Burkholderia sp. as Antifungal-Producing Bacteria to Suppress Ganoderma boninense in Oil Palm
Burkholderia sp. AS ANTIFUNGAL-PRODUCING BACTERIA
TO SUPPRESS Ganoderma boninense IN OIL PALM
RIKA FITHRI NURANI
GRADUATE SCHOOL
BOGOR AGRICULTURAL UNIVERSITY
BOGOR
2014
CERTIFICATE OF ORIGINALITY
I hereby declare that this Master thesis entitled Burkholderia sp. as
Antifungal-Producing Bacteria to Suppress Ganoderma boninense in Oil Palm is
the result of my own work under supervisor committee and has not been
submitted in any forms to any colleges. Sources of information derived or quoted
are from published and unpublished works of other authors which has been
mentioned in the text and listed in the reference chapter at the end of this thesis.
Bogor, August 2014
Rika Fithri Nurani
NIM G351120311
RINGKASAN
RIKA FITHRI NURANI. Burkholderia sp Sebagai Bakteri Penghasil Senyawa
Antifungi dalam Menekan Pertumbuhan Ganoderma boninense pada Kelapa
Sawit. Dibimbing oleh ARIS TRI WAHYUDI dan NURITA TORUANMATHIUS
Indonesia merupakan salah satu produsen minyak kelapa sawit di dunia,
sehingga kelapa sawit merupakan salah satu komoditas penting di Indonesia.
Indonesia menyediakan 46% minyak kelapa sawit di dunia dan permintaan akan
minyak kelapa sawit semakin lama semakin meningkat. Penyakit yang paling
banyak ditemukan di perkebunan kelapa sawit adalah busuk pangkal batang yang
disebabkan oleh G. boninense. Berbagai usaha telah dilakukan untuk mencegah
penyebaran penyakit ini, namun belum menunjukkan hasil yang optimum.
Burkholderia sp. yang diisolasi dari rizosfer dan dalam jaringan (endofit) yang
berasal dari tanaman kelapa sawit yang sehat menunjukkan potensi dalam
menekan pertumbuhan G. boninense secara in vitro. Burkholderia sp. telah
dilaporkan sebagai agen biokontrol karena kemampuannya dalam memproduksi
beberapa senyawa antifungi. Tujuan penelitian ini adalah untuk mengisolasi
Burkholderia sp indigenus yang berpotensi dalam menghambat pertumbuhan G.
boninense secara in vitro dan in vivo, dan profil komunitas bakteri di dalam
tanaman setelah diberikan perlakuan Burkholderia sp. dan G. boninense.
Lima isolat Burkholderia sp. rizosfer (B313, B51a, B52c, B51b, B52a) dan
satu isolat Burkholderia sp. endofit (B212) telah berhasil diisolasi dari
perkebunan kelapa sawit. Isolat Burkholderia sp. kemudian digunakan dalam uji
antagonis terhadap pertumbuhan G. boninense di dalam media PDA.
Burkholderia sp. dengan aktivitas antagonis yang tertinggi kemudian digunakan
untuk uji in vivo. Profil komunitas bakteri endofit setelah perlakuan Burkholderia
sp. dan G. boninense dianalisis dengan menggunakan DGGE (Denaturing
Gradient Gel Electrophoresis). Selanjutnya gen yang diduga terkait dengan
biosistesis senyawa antifungi dari Burkholderia sp. dikonfirmasi dengan
menggunakan primer spesifik pyrrolnitrin (prn), pyoluteorin (plt), phenazine
(phz), dan DAPG (phl).
Burkholderia sp. dengan kode B212 menunjukkan aktivitas hambat yang
paling tinggi yaitu dengan nilai PIRG 24,38%. Genom dari isolat B212 tersebut
menunjukkan hasil PCR dengan ukuran 790 bp menggunakan primer prn. Hasil
sekuens menunjukkan bahwa hasil PCR tersebut 99% identik dengan gen prnD
parsial dari B. cepacia strain ESR63. Hasil uji in vivo konsorsium B212 dan B52a
pada tanaman yang tidak diberikan infeksi G. boninense menunjukkan adanya
pertumbuhan tanaman yang lebih baik dibandingkan dengan kontrol. Namun,
konsorsium B212 dan B52a tidak menurunkan tingkat infeksi dari G.boninense
pada tanaman kelapa sawit. B212 juga cenderung menghambat pertumbuhan
tanaman yang diberikan infeksi G. boninense jika dibandingkan dengan kontrol.
Analisis DGGE menunjukkan bahwa tanaman yang diberikan Burkholderia sp.
memiliki profil komunitas bakteri endofit yang berbeda dengan yang tidak
diberikan dengan Burkholderia sp. Sedangkan pemberian G. boninense tidak
memberikan profil bakteri endofit yang berbeda dengan kontrol (yang tidak
diberikan G. boninense).
Burkholderia sp. memiliki potensi sebagai agen biokontrol untuk fungi
patogen seperti G. boninense, namun metode aplikasinya belum tepat. Aplikasi
Burkholderia sp dan G. boninense pada kelapa sawit secara bersamaan
memberikan hasil yang belum memuaskan. Metode aplikasi Burkholderia sp.
endofit sebagai biokontrol terhadap G. boninense perlu dioptimasi dan riset yang
lebih mendalam. Dari hasil DGGE menunjukkan bahwa introduksi bakteri dari
luar dapat mengubah komunitas bakteri yang ada di dalam jaringan tanaman.
Kata kunci : gen penyandi antibiotik, busuk pangkal batang, agen biokontrol,
bakteri endofit, aplikasi perendaman.
.
SUMMARY
RIKA FITHRI NURANI. Burkholderia sp. as Antifungal-Producing Bacteria to
Suppress Ganoderma boninense in Oil Palm. Supervised by ARIS TRI
WAHYUDI and NURITA TORUAN-MATHIUS.
Indonesia is one of the world palm oil producer, which make oil palm is
one of the most important comodity in Indonesia. Indonesia provide 46% of palm
oil in the world and the demand is increase continously. Though in fact, the land
for oil palm plantation has been limited. Basal Stem Rot (BSR) disease caused by
G. boninense is one of the most serious diseases in oil palm. Many attempts have
been done to prevent or reduce infection of this disease, but they have not
provided optimum results. Burkholderia sp. isolated from rhizosphere and root
tissue of symptomless oil palm showed potentials in suppressing G. boninense
growth in vitro. Burkholderia sp. has been reported as a biocontrol agent regards
to its ability to produce vary of antifungal compounds. The objective of this
research were to isolate the Burkholderia sp. potential to suppress G. boninense
growth in vitro and in vivo, and community profile of endophyte bacteria after
treated with Burkholderia sp. and G. boninense.
There were five isolates of rhizosphere Burkholderia sp. (B313, B51a,
B52c, B51b, B52a) and one endophyte Burkholderia sp. (B212) isolated from oil
palm plantation. The Burkholderia sp. isolates were used in antagonist test against
G. boninense growth on PDA media. Burkholderia sp. with the highest antagonist
activity were applied to oil palm germinated seed for in vivo test. Endophyte
bacteria community profile was analyzed by using Denaturing Gradient Gel
Electrophoresis (DGGE) after treated with Burkholderia sp. and G. boninense.
Then, antifungal biosynthesis related gene from Burkholderia sp. was confirmed
by using PCR with pyrrolnitrin (prn), pyoluteorin (plt), phenazine (phz), and
DAPG (phl) primers.
Endophyte Burkholderia B212 showed the highest antagonist activity
against G. boninense growth in vitro with PIRG 34.38%. B212 genome was yield
an expected PCR product by using prn primers (790-bp). Sequence BLAST result
showed the gene was 99% identical with B. cepacia partial prnD gene, strain
ESR63. In vivo test of B212 showed that treatment of Burkholderia B212 on plant
without G. boninense infection increased the height and biomass of the plant.
However, B212 did not decrease the disease severity on G. boninense infected
plant. In addition it suppressed the plant height and biomass compare to control
plant. DGGE analysis was show that community profile of bacteria endophyte on
plant treated with Burkholderia sp. was different with those in untreated plants.
However, endophyte bacteria community profile in plants applied with G.
boninense was similar with those in control plants (without G. boninense).
Burkholderia sp. has a potential as a biocontrol agent for pathogen such as
G. boninense. Application of Burkholderia sp. to oil palm seeds in the same time
with G. boninense application gave a unsatisfied results to the plant. Application
method of endophyte Burkholderia sp. as biocontrol agent for G. boninense still
need optimatization and further research. DGGE results showed that introduction
of bacteria into the plant will change the bacteria community profile that were
already exist in plants tissue. observation of Burkholderia and G. boninense
interaction in oil palm should be conduct longer.
Keywords: antibiotic-related gene, basal stem rot, biocontrol agent, endophyte
bacteria, dipping-seed
© Copy Right IPB, 2014
All Rights Reserved by Law
No part or all of this work may be reproduced without citing the source. Copying
may be done only on the basis of education, research, scientific writting, reports
or reviews; and which should not cause any prejudice to IPB.
No part or all of this work may be produced in any form or by any means without
permission from IPB .
Burkholderia sp. AS ANTIFUNGAL-PRODUCING BACTERIA
TO SUPPRESS Ganoderma boninense
IN OIL PALM
RIKA FITHRI NURANI
Thesis
submitted in partial fulfilments for the degree
Master Science
in
Microbiology Study Program
GRADUATE SCHOOL
BOGOR AGRICULTURAL UNIVERSITY
BOGOR
2014
External Examiner at Final Exam:
Dr Ir Giyanto, MSi
Title
Name
NIM
: Burkholderia sp. as Antifungal-Producing Bacteria to Suppress
Ganoderma boninense in Oil Palm
: Rika Fithri Nurani
: G351120311
Approved by
Supervising committee
Prof Dr Aris Tri Wahyudi, MS
Head
Dr Nurita Toruan-Mathius, MS
Member
Endorsed by
Head of Study Program
Microbiology
Dean of Graduate School
Prof Dr Anja Meryandini, MS
Dr Ir Dahrul Syah, MScAgr
Date of Examination:
28 August 2014
Date of Graduation:
PREFACE
I would like to express the deepest appreciation to my supervisor Prof. Dr.
Aris Tri Wahyudi for the guidance, suggestions and valuable comments
throughout the development of this thesis. I would like to thank my cosuppervisor, Dr. Nurita Toruan-Mathous for never ending support, guidance, and
encouragement throughout the whole process. My sincere thanks go to Dr. Tony
Liwang as Division Head of Plant Production and Biotechnology, PT. SMART
Tbk for the permission to continue my study and for the scholar.
I am grateful to my colleagues in IPB Aar, Randi, Nezha, Lekta, Ayun,
Dina, Anja, and Asril for their teamwork and companion and also the whole
Microbiology Laboratory staff. My sincere thanks also go to my fellow lab mates
in PT. SMART Tbk. ibu Elizabeth, Sinthya, Wisnu, Diessa, Dewi, Esti, Hany,
Zulfikar and whom I cannot mention one by one for their helps besides their
friendship.
Last but not least, I would like to thank my family, especially my father
Lalang Buana, my mother Tri Haryati, and my sisters Ratna dan Ririn for their
eternal love, encouragement, and support throughout my life. My special thanks
also go to Firman for the support and understanding.
Result of this work has been acccepted and reviewed by Asian Journal of
Agricultural Research.
Bogor, August 2014
Rika Fithri Nurani
CONTENTS
LIST OF TABLES
vi
LIST OF FIGURES
vi
LIST OF ATTACHMENTS
vi
INTRODUCTION
Background
Scientific Problem
Objective
Research Benefit
Research Scope
1
1
2
2
2
3
LITERATURE REVIEW
G. boninense in Oil Palm
Basal Stem Rot Disease
Endophyte Microbes
Potential Endophyte Bacteria
DGGE Analysis of Endophyte Community
3
3
4
4
5
6
METHOD
Research framework
Research Time and Place
Burkholderia sp. isolation
Antagonist in vitro test
In vivo test
Detection antifungal gene
7
7
8
8
8
8
10
RESULTS AND DISCUSSION
Results
Discussion
12
12
17
CONCLUSION AND SUGESTION
Conclusion
Sugestion
19
19
20
REFERENCES
20
ATTACHMENTS
24
LIST OF TABLES
1 The signs and symptoms of plants were scored on a disease scale 0-4
2 Treatments of Burkholderia sp and G. boninense on oil palm seedling,
3 Polymerase chain reaction primers and expected amplification products
from genes encoding enzymes involved in the biosynthesis of several
antibiotics.
4 Percentage of inhibition ratio from Burkholderia sp against G.
boninense growth in-vitro.
5 Disease severity index (DSI) of treated plant with G. boninense.
6 The effect of different progeny on root and leaf total number, lenght,
and dry weight after treatment with G. boninense and Burkholderia
sp.
7 The effect of dipping treatment of antagonistic bacteria on seedling of
oil palm inoculated with G. boninense in pre nursery at 3 months
after planting
4
9
11
13
13
14
14
LIST OF FIGURES
1 Research framework
2 In vitro test of Burkholderia sp. against G. boninense growth. R1 as the
control and R2 is the radial growth of G. boninense on trial.
3 Burkholderia sp. streaked on agar plate.
4 a. Plants treatment left to right (A-D). b. Healthy root with no
appearance of fungal mycellia (left). Appearance of fungal mycellia
(red arrow).
5 PCR amplification of 16S rRNA gene from oil palm roots after
3months.
6 DGGE band profile of endophyte bacteria treatment with Burkholderia
and G. boninense (left) and cluster analysis of endophyte bacterial in
oil palm root treated with Burkholderia sp and G. boninense with 1D
Pro Phoretrix software (right).
7 Phylogenetic tree of excised bands from DGGE.
8 PCR product of pyrrolnitrin and pyoluteorin gene amplification. M :
marker, 3. prn primer, 4. plt primer, a. B212, b. B313 , c. B51a , d.
B52c , e. B51b, f. B52a. Red arrows showed the expected band size.
9 Phylogenetic tree of PrnD gene from B212 and B51a.
7
12
12
13
15
15
16
16
17
LIST OF ATTACHMENTS
1 List of sequencing results from Burkholderia sp. isolate.
2 List of sequencing results from DGGE band slicing.
3 Sequencing result of PRND gene.
24
27
28
INTRODUCTION
Background
Oil palm is one of the most important agricultural export crops in Indonesia
besides rubber, cocoa, coffee, and spices (Stads et al. 2007). Basal stem rot
disease has been a serious threat to the oil palm industry in Indonesia because it
shortens the productive life of oil palms and causes serious economic loss. The
disease is caused by a white-rot fungi G. boninense and in the past few decades
has been spreading rapidly, for instance, in North Sumatra, Indonesia, this disease
can lead to losses as much as 50% after repeated planting cycles (25 years)
(Corley & Tinker 2003).
The use of fungicides for fungal control did not produce significant results
yet (Haas & Defago 2005). This may be due to the fact that by the time treatment
is applied, the palms may already have the disease. Antifungal-producing bacteria
is a promising biocontrol agent (BCA) to overcome this disease. BCA does not
necessarily be a cure for the disease but to slowing or even to stop the disease
spread by protect the plant or enhance the plant defense. Endophyte BCAs have
more value since it can live inside the plant tissue through the plants lifetime.
Endophyte bacteria is bacteria which live inside the plant tissues without
causing apparent harm or symptoms to the host (Munif et al. 2013). Endophyte as
the internal plant habitat provide several advantages as BCA. It will be less
competition with other microorganisms, sufficient supply with the nutrients, less
exposure to environmental stress factors, and better translocation of bacterial
metabolites throughout the host plant (Hallmann et al. 1997). Application of
endophyte Pseudomonas aeruginosa and B. cepacia could reduce BSR (Basal
Stem Rot) incidence up to 76% in 8 months oil palm seedling after pathogen
inoculation (Zaiton et al. 2008).
Endophyte bacteria live inside the plant and make their own community.
The community of endophytic bacteria is a dynamic habitat that influenced by
many factors such as climate change, plant tissues, soil type, and interaction with
other microorganisms. These factors may affect the structure and species
composition of the bacterial communities in plant tissues (Lacava et al. 2004;
Mocali et al. 2003). The communities of endophytic antagonist bacteria inside the
plant will be vary along with environment changes including the presence of
phytopathogen.
Members of the genus Burkholderia sp. are known for their ability to
suppress soil-borne fungal pathogens by the production of various antibiotic
compounds such as pyrrolnitrin and phenazines (Kirner et al. 1998). Other
different antibiotics such 2,4-diacetylphloroglucinol (2,4-DAPG) and pyoluteorin
has also been found responsible for suppression of soil-borne fungal pathogens
(Subagio & Foster 2003).
Antibiotic-related genes can be detected from BCAs by using Polymerase
Chain Reaction (PCR) by using antibiotic specific primers, which encode
phenazine-1-carboxylic acid, 2,4-DAPG, pyoluteorin, and pyrrolnitrin, from
Pseudomonas and Bacillus genome (Zhang et al. 2005).
2
BCAs have been applied in many ways and on many crops species, for
instance, seed dipping application on rice seeds to control bacterial blight disease
caused by Xanthomonas oryzae was able to reduce the disease incidence (Suryadi
et al. 2012). Besides microbial pathogen, BCA was also reported able to control
plant parasitic nematodes. Munif et al. (2013) was reported seed dipping
application on tomato seeds able to control Meloidogyne incognita penetration
and enhanced the plant growth. Oil palm germinated seeds dipping application
was also conducted by Dikin et al. (2003) to suppress Schizopyllum commune,
causal agents of brown germ and seed rot in oil palm.
Scientific Problem
1.
2.
3.
4.
5.
G. boninense is the most serious disease of field palms in Southeast Asia,
particularly Malaysia and Indonesia. Ganoderma BSR is now recognized as
a significant constraint to sustainable production in Asia, and development
of techniques for disease management has been highlighted as a key
research priority.
Chemical pesticides usage is consider to polution risk. We need a greener
alternative to control plant pathogen.
G. boninense growth can be supress by using biocontrol agent such as
bacteria.
Burkholderia exhibit a antibiotic compounds which responsible for
antifungal. Many research have reported about using microbes as a
biocontrol agent, but none showed a significant result in oil palm plantation.
Different climate and different land may give a different effect for
biocontrol agent. By using endophyte bacteria may minimize the
environmental factor.
Objective
The aim of this research in general is to gain endophyte biocontrol agent
potential in surpressing G. boninense growth in oil palm. Specific purposes of this
study are (1) to detect antifungi encoding gene from Burkholderia potential, thus
to gain information which antifungal compounds that play role in inhibiting G.
boninense growth, (2) to determine the effectiveness of endophytic Burkholderia
in suppressing G. boninense infection in-vivo and in vitro(3) to gain community
profile of endophyte bacteria in general and Burkholderia specifically among the
treatments with G. boninense as the plant pathogen.
Research Benefit
Achievement of the purpose of this study are expected to (1) obtain useful
information for the purpose of biocontrol agents development for pathogenic
fungi G. boninense, (2) endophytic Burkholderia as biocontrol agents to inhibit
infection of G. boninense in palm oil, and (3) confirmation of biocontrol agents in
interaction with G. boninense and to obtain bacterial community information after
the application of endophytic bacteria with biocontrol agents.
3
Research Scope
This research include isolation and genetic identification of Burkholderia
sp. from roots and soil taken from oil palm plantation. In vivo application of
Burkholderia sp. and G. boninense to oil palm seedling by using dipping
treatment. Plant growth measurement and infection scoring of oil palm after 3
months planting. Bacterial genome isolation from oil palm roots after treated with
Burkholderia sp. and G. boninense and bacterial community profile analysis by
using DGGE. Specific antifungal-related gene amplification by using PCR and
analyse the sequence by using gene bank (www.ncbi.nlm.nih.gov).
LITERATURE REVIEW
G. boninense in Oil Palm
The world‟s palm oil demand increased sharply in the past 5 years. In 2009,
global consumption for palm oil was 42 million tons, and in 2011 was 49.05
million tonnes, higher than rapeseed and soybean oil (Oil World 2012). The
greatest threat to sustainable oil palm production is Southeast Asia is from basal
stem rot disease caused by the white rot fungus G. boninense (Flood et al. 2000).
Most severe losses from BSR occur in Indonesia and Malaysia with lower
incidences being recorded in Africa, Papua New Guinea and Thailand (Idris et al.
2004). In North Sumatra, Indonesia, by the time of replanting (25 years) 40-50%
of palms are lost with the majority of standing palms showing disease symptoms.
The more serious palm losses due to G. boninense is occur in plantation where the
oil palm stumps were left in the ground after replanting (up to 25% occurred
within 7 years) (Subagio & Foster 2003).
Losses begin to have a financial effect once the disease affects more than
10% of the stand (Hasan & Turner 1998). On average there is a decline of the
yield of the fresh fruit bunch (FFB) of 0.16t/ha for every palm lost, and when the
stand had declined by 50% the average FFB yield reduction was 35% (Subagio &
Foster 2003). Plant improvement is required to overcome this problem.
The development of oil palm genotypes resistant to Ganoderma may
provide the ideal long-term solution to BSR. Many oil palm seed producer has
attempted to provide a G. boninense resistance oil palm through conventional
breeding and also through elite palm tissue culture. This attempt is consume a
long time until the seeds are established for commercial. For a short-term solution,
biocontrol agent such us microbes to protect the palm from G. boninense infection
can be use. The use of chemical fertilizer and pesticide is not environment
friendly which is not sustainable for they may cause several damages to
environment community. The use of biofertilizer and biopesticide has been done
extensively in many plantations, but the result is not yet optimal.
4
Basal Stem Rot Disease
Basal stem rot disease (BSR) caused by G. boninense is currently the major
disease in oil palm plantations (Darmono 1998). Typically the fungus may attack
an already weakened oil palm as G. boninense is seldom infects healthy trees
seriously (Paterson 2007). Wong et al. (2012) mentioned that infection mainly
occur in palms aging 30 years and above. The infections in younger palms of 1015 years become more apparent, followed by spreading of the disease in oil palms
at nursery stage.
G. boninense is a white rot fungus. The term „„white rot‟‟ derives from the
fungus degrading specifically the lignin component of wood while leaving white
cellulose exposed (Paterson 2007). Lignin biodegradation is probably a major part
of the disease process. Lignin protects the more amenable cellulose and
hemicelluloses from enzymatic attack by forming direct chemical bonds. White
rot fungi such as G. boninense, are an organism that has the capability of
degrading lignin into carbon dioxide and water, then celluloses is available as
nutrients for the fungus.
The earliest external symptoms of BSR of oil palms occur in the foliage. In
young palms, external symptoms of BSR comprise a yellowing or mottling of the
lower fronds, followed by necrosis. Young unfolded leaves become chlorotic and
may be reduced in length, sometimes with necrotic tips (Corley & Tinker 2003).
As the disease progresses, palms may take on a pale appearance, with retarded
growth and spear leaves remaining unopened. Similar symptoms are observed in
mature palms, with multiple unopened spear leaves and a generally pale leaf
canopy. Ultimately, affected palms may died, the necrosis beginning with the
oldest fronds and extending to younger regions of the crown. Palms normally die
within 6 to 12 months after the appearance of unexpanded spear leaves. The
infection of G. boninense on plant can be scored by using disease severity index
(DSI) showed in Table 1. (Abdullah et al. 2003).
Table 1 Score and disease scale of G. boninense infection in oil palm
Disease
class
0
1
2
3
4
Sign and symptom infection
Healthy plants with green leaves without appearance of fungal
mycelium on any part of plants
Appearance of white fungal mass on any part of plants, with or
without chlorotic leaves
Appearance of basidioma on any part of plants with chlorotic leaves
(1-3 leaves)
Formation of basidioma on any part of plants with chlorotic leaves
(> 3 leaves)
Formation of well-developed basidioma and the plants dried
Endophyte Microbes
Microbes have been reported as a potential biopesticide for its ability in
producing antifungal compound. Microbes niche naturally inside and outside of
5
almost every part of biotic and abiotic. Microbes which lived inside the plant
tissue is called endophyte. The usage of this term is equally for variable strategies
of symbiosis, ranging from facultatively saprobic to parasitic to exploitive to
mutualistic. It is because if taken literally, it can include all pathogen at some
stage of their development, since the plant host responds to at least some infection
with mechanical defence reactions (Narisawa et al. 2004).
Petrini et al. (1991) add another characterisation of endophytic interactions
as not "causing apparent harm", which presumably refers to an absence of
macroscopically visible symptoms. Aware of the determinative discrepancies, the
term of endophyte here to describe is those bacteria that can be detected at a
particular moment within the tissues of apparently healthy plant hosts. Particular
moment is added in term of endophyte because of the associated habitat is
dynamic along with environment changes, including the presence of pathogen
fungi.
As its ability to live inside the plant, endophytic bacteria can be utilized as
sustainable biocontrol. Introducing endophytic potential bacteria into plant tissue
has been widely applied by dipping the seeds or roots of plant in bacterial culture
concentrate. This treatment will increased the number of endophytic bacteria
inside the plant, but will not stay stable in a long time. Krechel et al. (2002)
reported that after treatment, in the first 3 weeks after seedling the density of
endophytic microbe will increased up to 105 cfu.g-1, and this number will stay
constant through plant growth periode. Plants has its own mechanism to tolerate
some number of endophyte living inside, and able to stabilize the number through
competition.
The population of endophytic itself is not spread evenly in all parts of the
plant. Hallman et al. (1997) reported that the population densities of indigenous
endophytic bacteria in roots are found about 105 cfu.g-1 fresh root weight. This is
higher than any other plant organ with average densities of 104 cfu.g-1 and 103
cfu.g-1 fresh weight in stem and leaves respectively.
Potential Endophyte Bacteria
Endophyte bacteria living inside the plant and bring an advantages to the
plant host. It has a direct and indirect role in plant growth and plant defence
system. Some bacteria exhibit a broad range of antifungal compound, and some
regulate plant growth hormone. Schimidt et al. (2009) reported that antibiotic
compounds produced by Burkholderia sp. are lipopeptides, cepaciamides A and
B, cepacidines, siderophores, altericidin, pyrrolnitrin, glidobactins, phenazines
and 2-hydroxymethyl-chroman-4-one. Antibiosis has been widely studied as one
of the most important biocontrol mechanisms inhibiting plant pathogens.
Different antibiotics have been found to be responsible for this inhibition,
including 2,4-diacetylphloroglucinol (2,4-DAPG), pyoluteorin, zwittermicin A,
and kanosamine (Zhang et al. 2006). Pyrrolnitrin [Prn; 3-chloro-4(2'-nitro-3'chlorophenyl)-pyrrole] has been correlated with biocontrol activity of fungal plant
pathogens (Homma et al. 1989). The biosynthetic genes for phenazine, 2,4DAPG, pyrrolnitrin, and pyoluteorin self-resistance gene have been sequenced.
Availability of these sequences has enabled for primers design based on conserved
6
regions for polymerase chain reaction (PCR) detection of antibiotic producing
bacteria.
DGGE Analysis of Endophyte Community
Arau´jo et al. (2002) worked on diversity of endophytic bacterial population
in healthy, resistant, and Citrus Variegated Chlorosis (CVC)-affected citrus plants.
He was using cultivation and cultivation-independent techniques to assess the
endophytic communities. His work showed that the diversity of endophytic
bacterial population in each treatment were different. The result showed there
were some specific bands that only appeared in asymptomatic plants. Also from
the cultivation observed, some isolates were found significantly more frequent
from asymptomatic plants than the other treatment. This came to a suggestion that
this organism has a role in the resistancy of plants to CVC. His research proved
that community of endophytic bacteria is influence by environment.
Bacterial community can be observed by using several methods, common
method that is used are DGGE (Denaturing Gradient Gel Electrophoresis), TRFLP (Terminal- Restriction Fragment Lenght Polymorphism), and SSCP (Single
Strand Conformation Polymorphism). Smalla et al. (2007), compared DGGE, TRFLP, and SSCP for assessing bacterial diversity in soil. The result showed
although the fragments amplified comprised different variable regions and
lengths, DGGE, T-RFLP and SSCP analyses led to similar findings. The
clustering of fingerprints which correlated with soil physico-chemical properties is
similar. Also the variability between the four replicates of the same soil is small.
The results showed that the 3 method is stable and show similar result. DGGE is
used in this research to assess the diversity of bacterial after introduced with
endophytic bacteria biocontrol potential and planted in treated soil.
DGGE is a molecular fingerprinting method that separates polymerase chain
reaction (PCR)-generated DNA products. However, since PCR products from a
given reaction are of similar size (bp), conventional separation by agarose gel
electrophoresis results only in a single DNA band that is non-descriptive. DGGE
can overcome this limitation by separating PCR products based on sequence
differences that results in differential denaturing characteristics of the DNA.
During DGGE, PCR products encounter increasingly higher concentrations of
chemical denaturant as they migrate through a polyacrylamide gel.
Upon reaching a threshold denaturant concentration, the weaker melting
domains of the double-stranded PCR product will begin to denature at which time
migration slows dramatically. Differing sequences of DNA (from different
bacteria) will denature at different denaturant concentrations resulting in a pattern
of bands. Each band theoretically representing a different bacterial population
present in the community. Once generated, fingerprints can be uploaded into
databases in which fingerprint similarity can be assessed to determine microbial
structural differences between environments or among treatments.
7
METHOD
Research framework
The experiment was divided into four steps as shown in Fig. 1. The research
activity was consist of bacterial isolation, antagonist in vitro test and in vivo test
of Burkholderia against G. boninense growth, and detection of antifungal gene.
Burkholderia sp. isolation (1)
Endophyte
Burkholderia sp.
Burkholderia sp.
isolates (1)
Rhizosphere
Burkholderia sp.
Detection of antifungal gene (4)
Antagonist in vitro test (2)
Antifungal partial
gene
Antagonist
Burkholderia sp. (2)
In vivo test (3)
Sequencing
DGGE
Bioinformatic
analysis
Endophyte
bacteria
sequences (3)
Phylogenetic tree of
antifungal genes (4)
Plant growth
observation
Disease severity
index (3)
Plant growth (3)
Fig. 1 Research framework
Infection
scoring
8
Research Time and Place
This research was start from June 2013 and finish on February 2014.
Laboratory activity was took place in laboratory of Microbiology, Biology
Departement, IPB, Bogor and laboratory of Microbiome Technology, PT.
SMART Tbk, Sentul, Bogor.
Burkholderia sp. isolation
Burkholderia sp. were isolated from soil near the roots and the roots that
were taken from a healhty (symtompless) oil palm tree in an endemic area, in
North Sumatera, Indonesia. A gram of soil was dilluted in steriled water and
poured on Nutrient Agar plates. For the roots, were surface sterilized with 90%
alcohol for 1 min, 70% alcohol for 3 min, and washed twice with 50mL sterile
distilled water for 30 sec. The roots were crushed aseptically and put on NA in
plate. The plate were incubated for 24-36 hours. Each of the grown colony were
subculture and genome extracted for identification. Purified PCR product of 16s
DNA were sent to 1st Base, Singapore.
Antagonist in vitro test
Antagonist test was observed to determine the percentage inhibition of
radial growth (PIRG) of G. boninense (Bivi et al. 2010). Six bacterial isolates of
Burkholderia sp. were selected to evaluate their efficacy in enhancing growth and
inhibit the infection of BSR in oil palm in pre nursery. There were five
rhizosphere Burkholderia sp. (B313, B51a, B52c, B51b, B52a) and one endophyte
Burkholderia sp. (B212).
Burkholderia sp. was streaked into the PDA plate 2.5 cm from the edge of
the Petri dish. Agar disc cut diameter 5 mm of 5-day old G. boninense was placed
2.5 cm from the edge at the opposite side of the same Petri dish. For the control
plate, only G. boninense was placed in a similar manner without bacteria on a
fresh Petri dish. The plates were incubated at 28oC for five days.
Results shown by measured the radial growth of G. boninense. PIRG was
measured using the equation below (Zaiton et al. 2006):
PIRG : percentage inhibition of radial growth; R1 : radial growth of G.
boninense in the absence of bacteria (control); R2 : radial growth of G. boninense
in the presence of Burkholderia sp. The three highest PIRG isolates from in vitro
test were used for in vivo test.
In vivo test
Burkholderia sp. suspensions were prepared by inoculating 24 h-old
cultures into Nutrient Broth (NB) and incubated for 20 hr and adjusted to 108 cfu.
mL-1. During the preparation of mixture, equal volume of the three highest PIRG
Burkholderia sp. were mixed. G. boninense inoculum was prepared on 6 x 3 x 15
9
cm sterilized oil palm fronds. The fronds were sterlized in a heat resistant plastic
each before inoculated with G. boninense. After sterlized, the fronds were
inoculated with a 0.5 cm diameter disc of G. boninense mycellia on agar plate.
The plastic was sealed and incubated in room temperature for 3 months before
used.
The plant material was Tenera oil palm and provided by PT. SMART Tbk.
The plant material was selected as the most G. boninense susceptible progeny.
Two different progenies were used in this research. Briefly, oil palm germinated
seeds were treated with bacterial suspension (108 cfu. mL-1), dipped for 20 min
(seed bacterization) and air dried for 10 min before planted.
Oil palm germinated seeds were planted in polybags (15 cm x 20 cm)
regarding to the Standard Operation Prosedure (SOP) in prenursery of oil palm
plantation. There were four treatments in this research as shown in Table 2.
Treatment A and C were not inoculated with G. boninense and treatments C and D
were inoculated with G. boninense. Treatment B and C were using seedling
treated with Burkholderia sp. Treatments with G. boninense, the seedlings were
placed in contact with radicula. The pots were placed under shead, watered daily
and no supplementary organic fertilizer was applied for 3 months (prenursery). A
destructive observation was conducted after 3 months.
Table 2 Treatments of Burkholderia sp and G. boninense on oil palm seedling,
Treatment
A (control)
B (control Burkholderia sp.)
C (antagonist test)
D (control G. boninense)
Burkholderia
+
+
-
G. boninense
+
+
Infection scoring
The infection of G. boninense on plant can be scored by observation on
signs and symptom on the treatment plants using disease severity index (DSI) as
in Abdullah et al. (2003). DSI was observed from the external symtomp from
foliar and the roots (destructive method).
The score can be calculated by the formula of Nur Ain Izzati and Abdullah (2008)
as below in percentage :
where:
A : disease class (0, 1, 2, 3 or 4)
B : number of plants showing that disease class per treatment
The treatment was repeated into 13 replicates. This research used factorial
design with one factor and the environmental design is Complete Randomized
Design. Statistic analysis was done by using general method linear model
univariate. If there was a significant diferrences, further analysis will be analyzed
with α value is 5% by using SAS.
10
Bacterial genome isolation
The roots (1g) which already surface sterilized, were placed in a mortar
and grinded into fine powder by using liquid nitrogen. Bacterial genome were
islated by using PowerPlant DNA isolation kit (MoBio). Then visualized the total
DNA by electrophoresis on a 1% (wt/vol) agarose gel with 100 volt, 30 min.
PCR-DGGE Analysis and Sequencing
The PCR mixture is prepared by 1 μl of extracted DNA, 2.5 μl of 10x
Dream Taq buffer, 1 μl 25 nmole of each primer (16sRNA), 0.4 μl of 2mM
deoxynucleoside triphosphate (dNTP), 0.12 μl of Dream Taq DNA polymerase
(5u/ μl), in a 25 μl final volume. A negative control (PCR mixture without DNA)
included in all PCR experiments.
The diversity of the endophytic bacterial communities is studied by the
DGGE method. PCR products obtained from 16S rDNAs with the 357F (5´-CGC
CCG CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG GCC CTA
CGG GAG GCA GCAG-3´) and 518R (5´-ATTACCGCGGCTGCTGG-3´)
primers developed by Muyzer et al. (1993). The DGGE-PCR was carried out with
the temperature profile as follows-an initial denaturation step of 3 min at 95oC,
followed by 35 cycles of 94oC for 1 min, 55oC annealing for 30 sec, 72oC pprimer
extention for 1 min and a final step was carried out 72oC for 7 min. PCR product
was analyzed by electrophoresis in a 1% (wt/vol) agarose gel with 0.5 x TAE
buffer and stored at 20°C for DGGE analysis.
DGGE was performed on PCR products obtained as above using the DCode universal mutation detection system as per the manufacturer's instructions
(Bio-Rad, USA). PCR samples were loaded into 8% (wt/vol) polyacrylamide gels
in 1 x TAE buffer (20 mM Tris-acetate, 0.5 mM EDTA, pH 7.4). The
polyacrylamide gels were made with denaturing gradients ranging from 30 to 70%
(where the 100% denaturant contained 7 M urea and 40% formamide). The gels
were run for 6 h at 150 V and 60°C, after which the gels were soaked for 1 h in
SYBR Green I nucleic acid stain (1:10,000 dilution; Molecular Probes, Leiden,
The Netherlands) and immediately photographed under UV light.
Prominent bands are excised from the gels, reamplified, and subjected to
DGGE as previously described. The new PCR products were purified with
GenJET PCR purification kit (Thermo Scientific). Analyses of sequences are
performed with the basic sequence alignment (BLAST) program run against the
BLAST database (National Center for Biotechnology Information website
[http://www.ncbi.nlm.nih.gov]).
Detection antifungal gene
The DNA isolation was carried out by using GeneJET Genome DNA
Purification Kit from Thermo Scientific. Burkholderia sp. was prepared in 10 mL
liquid medium and the cells were collected after incubated for 18 hr in 37oC.
Specific primers for DAPG (Phl2a-Phl2b), phenazine (PHZ1-PHZ2),
pyrrolnitrin (PRND1-PRND2) and pyoluteorin (PLTC1-PLTC2) were used for
detection according to Zhang et al. (2005)(Table 3).
11
Table 3 Polymerase chain reaction primers and expected amplification products
from genes encoding enzymes involved in the biosynthesis of several
antibiotics.
Primer
Phl2a
Phl2b
PHZ1
PHZ2
PRND1
PRND2
PLTC1
PLTC2
Antibiotic
2,4-DAPG
Phenazine
Pyrrolnitrin
Pyoluteorin
Sequence
GAGGACGTCGAAGACCACCA
ACCGCAGCATCGTGTATGAG
GGCCAGATGGTCAACGG
CGGCTGGCGGCGTATAT
GGGGCGGGCCGTGGTGATGGA
YCCCGCSGCCTGYCTGGTCTG
AACAGATCGCCCCGGTACAGAACG
AGGCCCGGACACTCAAGAAACTCG
Sequence
size (bp)
745
1400
790
438
Amplification of target gene was using master PCR mixed 1 μl of template
DNA, 2.5 μl of 10x Dream Taq buffer, 1 μl 25 nmole of each primer (16sRNA),
0.4 μl of 2mM deoxynucleoside triphosphate (dNTP), 0.12 μl of Dream Taq DNA
polymerase (5u/ μl), in a 25 μl final volume. The PCR reaction for DAPG and
pyrrolnitrin primers was the same, it was 30 cycle with PCR condition
predenaturation (94oC, 2 min), denaturation (94oC, 1 min), annealing (62oC, 45
sec), elongation (72oC, 1 min), and post PCR (72oC, 2 min). PCR reaction for
phenazine primers was 30 cycle with PCR condition predenaturation (94oC, 1.5
min), denaturation (94oC, 45 sec), annealing (58oC, 45 sec), elongation (72oC,
1.75 min), and post PCR (72oC, 1 min). PCR reaction for pyoluteorin primers
was amplified 35 cycle with PCR condition predenaturation (94 OC, 5 min),
denaturation (94 OC,1 min), annealing (50 oC, 1 min), elongation (72 oC, 1 min),
and post PCR (72 oC, 10 min).
PCR product visualization is conducted by elecphoresis in 2 % agarose
(w/v) with voltation 90 volt in 30 min. PCR product was gel extracted from
agarose by using Gene JET Gel Extraction Kit (Fermentas), according to
manufacturer's instruction. After purification, the PCR products were sent to 1st
Base, Singapore, to be sequenced. The antifungal genes sequences were aligned
by using BioEdit software and searched for sequence similarity to other sequences
which are available in the NCBI database at http://www.ncbi.nih.gov using Basic
Local Alignment Search Tool (BLAST) algorithm. Multiple sequence alignments
were performed on the selected closely related sequence accessions available
using CLUSTAL W software in Mega 5.
12
RESULTS AND DISCUSSION
Results
Burkholderia sp. isolation
Bacterial isolation from root and soils were found five isolates of
rhizosphere Burkholderia sp. and one isolate of endophyte Burkholderia sp. The
isolates were rod shape and Gram negative cell on 1000x magnification under
microscope. The colony was yellowish translucent on Nurtient agar (NA) media
(Fig. 2).
Fig. 2 Burkholderia sp. growth on nutrient agar (NA) plate.
Antagonist in vitro test
All of the Burkholderia sp. isolates showed an inhibition activity against G.
boninense growth in vitro. Burkholderia B212 showed the highest inhibition on
G. boninense growth in vitro (Fig. 3).
Fig. 3 In vitro test of Burkholderia sp. against G. boninense growth. R1 as the
control and R2 is the radial growth of G. boninense on trial with
Burkholderia B212.
PIRG scores of Burkholderia sp. on G. boninense growth shown on Table 4.
The score followed by the same letter indicated that they were insignificantly
different scores. The highest inhibition activity was shown by isolate B212 with
%PIRG was 34.38%, but not significantly different with B52a and B52c which
were both 27.50%. Burkholderia B313 showed the lowest activity (23.75%) and
13
significantly different with B212, but still has an antagonist activity against G.
boninense growth in vitro.
Table 4 Percentage of inhibition ratio from Burkholderia sp against G. boninense
growth in-vitro.
Isolates
B212
B52a
B51a
B52c
B251a
B313
PIRG (%)
34.38a
27.50ab
25.00b
27.50ab
25.63b
23.75b
In vivo test
The necrosis and chlorosis foliar was not seen in all treatments, though the
height of the plants between treatment was seem different (Fig. 4a). DSI after 3
months only showed in treatment C and D (25%) (Table 5). Destructive
observation showed that all plants in treatment C and D were infected with G.
boninense. Treatment C and D, which were inoculated with G. boninense, showed
a brown-blackening roots especially on the parts which colonized with the G.
boninense (Fig. 4b). The roots in treatment A and C, without G. boninense were
cream-brown colored.
Table 5 Disease severity index (DSI) of treated plant with G. boninense.
Treatments
Un-inoculated seed (A)
Un-inoculated seed + Burkholderia consortia (B)
Inoculated seed + Burkholderia consortia (C)
Inoculated seed (D)
a
DSI (%)
0b
0b
25a
25a
b
Fig. 4a. Plants treatment left to right (A: control, B: control Burkholderia sp., C:
antagonist test, D: control G. boninense). b. Healthy root with no
appearance of fungal mycellia (left). Appearance of fungal mycellia (red
arrow).
14
Progeny give a significant different mostly to the shoot lenght and dry
weight (Table 6). Total number of roots between progeny also showed a
significant difference. However, there is no interaction between progenies and
treatments though in some parameter that were observed was showed a significant
difference.
Table 6 The effect of different progeny on root and leaf total number, lenght, and
dry weight after treatment with G. boninense and Burkholderia sp.
Lenght (cm)
Dry weight (g)
Total number of
shoot
Root
shoot
Root
Shoot
Root
a*
a
a
a
a
1
24.794
28.304
1.162
0.989
5.130
4.413a
2
22.789b
29.145a
1.011b
0.916a
4.872a
3.829b
* Means within a column with the same letter are not significantly different at
p
TO SUPPRESS Ganoderma boninense IN OIL PALM
RIKA FITHRI NURANI
GRADUATE SCHOOL
BOGOR AGRICULTURAL UNIVERSITY
BOGOR
2014
CERTIFICATE OF ORIGINALITY
I hereby declare that this Master thesis entitled Burkholderia sp. as
Antifungal-Producing Bacteria to Suppress Ganoderma boninense in Oil Palm is
the result of my own work under supervisor committee and has not been
submitted in any forms to any colleges. Sources of information derived or quoted
are from published and unpublished works of other authors which has been
mentioned in the text and listed in the reference chapter at the end of this thesis.
Bogor, August 2014
Rika Fithri Nurani
NIM G351120311
RINGKASAN
RIKA FITHRI NURANI. Burkholderia sp Sebagai Bakteri Penghasil Senyawa
Antifungi dalam Menekan Pertumbuhan Ganoderma boninense pada Kelapa
Sawit. Dibimbing oleh ARIS TRI WAHYUDI dan NURITA TORUANMATHIUS
Indonesia merupakan salah satu produsen minyak kelapa sawit di dunia,
sehingga kelapa sawit merupakan salah satu komoditas penting di Indonesia.
Indonesia menyediakan 46% minyak kelapa sawit di dunia dan permintaan akan
minyak kelapa sawit semakin lama semakin meningkat. Penyakit yang paling
banyak ditemukan di perkebunan kelapa sawit adalah busuk pangkal batang yang
disebabkan oleh G. boninense. Berbagai usaha telah dilakukan untuk mencegah
penyebaran penyakit ini, namun belum menunjukkan hasil yang optimum.
Burkholderia sp. yang diisolasi dari rizosfer dan dalam jaringan (endofit) yang
berasal dari tanaman kelapa sawit yang sehat menunjukkan potensi dalam
menekan pertumbuhan G. boninense secara in vitro. Burkholderia sp. telah
dilaporkan sebagai agen biokontrol karena kemampuannya dalam memproduksi
beberapa senyawa antifungi. Tujuan penelitian ini adalah untuk mengisolasi
Burkholderia sp indigenus yang berpotensi dalam menghambat pertumbuhan G.
boninense secara in vitro dan in vivo, dan profil komunitas bakteri di dalam
tanaman setelah diberikan perlakuan Burkholderia sp. dan G. boninense.
Lima isolat Burkholderia sp. rizosfer (B313, B51a, B52c, B51b, B52a) dan
satu isolat Burkholderia sp. endofit (B212) telah berhasil diisolasi dari
perkebunan kelapa sawit. Isolat Burkholderia sp. kemudian digunakan dalam uji
antagonis terhadap pertumbuhan G. boninense di dalam media PDA.
Burkholderia sp. dengan aktivitas antagonis yang tertinggi kemudian digunakan
untuk uji in vivo. Profil komunitas bakteri endofit setelah perlakuan Burkholderia
sp. dan G. boninense dianalisis dengan menggunakan DGGE (Denaturing
Gradient Gel Electrophoresis). Selanjutnya gen yang diduga terkait dengan
biosistesis senyawa antifungi dari Burkholderia sp. dikonfirmasi dengan
menggunakan primer spesifik pyrrolnitrin (prn), pyoluteorin (plt), phenazine
(phz), dan DAPG (phl).
Burkholderia sp. dengan kode B212 menunjukkan aktivitas hambat yang
paling tinggi yaitu dengan nilai PIRG 24,38%. Genom dari isolat B212 tersebut
menunjukkan hasil PCR dengan ukuran 790 bp menggunakan primer prn. Hasil
sekuens menunjukkan bahwa hasil PCR tersebut 99% identik dengan gen prnD
parsial dari B. cepacia strain ESR63. Hasil uji in vivo konsorsium B212 dan B52a
pada tanaman yang tidak diberikan infeksi G. boninense menunjukkan adanya
pertumbuhan tanaman yang lebih baik dibandingkan dengan kontrol. Namun,
konsorsium B212 dan B52a tidak menurunkan tingkat infeksi dari G.boninense
pada tanaman kelapa sawit. B212 juga cenderung menghambat pertumbuhan
tanaman yang diberikan infeksi G. boninense jika dibandingkan dengan kontrol.
Analisis DGGE menunjukkan bahwa tanaman yang diberikan Burkholderia sp.
memiliki profil komunitas bakteri endofit yang berbeda dengan yang tidak
diberikan dengan Burkholderia sp. Sedangkan pemberian G. boninense tidak
memberikan profil bakteri endofit yang berbeda dengan kontrol (yang tidak
diberikan G. boninense).
Burkholderia sp. memiliki potensi sebagai agen biokontrol untuk fungi
patogen seperti G. boninense, namun metode aplikasinya belum tepat. Aplikasi
Burkholderia sp dan G. boninense pada kelapa sawit secara bersamaan
memberikan hasil yang belum memuaskan. Metode aplikasi Burkholderia sp.
endofit sebagai biokontrol terhadap G. boninense perlu dioptimasi dan riset yang
lebih mendalam. Dari hasil DGGE menunjukkan bahwa introduksi bakteri dari
luar dapat mengubah komunitas bakteri yang ada di dalam jaringan tanaman.
Kata kunci : gen penyandi antibiotik, busuk pangkal batang, agen biokontrol,
bakteri endofit, aplikasi perendaman.
.
SUMMARY
RIKA FITHRI NURANI. Burkholderia sp. as Antifungal-Producing Bacteria to
Suppress Ganoderma boninense in Oil Palm. Supervised by ARIS TRI
WAHYUDI and NURITA TORUAN-MATHIUS.
Indonesia is one of the world palm oil producer, which make oil palm is
one of the most important comodity in Indonesia. Indonesia provide 46% of palm
oil in the world and the demand is increase continously. Though in fact, the land
for oil palm plantation has been limited. Basal Stem Rot (BSR) disease caused by
G. boninense is one of the most serious diseases in oil palm. Many attempts have
been done to prevent or reduce infection of this disease, but they have not
provided optimum results. Burkholderia sp. isolated from rhizosphere and root
tissue of symptomless oil palm showed potentials in suppressing G. boninense
growth in vitro. Burkholderia sp. has been reported as a biocontrol agent regards
to its ability to produce vary of antifungal compounds. The objective of this
research were to isolate the Burkholderia sp. potential to suppress G. boninense
growth in vitro and in vivo, and community profile of endophyte bacteria after
treated with Burkholderia sp. and G. boninense.
There were five isolates of rhizosphere Burkholderia sp. (B313, B51a,
B52c, B51b, B52a) and one endophyte Burkholderia sp. (B212) isolated from oil
palm plantation. The Burkholderia sp. isolates were used in antagonist test against
G. boninense growth on PDA media. Burkholderia sp. with the highest antagonist
activity were applied to oil palm germinated seed for in vivo test. Endophyte
bacteria community profile was analyzed by using Denaturing Gradient Gel
Electrophoresis (DGGE) after treated with Burkholderia sp. and G. boninense.
Then, antifungal biosynthesis related gene from Burkholderia sp. was confirmed
by using PCR with pyrrolnitrin (prn), pyoluteorin (plt), phenazine (phz), and
DAPG (phl) primers.
Endophyte Burkholderia B212 showed the highest antagonist activity
against G. boninense growth in vitro with PIRG 34.38%. B212 genome was yield
an expected PCR product by using prn primers (790-bp). Sequence BLAST result
showed the gene was 99% identical with B. cepacia partial prnD gene, strain
ESR63. In vivo test of B212 showed that treatment of Burkholderia B212 on plant
without G. boninense infection increased the height and biomass of the plant.
However, B212 did not decrease the disease severity on G. boninense infected
plant. In addition it suppressed the plant height and biomass compare to control
plant. DGGE analysis was show that community profile of bacteria endophyte on
plant treated with Burkholderia sp. was different with those in untreated plants.
However, endophyte bacteria community profile in plants applied with G.
boninense was similar with those in control plants (without G. boninense).
Burkholderia sp. has a potential as a biocontrol agent for pathogen such as
G. boninense. Application of Burkholderia sp. to oil palm seeds in the same time
with G. boninense application gave a unsatisfied results to the plant. Application
method of endophyte Burkholderia sp. as biocontrol agent for G. boninense still
need optimatization and further research. DGGE results showed that introduction
of bacteria into the plant will change the bacteria community profile that were
already exist in plants tissue. observation of Burkholderia and G. boninense
interaction in oil palm should be conduct longer.
Keywords: antibiotic-related gene, basal stem rot, biocontrol agent, endophyte
bacteria, dipping-seed
© Copy Right IPB, 2014
All Rights Reserved by Law
No part or all of this work may be reproduced without citing the source. Copying
may be done only on the basis of education, research, scientific writting, reports
or reviews; and which should not cause any prejudice to IPB.
No part or all of this work may be produced in any form or by any means without
permission from IPB .
Burkholderia sp. AS ANTIFUNGAL-PRODUCING BACTERIA
TO SUPPRESS Ganoderma boninense
IN OIL PALM
RIKA FITHRI NURANI
Thesis
submitted in partial fulfilments for the degree
Master Science
in
Microbiology Study Program
GRADUATE SCHOOL
BOGOR AGRICULTURAL UNIVERSITY
BOGOR
2014
External Examiner at Final Exam:
Dr Ir Giyanto, MSi
Title
Name
NIM
: Burkholderia sp. as Antifungal-Producing Bacteria to Suppress
Ganoderma boninense in Oil Palm
: Rika Fithri Nurani
: G351120311
Approved by
Supervising committee
Prof Dr Aris Tri Wahyudi, MS
Head
Dr Nurita Toruan-Mathius, MS
Member
Endorsed by
Head of Study Program
Microbiology
Dean of Graduate School
Prof Dr Anja Meryandini, MS
Dr Ir Dahrul Syah, MScAgr
Date of Examination:
28 August 2014
Date of Graduation:
PREFACE
I would like to express the deepest appreciation to my supervisor Prof. Dr.
Aris Tri Wahyudi for the guidance, suggestions and valuable comments
throughout the development of this thesis. I would like to thank my cosuppervisor, Dr. Nurita Toruan-Mathous for never ending support, guidance, and
encouragement throughout the whole process. My sincere thanks go to Dr. Tony
Liwang as Division Head of Plant Production and Biotechnology, PT. SMART
Tbk for the permission to continue my study and for the scholar.
I am grateful to my colleagues in IPB Aar, Randi, Nezha, Lekta, Ayun,
Dina, Anja, and Asril for their teamwork and companion and also the whole
Microbiology Laboratory staff. My sincere thanks also go to my fellow lab mates
in PT. SMART Tbk. ibu Elizabeth, Sinthya, Wisnu, Diessa, Dewi, Esti, Hany,
Zulfikar and whom I cannot mention one by one for their helps besides their
friendship.
Last but not least, I would like to thank my family, especially my father
Lalang Buana, my mother Tri Haryati, and my sisters Ratna dan Ririn for their
eternal love, encouragement, and support throughout my life. My special thanks
also go to Firman for the support and understanding.
Result of this work has been acccepted and reviewed by Asian Journal of
Agricultural Research.
Bogor, August 2014
Rika Fithri Nurani
CONTENTS
LIST OF TABLES
vi
LIST OF FIGURES
vi
LIST OF ATTACHMENTS
vi
INTRODUCTION
Background
Scientific Problem
Objective
Research Benefit
Research Scope
1
1
2
2
2
3
LITERATURE REVIEW
G. boninense in Oil Palm
Basal Stem Rot Disease
Endophyte Microbes
Potential Endophyte Bacteria
DGGE Analysis of Endophyte Community
3
3
4
4
5
6
METHOD
Research framework
Research Time and Place
Burkholderia sp. isolation
Antagonist in vitro test
In vivo test
Detection antifungal gene
7
7
8
8
8
8
10
RESULTS AND DISCUSSION
Results
Discussion
12
12
17
CONCLUSION AND SUGESTION
Conclusion
Sugestion
19
19
20
REFERENCES
20
ATTACHMENTS
24
LIST OF TABLES
1 The signs and symptoms of plants were scored on a disease scale 0-4
2 Treatments of Burkholderia sp and G. boninense on oil palm seedling,
3 Polymerase chain reaction primers and expected amplification products
from genes encoding enzymes involved in the biosynthesis of several
antibiotics.
4 Percentage of inhibition ratio from Burkholderia sp against G.
boninense growth in-vitro.
5 Disease severity index (DSI) of treated plant with G. boninense.
6 The effect of different progeny on root and leaf total number, lenght,
and dry weight after treatment with G. boninense and Burkholderia
sp.
7 The effect of dipping treatment of antagonistic bacteria on seedling of
oil palm inoculated with G. boninense in pre nursery at 3 months
after planting
4
9
11
13
13
14
14
LIST OF FIGURES
1 Research framework
2 In vitro test of Burkholderia sp. against G. boninense growth. R1 as the
control and R2 is the radial growth of G. boninense on trial.
3 Burkholderia sp. streaked on agar plate.
4 a. Plants treatment left to right (A-D). b. Healthy root with no
appearance of fungal mycellia (left). Appearance of fungal mycellia
(red arrow).
5 PCR amplification of 16S rRNA gene from oil palm roots after
3months.
6 DGGE band profile of endophyte bacteria treatment with Burkholderia
and G. boninense (left) and cluster analysis of endophyte bacterial in
oil palm root treated with Burkholderia sp and G. boninense with 1D
Pro Phoretrix software (right).
7 Phylogenetic tree of excised bands from DGGE.
8 PCR product of pyrrolnitrin and pyoluteorin gene amplification. M :
marker, 3. prn primer, 4. plt primer, a. B212, b. B313 , c. B51a , d.
B52c , e. B51b, f. B52a. Red arrows showed the expected band size.
9 Phylogenetic tree of PrnD gene from B212 and B51a.
7
12
12
13
15
15
16
16
17
LIST OF ATTACHMENTS
1 List of sequencing results from Burkholderia sp. isolate.
2 List of sequencing results from DGGE band slicing.
3 Sequencing result of PRND gene.
24
27
28
INTRODUCTION
Background
Oil palm is one of the most important agricultural export crops in Indonesia
besides rubber, cocoa, coffee, and spices (Stads et al. 2007). Basal stem rot
disease has been a serious threat to the oil palm industry in Indonesia because it
shortens the productive life of oil palms and causes serious economic loss. The
disease is caused by a white-rot fungi G. boninense and in the past few decades
has been spreading rapidly, for instance, in North Sumatra, Indonesia, this disease
can lead to losses as much as 50% after repeated planting cycles (25 years)
(Corley & Tinker 2003).
The use of fungicides for fungal control did not produce significant results
yet (Haas & Defago 2005). This may be due to the fact that by the time treatment
is applied, the palms may already have the disease. Antifungal-producing bacteria
is a promising biocontrol agent (BCA) to overcome this disease. BCA does not
necessarily be a cure for the disease but to slowing or even to stop the disease
spread by protect the plant or enhance the plant defense. Endophyte BCAs have
more value since it can live inside the plant tissue through the plants lifetime.
Endophyte bacteria is bacteria which live inside the plant tissues without
causing apparent harm or symptoms to the host (Munif et al. 2013). Endophyte as
the internal plant habitat provide several advantages as BCA. It will be less
competition with other microorganisms, sufficient supply with the nutrients, less
exposure to environmental stress factors, and better translocation of bacterial
metabolites throughout the host plant (Hallmann et al. 1997). Application of
endophyte Pseudomonas aeruginosa and B. cepacia could reduce BSR (Basal
Stem Rot) incidence up to 76% in 8 months oil palm seedling after pathogen
inoculation (Zaiton et al. 2008).
Endophyte bacteria live inside the plant and make their own community.
The community of endophytic bacteria is a dynamic habitat that influenced by
many factors such as climate change, plant tissues, soil type, and interaction with
other microorganisms. These factors may affect the structure and species
composition of the bacterial communities in plant tissues (Lacava et al. 2004;
Mocali et al. 2003). The communities of endophytic antagonist bacteria inside the
plant will be vary along with environment changes including the presence of
phytopathogen.
Members of the genus Burkholderia sp. are known for their ability to
suppress soil-borne fungal pathogens by the production of various antibiotic
compounds such as pyrrolnitrin and phenazines (Kirner et al. 1998). Other
different antibiotics such 2,4-diacetylphloroglucinol (2,4-DAPG) and pyoluteorin
has also been found responsible for suppression of soil-borne fungal pathogens
(Subagio & Foster 2003).
Antibiotic-related genes can be detected from BCAs by using Polymerase
Chain Reaction (PCR) by using antibiotic specific primers, which encode
phenazine-1-carboxylic acid, 2,4-DAPG, pyoluteorin, and pyrrolnitrin, from
Pseudomonas and Bacillus genome (Zhang et al. 2005).
2
BCAs have been applied in many ways and on many crops species, for
instance, seed dipping application on rice seeds to control bacterial blight disease
caused by Xanthomonas oryzae was able to reduce the disease incidence (Suryadi
et al. 2012). Besides microbial pathogen, BCA was also reported able to control
plant parasitic nematodes. Munif et al. (2013) was reported seed dipping
application on tomato seeds able to control Meloidogyne incognita penetration
and enhanced the plant growth. Oil palm germinated seeds dipping application
was also conducted by Dikin et al. (2003) to suppress Schizopyllum commune,
causal agents of brown germ and seed rot in oil palm.
Scientific Problem
1.
2.
3.
4.
5.
G. boninense is the most serious disease of field palms in Southeast Asia,
particularly Malaysia and Indonesia. Ganoderma BSR is now recognized as
a significant constraint to sustainable production in Asia, and development
of techniques for disease management has been highlighted as a key
research priority.
Chemical pesticides usage is consider to polution risk. We need a greener
alternative to control plant pathogen.
G. boninense growth can be supress by using biocontrol agent such as
bacteria.
Burkholderia exhibit a antibiotic compounds which responsible for
antifungal. Many research have reported about using microbes as a
biocontrol agent, but none showed a significant result in oil palm plantation.
Different climate and different land may give a different effect for
biocontrol agent. By using endophyte bacteria may minimize the
environmental factor.
Objective
The aim of this research in general is to gain endophyte biocontrol agent
potential in surpressing G. boninense growth in oil palm. Specific purposes of this
study are (1) to detect antifungi encoding gene from Burkholderia potential, thus
to gain information which antifungal compounds that play role in inhibiting G.
boninense growth, (2) to determine the effectiveness of endophytic Burkholderia
in suppressing G. boninense infection in-vivo and in vitro(3) to gain community
profile of endophyte bacteria in general and Burkholderia specifically among the
treatments with G. boninense as the plant pathogen.
Research Benefit
Achievement of the purpose of this study are expected to (1) obtain useful
information for the purpose of biocontrol agents development for pathogenic
fungi G. boninense, (2) endophytic Burkholderia as biocontrol agents to inhibit
infection of G. boninense in palm oil, and (3) confirmation of biocontrol agents in
interaction with G. boninense and to obtain bacterial community information after
the application of endophytic bacteria with biocontrol agents.
3
Research Scope
This research include isolation and genetic identification of Burkholderia
sp. from roots and soil taken from oil palm plantation. In vivo application of
Burkholderia sp. and G. boninense to oil palm seedling by using dipping
treatment. Plant growth measurement and infection scoring of oil palm after 3
months planting. Bacterial genome isolation from oil palm roots after treated with
Burkholderia sp. and G. boninense and bacterial community profile analysis by
using DGGE. Specific antifungal-related gene amplification by using PCR and
analyse the sequence by using gene bank (www.ncbi.nlm.nih.gov).
LITERATURE REVIEW
G. boninense in Oil Palm
The world‟s palm oil demand increased sharply in the past 5 years. In 2009,
global consumption for palm oil was 42 million tons, and in 2011 was 49.05
million tonnes, higher than rapeseed and soybean oil (Oil World 2012). The
greatest threat to sustainable oil palm production is Southeast Asia is from basal
stem rot disease caused by the white rot fungus G. boninense (Flood et al. 2000).
Most severe losses from BSR occur in Indonesia and Malaysia with lower
incidences being recorded in Africa, Papua New Guinea and Thailand (Idris et al.
2004). In North Sumatra, Indonesia, by the time of replanting (25 years) 40-50%
of palms are lost with the majority of standing palms showing disease symptoms.
The more serious palm losses due to G. boninense is occur in plantation where the
oil palm stumps were left in the ground after replanting (up to 25% occurred
within 7 years) (Subagio & Foster 2003).
Losses begin to have a financial effect once the disease affects more than
10% of the stand (Hasan & Turner 1998). On average there is a decline of the
yield of the fresh fruit bunch (FFB) of 0.16t/ha for every palm lost, and when the
stand had declined by 50% the average FFB yield reduction was 35% (Subagio &
Foster 2003). Plant improvement is required to overcome this problem.
The development of oil palm genotypes resistant to Ganoderma may
provide the ideal long-term solution to BSR. Many oil palm seed producer has
attempted to provide a G. boninense resistance oil palm through conventional
breeding and also through elite palm tissue culture. This attempt is consume a
long time until the seeds are established for commercial. For a short-term solution,
biocontrol agent such us microbes to protect the palm from G. boninense infection
can be use. The use of chemical fertilizer and pesticide is not environment
friendly which is not sustainable for they may cause several damages to
environment community. The use of biofertilizer and biopesticide has been done
extensively in many plantations, but the result is not yet optimal.
4
Basal Stem Rot Disease
Basal stem rot disease (BSR) caused by G. boninense is currently the major
disease in oil palm plantations (Darmono 1998). Typically the fungus may attack
an already weakened oil palm as G. boninense is seldom infects healthy trees
seriously (Paterson 2007). Wong et al. (2012) mentioned that infection mainly
occur in palms aging 30 years and above. The infections in younger palms of 1015 years become more apparent, followed by spreading of the disease in oil palms
at nursery stage.
G. boninense is a white rot fungus. The term „„white rot‟‟ derives from the
fungus degrading specifically the lignin component of wood while leaving white
cellulose exposed (Paterson 2007). Lignin biodegradation is probably a major part
of the disease process. Lignin protects the more amenable cellulose and
hemicelluloses from enzymatic attack by forming direct chemical bonds. White
rot fungi such as G. boninense, are an organism that has the capability of
degrading lignin into carbon dioxide and water, then celluloses is available as
nutrients for the fungus.
The earliest external symptoms of BSR of oil palms occur in the foliage. In
young palms, external symptoms of BSR comprise a yellowing or mottling of the
lower fronds, followed by necrosis. Young unfolded leaves become chlorotic and
may be reduced in length, sometimes with necrotic tips (Corley & Tinker 2003).
As the disease progresses, palms may take on a pale appearance, with retarded
growth and spear leaves remaining unopened. Similar symptoms are observed in
mature palms, with multiple unopened spear leaves and a generally pale leaf
canopy. Ultimately, affected palms may died, the necrosis beginning with the
oldest fronds and extending to younger regions of the crown. Palms normally die
within 6 to 12 months after the appearance of unexpanded spear leaves. The
infection of G. boninense on plant can be scored by using disease severity index
(DSI) showed in Table 1. (Abdullah et al. 2003).
Table 1 Score and disease scale of G. boninense infection in oil palm
Disease
class
0
1
2
3
4
Sign and symptom infection
Healthy plants with green leaves without appearance of fungal
mycelium on any part of plants
Appearance of white fungal mass on any part of plants, with or
without chlorotic leaves
Appearance of basidioma on any part of plants with chlorotic leaves
(1-3 leaves)
Formation of basidioma on any part of plants with chlorotic leaves
(> 3 leaves)
Formation of well-developed basidioma and the plants dried
Endophyte Microbes
Microbes have been reported as a potential biopesticide for its ability in
producing antifungal compound. Microbes niche naturally inside and outside of
5
almost every part of biotic and abiotic. Microbes which lived inside the plant
tissue is called endophyte. The usage of this term is equally for variable strategies
of symbiosis, ranging from facultatively saprobic to parasitic to exploitive to
mutualistic. It is because if taken literally, it can include all pathogen at some
stage of their development, since the plant host responds to at least some infection
with mechanical defence reactions (Narisawa et al. 2004).
Petrini et al. (1991) add another characterisation of endophytic interactions
as not "causing apparent harm", which presumably refers to an absence of
macroscopically visible symptoms. Aware of the determinative discrepancies, the
term of endophyte here to describe is those bacteria that can be detected at a
particular moment within the tissues of apparently healthy plant hosts. Particular
moment is added in term of endophyte because of the associated habitat is
dynamic along with environment changes, including the presence of pathogen
fungi.
As its ability to live inside the plant, endophytic bacteria can be utilized as
sustainable biocontrol. Introducing endophytic potential bacteria into plant tissue
has been widely applied by dipping the seeds or roots of plant in bacterial culture
concentrate. This treatment will increased the number of endophytic bacteria
inside the plant, but will not stay stable in a long time. Krechel et al. (2002)
reported that after treatment, in the first 3 weeks after seedling the density of
endophytic microbe will increased up to 105 cfu.g-1, and this number will stay
constant through plant growth periode. Plants has its own mechanism to tolerate
some number of endophyte living inside, and able to stabilize the number through
competition.
The population of endophytic itself is not spread evenly in all parts of the
plant. Hallman et al. (1997) reported that the population densities of indigenous
endophytic bacteria in roots are found about 105 cfu.g-1 fresh root weight. This is
higher than any other plant organ with average densities of 104 cfu.g-1 and 103
cfu.g-1 fresh weight in stem and leaves respectively.
Potential Endophyte Bacteria
Endophyte bacteria living inside the plant and bring an advantages to the
plant host. It has a direct and indirect role in plant growth and plant defence
system. Some bacteria exhibit a broad range of antifungal compound, and some
regulate plant growth hormone. Schimidt et al. (2009) reported that antibiotic
compounds produced by Burkholderia sp. are lipopeptides, cepaciamides A and
B, cepacidines, siderophores, altericidin, pyrrolnitrin, glidobactins, phenazines
and 2-hydroxymethyl-chroman-4-one. Antibiosis has been widely studied as one
of the most important biocontrol mechanisms inhibiting plant pathogens.
Different antibiotics have been found to be responsible for this inhibition,
including 2,4-diacetylphloroglucinol (2,4-DAPG), pyoluteorin, zwittermicin A,
and kanosamine (Zhang et al. 2006). Pyrrolnitrin [Prn; 3-chloro-4(2'-nitro-3'chlorophenyl)-pyrrole] has been correlated with biocontrol activity of fungal plant
pathogens (Homma et al. 1989). The biosynthetic genes for phenazine, 2,4DAPG, pyrrolnitrin, and pyoluteorin self-resistance gene have been sequenced.
Availability of these sequences has enabled for primers design based on conserved
6
regions for polymerase chain reaction (PCR) detection of antibiotic producing
bacteria.
DGGE Analysis of Endophyte Community
Arau´jo et al. (2002) worked on diversity of endophytic bacterial population
in healthy, resistant, and Citrus Variegated Chlorosis (CVC)-affected citrus plants.
He was using cultivation and cultivation-independent techniques to assess the
endophytic communities. His work showed that the diversity of endophytic
bacterial population in each treatment were different. The result showed there
were some specific bands that only appeared in asymptomatic plants. Also from
the cultivation observed, some isolates were found significantly more frequent
from asymptomatic plants than the other treatment. This came to a suggestion that
this organism has a role in the resistancy of plants to CVC. His research proved
that community of endophytic bacteria is influence by environment.
Bacterial community can be observed by using several methods, common
method that is used are DGGE (Denaturing Gradient Gel Electrophoresis), TRFLP (Terminal- Restriction Fragment Lenght Polymorphism), and SSCP (Single
Strand Conformation Polymorphism). Smalla et al. (2007), compared DGGE, TRFLP, and SSCP for assessing bacterial diversity in soil. The result showed
although the fragments amplified comprised different variable regions and
lengths, DGGE, T-RFLP and SSCP analyses led to similar findings. The
clustering of fingerprints which correlated with soil physico-chemical properties is
similar. Also the variability between the four replicates of the same soil is small.
The results showed that the 3 method is stable and show similar result. DGGE is
used in this research to assess the diversity of bacterial after introduced with
endophytic bacteria biocontrol potential and planted in treated soil.
DGGE is a molecular fingerprinting method that separates polymerase chain
reaction (PCR)-generated DNA products. However, since PCR products from a
given reaction are of similar size (bp), conventional separation by agarose gel
electrophoresis results only in a single DNA band that is non-descriptive. DGGE
can overcome this limitation by separating PCR products based on sequence
differences that results in differential denaturing characteristics of the DNA.
During DGGE, PCR products encounter increasingly higher concentrations of
chemical denaturant as they migrate through a polyacrylamide gel.
Upon reaching a threshold denaturant concentration, the weaker melting
domains of the double-stranded PCR product will begin to denature at which time
migration slows dramatically. Differing sequences of DNA (from different
bacteria) will denature at different denaturant concentrations resulting in a pattern
of bands. Each band theoretically representing a different bacterial population
present in the community. Once generated, fingerprints can be uploaded into
databases in which fingerprint similarity can be assessed to determine microbial
structural differences between environments or among treatments.
7
METHOD
Research framework
The experiment was divided into four steps as shown in Fig. 1. The research
activity was consist of bacterial isolation, antagonist in vitro test and in vivo test
of Burkholderia against G. boninense growth, and detection of antifungal gene.
Burkholderia sp. isolation (1)
Endophyte
Burkholderia sp.
Burkholderia sp.
isolates (1)
Rhizosphere
Burkholderia sp.
Detection of antifungal gene (4)
Antagonist in vitro test (2)
Antifungal partial
gene
Antagonist
Burkholderia sp. (2)
In vivo test (3)
Sequencing
DGGE
Bioinformatic
analysis
Endophyte
bacteria
sequences (3)
Phylogenetic tree of
antifungal genes (4)
Plant growth
observation
Disease severity
index (3)
Plant growth (3)
Fig. 1 Research framework
Infection
scoring
8
Research Time and Place
This research was start from June 2013 and finish on February 2014.
Laboratory activity was took place in laboratory of Microbiology, Biology
Departement, IPB, Bogor and laboratory of Microbiome Technology, PT.
SMART Tbk, Sentul, Bogor.
Burkholderia sp. isolation
Burkholderia sp. were isolated from soil near the roots and the roots that
were taken from a healhty (symtompless) oil palm tree in an endemic area, in
North Sumatera, Indonesia. A gram of soil was dilluted in steriled water and
poured on Nutrient Agar plates. For the roots, were surface sterilized with 90%
alcohol for 1 min, 70% alcohol for 3 min, and washed twice with 50mL sterile
distilled water for 30 sec. The roots were crushed aseptically and put on NA in
plate. The plate were incubated for 24-36 hours. Each of the grown colony were
subculture and genome extracted for identification. Purified PCR product of 16s
DNA were sent to 1st Base, Singapore.
Antagonist in vitro test
Antagonist test was observed to determine the percentage inhibition of
radial growth (PIRG) of G. boninense (Bivi et al. 2010). Six bacterial isolates of
Burkholderia sp. were selected to evaluate their efficacy in enhancing growth and
inhibit the infection of BSR in oil palm in pre nursery. There were five
rhizosphere Burkholderia sp. (B313, B51a, B52c, B51b, B52a) and one endophyte
Burkholderia sp. (B212).
Burkholderia sp. was streaked into the PDA plate 2.5 cm from the edge of
the Petri dish. Agar disc cut diameter 5 mm of 5-day old G. boninense was placed
2.5 cm from the edge at the opposite side of the same Petri dish. For the control
plate, only G. boninense was placed in a similar manner without bacteria on a
fresh Petri dish. The plates were incubated at 28oC for five days.
Results shown by measured the radial growth of G. boninense. PIRG was
measured using the equation below (Zaiton et al. 2006):
PIRG : percentage inhibition of radial growth; R1 : radial growth of G.
boninense in the absence of bacteria (control); R2 : radial growth of G. boninense
in the presence of Burkholderia sp. The three highest PIRG isolates from in vitro
test were used for in vivo test.
In vivo test
Burkholderia sp. suspensions were prepared by inoculating 24 h-old
cultures into Nutrient Broth (NB) and incubated for 20 hr and adjusted to 108 cfu.
mL-1. During the preparation of mixture, equal volume of the three highest PIRG
Burkholderia sp. were mixed. G. boninense inoculum was prepared on 6 x 3 x 15
9
cm sterilized oil palm fronds. The fronds were sterlized in a heat resistant plastic
each before inoculated with G. boninense. After sterlized, the fronds were
inoculated with a 0.5 cm diameter disc of G. boninense mycellia on agar plate.
The plastic was sealed and incubated in room temperature for 3 months before
used.
The plant material was Tenera oil palm and provided by PT. SMART Tbk.
The plant material was selected as the most G. boninense susceptible progeny.
Two different progenies were used in this research. Briefly, oil palm germinated
seeds were treated with bacterial suspension (108 cfu. mL-1), dipped for 20 min
(seed bacterization) and air dried for 10 min before planted.
Oil palm germinated seeds were planted in polybags (15 cm x 20 cm)
regarding to the Standard Operation Prosedure (SOP) in prenursery of oil palm
plantation. There were four treatments in this research as shown in Table 2.
Treatment A and C were not inoculated with G. boninense and treatments C and D
were inoculated with G. boninense. Treatment B and C were using seedling
treated with Burkholderia sp. Treatments with G. boninense, the seedlings were
placed in contact with radicula. The pots were placed under shead, watered daily
and no supplementary organic fertilizer was applied for 3 months (prenursery). A
destructive observation was conducted after 3 months.
Table 2 Treatments of Burkholderia sp and G. boninense on oil palm seedling,
Treatment
A (control)
B (control Burkholderia sp.)
C (antagonist test)
D (control G. boninense)
Burkholderia
+
+
-
G. boninense
+
+
Infection scoring
The infection of G. boninense on plant can be scored by observation on
signs and symptom on the treatment plants using disease severity index (DSI) as
in Abdullah et al. (2003). DSI was observed from the external symtomp from
foliar and the roots (destructive method).
The score can be calculated by the formula of Nur Ain Izzati and Abdullah (2008)
as below in percentage :
where:
A : disease class (0, 1, 2, 3 or 4)
B : number of plants showing that disease class per treatment
The treatment was repeated into 13 replicates. This research used factorial
design with one factor and the environmental design is Complete Randomized
Design. Statistic analysis was done by using general method linear model
univariate. If there was a significant diferrences, further analysis will be analyzed
with α value is 5% by using SAS.
10
Bacterial genome isolation
The roots (1g) which already surface sterilized, were placed in a mortar
and grinded into fine powder by using liquid nitrogen. Bacterial genome were
islated by using PowerPlant DNA isolation kit (MoBio). Then visualized the total
DNA by electrophoresis on a 1% (wt/vol) agarose gel with 100 volt, 30 min.
PCR-DGGE Analysis and Sequencing
The PCR mixture is prepared by 1 μl of extracted DNA, 2.5 μl of 10x
Dream Taq buffer, 1 μl 25 nmole of each primer (16sRNA), 0.4 μl of 2mM
deoxynucleoside triphosphate (dNTP), 0.12 μl of Dream Taq DNA polymerase
(5u/ μl), in a 25 μl final volume. A negative control (PCR mixture without DNA)
included in all PCR experiments.
The diversity of the endophytic bacterial communities is studied by the
DGGE method. PCR products obtained from 16S rDNAs with the 357F (5´-CGC
CCG CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG GCC CTA
CGG GAG GCA GCAG-3´) and 518R (5´-ATTACCGCGGCTGCTGG-3´)
primers developed by Muyzer et al. (1993). The DGGE-PCR was carried out with
the temperature profile as follows-an initial denaturation step of 3 min at 95oC,
followed by 35 cycles of 94oC for 1 min, 55oC annealing for 30 sec, 72oC pprimer
extention for 1 min and a final step was carried out 72oC for 7 min. PCR product
was analyzed by electrophoresis in a 1% (wt/vol) agarose gel with 0.5 x TAE
buffer and stored at 20°C for DGGE analysis.
DGGE was performed on PCR products obtained as above using the DCode universal mutation detection system as per the manufacturer's instructions
(Bio-Rad, USA). PCR samples were loaded into 8% (wt/vol) polyacrylamide gels
in 1 x TAE buffer (20 mM Tris-acetate, 0.5 mM EDTA, pH 7.4). The
polyacrylamide gels were made with denaturing gradients ranging from 30 to 70%
(where the 100% denaturant contained 7 M urea and 40% formamide). The gels
were run for 6 h at 150 V and 60°C, after which the gels were soaked for 1 h in
SYBR Green I nucleic acid stain (1:10,000 dilution; Molecular Probes, Leiden,
The Netherlands) and immediately photographed under UV light.
Prominent bands are excised from the gels, reamplified, and subjected to
DGGE as previously described. The new PCR products were purified with
GenJET PCR purification kit (Thermo Scientific). Analyses of sequences are
performed with the basic sequence alignment (BLAST) program run against the
BLAST database (National Center for Biotechnology Information website
[http://www.ncbi.nlm.nih.gov]).
Detection antifungal gene
The DNA isolation was carried out by using GeneJET Genome DNA
Purification Kit from Thermo Scientific. Burkholderia sp. was prepared in 10 mL
liquid medium and the cells were collected after incubated for 18 hr in 37oC.
Specific primers for DAPG (Phl2a-Phl2b), phenazine (PHZ1-PHZ2),
pyrrolnitrin (PRND1-PRND2) and pyoluteorin (PLTC1-PLTC2) were used for
detection according to Zhang et al. (2005)(Table 3).
11
Table 3 Polymerase chain reaction primers and expected amplification products
from genes encoding enzymes involved in the biosynthesis of several
antibiotics.
Primer
Phl2a
Phl2b
PHZ1
PHZ2
PRND1
PRND2
PLTC1
PLTC2
Antibiotic
2,4-DAPG
Phenazine
Pyrrolnitrin
Pyoluteorin
Sequence
GAGGACGTCGAAGACCACCA
ACCGCAGCATCGTGTATGAG
GGCCAGATGGTCAACGG
CGGCTGGCGGCGTATAT
GGGGCGGGCCGTGGTGATGGA
YCCCGCSGCCTGYCTGGTCTG
AACAGATCGCCCCGGTACAGAACG
AGGCCCGGACACTCAAGAAACTCG
Sequence
size (bp)
745
1400
790
438
Amplification of target gene was using master PCR mixed 1 μl of template
DNA, 2.5 μl of 10x Dream Taq buffer, 1 μl 25 nmole of each primer (16sRNA),
0.4 μl of 2mM deoxynucleoside triphosphate (dNTP), 0.12 μl of Dream Taq DNA
polymerase (5u/ μl), in a 25 μl final volume. The PCR reaction for DAPG and
pyrrolnitrin primers was the same, it was 30 cycle with PCR condition
predenaturation (94oC, 2 min), denaturation (94oC, 1 min), annealing (62oC, 45
sec), elongation (72oC, 1 min), and post PCR (72oC, 2 min). PCR reaction for
phenazine primers was 30 cycle with PCR condition predenaturation (94oC, 1.5
min), denaturation (94oC, 45 sec), annealing (58oC, 45 sec), elongation (72oC,
1.75 min), and post PCR (72oC, 1 min). PCR reaction for pyoluteorin primers
was amplified 35 cycle with PCR condition predenaturation (94 OC, 5 min),
denaturation (94 OC,1 min), annealing (50 oC, 1 min), elongation (72 oC, 1 min),
and post PCR (72 oC, 10 min).
PCR product visualization is conducted by elecphoresis in 2 % agarose
(w/v) with voltation 90 volt in 30 min. PCR product was gel extracted from
agarose by using Gene JET Gel Extraction Kit (Fermentas), according to
manufacturer's instruction. After purification, the PCR products were sent to 1st
Base, Singapore, to be sequenced. The antifungal genes sequences were aligned
by using BioEdit software and searched for sequence similarity to other sequences
which are available in the NCBI database at http://www.ncbi.nih.gov using Basic
Local Alignment Search Tool (BLAST) algorithm. Multiple sequence alignments
were performed on the selected closely related sequence accessions available
using CLUSTAL W software in Mega 5.
12
RESULTS AND DISCUSSION
Results
Burkholderia sp. isolation
Bacterial isolation from root and soils were found five isolates of
rhizosphere Burkholderia sp. and one isolate of endophyte Burkholderia sp. The
isolates were rod shape and Gram negative cell on 1000x magnification under
microscope. The colony was yellowish translucent on Nurtient agar (NA) media
(Fig. 2).
Fig. 2 Burkholderia sp. growth on nutrient agar (NA) plate.
Antagonist in vitro test
All of the Burkholderia sp. isolates showed an inhibition activity against G.
boninense growth in vitro. Burkholderia B212 showed the highest inhibition on
G. boninense growth in vitro (Fig. 3).
Fig. 3 In vitro test of Burkholderia sp. against G. boninense growth. R1 as the
control and R2 is the radial growth of G. boninense on trial with
Burkholderia B212.
PIRG scores of Burkholderia sp. on G. boninense growth shown on Table 4.
The score followed by the same letter indicated that they were insignificantly
different scores. The highest inhibition activity was shown by isolate B212 with
%PIRG was 34.38%, but not significantly different with B52a and B52c which
were both 27.50%. Burkholderia B313 showed the lowest activity (23.75%) and
13
significantly different with B212, but still has an antagonist activity against G.
boninense growth in vitro.
Table 4 Percentage of inhibition ratio from Burkholderia sp against G. boninense
growth in-vitro.
Isolates
B212
B52a
B51a
B52c
B251a
B313
PIRG (%)
34.38a
27.50ab
25.00b
27.50ab
25.63b
23.75b
In vivo test
The necrosis and chlorosis foliar was not seen in all treatments, though the
height of the plants between treatment was seem different (Fig. 4a). DSI after 3
months only showed in treatment C and D (25%) (Table 5). Destructive
observation showed that all plants in treatment C and D were infected with G.
boninense. Treatment C and D, which were inoculated with G. boninense, showed
a brown-blackening roots especially on the parts which colonized with the G.
boninense (Fig. 4b). The roots in treatment A and C, without G. boninense were
cream-brown colored.
Table 5 Disease severity index (DSI) of treated plant with G. boninense.
Treatments
Un-inoculated seed (A)
Un-inoculated seed + Burkholderia consortia (B)
Inoculated seed + Burkholderia consortia (C)
Inoculated seed (D)
a
DSI (%)
0b
0b
25a
25a
b
Fig. 4a. Plants treatment left to right (A: control, B: control Burkholderia sp., C:
antagonist test, D: control G. boninense). b. Healthy root with no
appearance of fungal mycellia (left). Appearance of fungal mycellia (red
arrow).
14
Progeny give a significant different mostly to the shoot lenght and dry
weight (Table 6). Total number of roots between progeny also showed a
significant difference. However, there is no interaction between progenies and
treatments though in some parameter that were observed was showed a significant
difference.
Table 6 The effect of different progeny on root and leaf total number, lenght, and
dry weight after treatment with G. boninense and Burkholderia sp.
Lenght (cm)
Dry weight (g)
Total number of
shoot
Root
shoot
Root
Shoot
Root
a*
a
a
a
a
1
24.794
28.304
1.162
0.989
5.130
4.413a
2
22.789b
29.145a
1.011b
0.916a
4.872a
3.829b
* Means within a column with the same letter are not significantly different at
p