42]. Briefly, tissue samples were
Hybond-N1, Amersham, UK revealed equivalent label- homogenized in 5 times v w extraction buffer 0.02 M
ing efficiency between sense and antisense cRNAs. Tris–HCl, pH 7.5, and 0.1 Triton X containing 1 mM
In situ hybridization was carried out on paraformal- EDTA and the protease inhibitors PMSF 10 mg ml and
dehyde-fixed, paraffin-embedded blocks of tissue. Fifteen aprotinin 10 mg ml. Homogenates were centrifuged at
micrometer sections were deparaffinized with xylene and 18,000 g at 48C for 30 min. The protein content of the
rehydrated in a graded series of ethanol solutions 100, supernatants was determined, the samples diluted in SDS
95, 90, 85, 80,and 70 in DEPC-treated distilled sample buffer 60 mM Tris, pH 6.8, 2.5 SDS, 5
water for 5 min at each step. Tissue sections were then 2-mercaptoethanol to a final protein concentration of 10
mounted on Silane-coated slides and treated with 2 mg ml mg ml and were boiled for 3 min. Samples containing 100
proteinase K Sigma at 378C for 30 min. They were mg of protein were loaded onto 10 acrylamide minigels.
further fixed for 30 min in 4 paraformaldehyde at 48C, For serum, samples containing 1–10 mg of protein were
followed by treatment with 0.25 acetic anhydride in 0.1 diluted in 5 ml of Tris buffer. An equal volume of SDS
M triethanolamine pH 8.0. The sections were washed sample buffer was added and the mixture boiled for 3 min
with phosphate-buffered saline PBS before dehydration before loading on 10 acrylamide minigels. Life Tech-
in a graded series of ethanol as described above for 30 s at nologies high range prestained standards were used as
each step. molecular weight markers. After 45 min of electrophoresis
The sections were prehybridized for 2 h at 508C in a 200 V, the proteins were transferred onto PVDF mem-
hybridization mixture [50 deionized formamide, 10 mM branes Immobilon P, Millipore Corp., MA at 7 V for 45
Tris pH 7.4, 200 mg ml yeast tRNA, 13 Denhardt’s min using a semi-dry blotter. Membranes were blocked in
solution, 10 dextran sulfate, 600 mM NaCl, 0.25 SDS 5 skim milk overnight at 48C. The immunoblots were
and 1 mM EDTA]. The probes 30 ng ml were added treated for 6 h at 48C with a primary antibody, followed by
into the hybridization mixture, which was heated at 808C treatment for 1 h with a secondary antibody labeled with
for 10 min and cooled before addition to the tissue horseradish peroxidase. Immunoreactivity was visualized
sections. by incubation with Supersignal CL–HRP chemilumines-
K . Yasojima et al. Brain Research 887 2000 80 –89
83
cent substrate Pierce Chemical Co., Rockford, IL. After containing 0.6 nickel ammonium sulfate and 0.001
draining, the membranes were covered in clear plastic H O in 0.05 Tris–HCl buffer, pH 7.6. When a dark blue
2 2
wrapping and exposed to X-ray film Hyperfilm ECL, color developed, sections were washed, mounted on glass
Amersham Life Science, UK for 0.3 to 2 min, depending slides and coverslipped with Entellan.
on the strength of the signal. The primary antibodies against human CRP were rabbit anti-CRP DAKO, 1:500,
sheep anti-CRP WAKO, 1:1000, mouse monoclonal anti-
3. Results
