58 N. Parkinson et al. Insect Biochemistry and Molecular Biology 31 2001 57–63
sitoid Pimpla hypochondriaca, and have previously identified several biologically active components includ-
ing an enzyme which oxidizes L-DOPA Parkinson and Weaver, 1999. Two enzymes known to catalyse oxi-
dation of L-DOPA are tyrosinase EC 1.14.18.1 mono- phenol
monooxygenase; L-DOPA:oxygen
oxidore- ductase and laccase EC 1.10.3.1 o-diphenol oxidase;
1,2-benzenediol:oxygen oxidoreductase. Tyrosinases are best known in catalysing synthesis of reactants
involved in early steps in the biosynthesis of melanin, a heteropolymer occurring widely in animals which serves
both as a pigment and to protect from ultraviolet light Mason, 1965. Laccases are found in insect integument
and catalyse the initial reactions leading to the synthesis of compounds that cross-link integument proteins to chi-
tin Sugumaran, 1988. This process is responsible for tanning the soft, newly synthesized cuticle which is ther-
eby converted into a hard and rigid structure.
Tyrosinase activity has been identified in arthropod haemolymph, and cDNAs encoding the enzyme have
been cloned from haemocytes of several insect and one crustacean species. Phylogenetic analysis has identified
the tyrosinase isolated from arthropod haemocytes as a distinct type Hall et al., 1995; Kawabata et al., 1995;
Fujimoto et al., 1995; Aspa´n et al., 1995; Jiang et al., 1997a,b; Park et al., 1997, which displays sequence
similarity to arthropod haemocyanins and is expressed as an inactive proenzyme Kawabata et al., 1995. The
term pro-phenoloxidase PPO or, following activation by proteolytic cleavage, phenoloxidase PO is com-
monly used to distinguish arthropod-specific tyrosinases, and this convention is followed here. PO is closely asso-
ciated with the arthropod immune system, and cleavage of PPO to yield PO occurs in response to microbial cell
wall products which activate PPO-specific proteases So¨derha¨ll and Hall, 1984; Ratcliffe and Rowley, 1987;
So¨derha¨ll and Smith, 1986; Ashida and Brey, 1997. A mechanism for PO-mediated clearance of microbial
infections has recently been proposed, in which quinones generated by PO activity cross-link bacteria to a protein
present on the haemocyte cytoplasmic membrane Marmaras et al., 1996.
We report here the analysis of Pimpla venom fractions containing L-DOPA-oxidizing activity. Genes encoding
the proteins in these fractions have been cloned and found to represent a new form of PO, with properties
that are strikingly different from those of all other arthro- pod POs which have been characterized to date.
2. Materials and methods
2.1. cDNA library construction Venom-producing glands from adult female P. hyp-
ochondriaca ,
cultured as
described previously
Parkinson and Weaver, 1999, were dissected from venom sacs and stored at 280
° C. Total RNA was pur-
ified by selective ethanol precipitation from guanidine thiocyanate using an RNA isolation kit Stratagene.
Polyadenylated RNA was selected using oligo[dT] coated magnetic beads Promega and converted to dou-
ble stranded cDNA which, after size fractionation, was ligated into the uni-ZAP vector Stratagene.
2.2. cDNA library screening and sequence analysis Reverse transcriptase–PCR was used to amplify a por-
tion of a putative PO gene from total RNA isolated from venom-producing tissue. Two primers were designed
from the conserved motifs HHWHWH 59-CAY- CAYTGGCAYTGGCA-39 and MGFYPFD 59-
RTCRAANGGRWANCCCAT-39, which are found in the copper A binding region and towards the COOH ter-
minus, respectively, of PPOs see Fig. 1. These primers were used to amplify a 1.3 kbp product, which was
cloned using a T-vector Promega. Partial sequence analysis of the PCR product confirmed its similarity to
known
PPOs. Following
radiolabelling with
[ α
-
32
P]dCTP the PCR product was used as a probe for cDNA library screening. Sequencing of both DNA
strands of selected cDNA clones was carried out by Sequiserve Vaterstetten, Germany. Multiple sequence
alignments were produced using ClustalWWW, a derivative of the ClustalW program Thompson et al.,
1994 located at the European Bioinformatics Institute Web pages http:www2.ebi.ac.ukclustalw. A phylo-
genetic tree was produced from a ‘guide tree’ generated by ClustalWWW, and displayed using TreeView
Page, 1996.
2.3. Northern hybridization For Northern hybridization the oligonucleotide 59-
TTCACTTCTTGGCTATTCCCCACGGGAGTGTTCT TGTGATT-39 was used as a probe. This sequence is
derived from one of the cDNAs POI cloned in this study and is the complement of the nucleotide sequence
encoding amino acid residues 51–64 NHK..., located towards the NH
2
-terminal region of POI Fig. 1. The sequence was selected on the basis that it would
hybridize specifically to POI transcripts. Approximately 4
µ g of total RNA determined by absorbance at 260 nm
was fractionated in a 1 agarose gel containing 17 formaldehyde and then transferred to a nylon membrane.
After hybridization in 5 ×
SSC, 5 ×
Denhardt’s solution at 45
° C for 16 h the membrane was washed three times at
increasing stringency final wash: 1 ×
SSC, 0.1 SDS for 15 min at 60
° C and exposed to X-ray film at 280
° C.
59 N. Parkinson et al. Insect Biochemistry and Molecular Biology 31 2001 57–63
Fig. 1. Deduced amino acid sequences of Pimpla POI, POII and POIII and alignment with Manduca PPO and Limulus haemocyanin. The PPO
sequences used in the alignment are listed in Fig. 2, though only the moth sequence M.S.PPO Hall et al., 1995 is shown. Residues highlighted with arrowheads are conserved in all PPO sequences and in Limulus haemocyanin L.P.Hcn but not in POs I–III. The RF residues indicated
by a single overline constitute the proteolytic cleavage site in insect PPOs. Conserved histidine-containing motifs involved in copper binding are underlined.
2.4. PO purification, NH
2
-terminal sequencing, PAGE analysis and determination of enzyme specific activity
Venom was size-fractionated as described previously Parkinson and Weaver, 1999. Fractions 17–20, which
contained maximum PO activity, were analysed by SDS–PAGE Laemmli, 1970 without the addition of
reducing agent and compared to the peptide profile from non-fractionated venom. These fractions were also used
for determination of the NH
2
-terminal PO sequence, by Edman degradation, as well as for determination of
enzyme specific activity. The latter was done spectro- photometrically using a wavelength of 492 nm with 15
mM L-DOPA as substrate in 10 mM cacodylate, 10 mM calcium chloride buffer pH 6.9.
3. Results
