IV. MICROSATELLITE MARKERS FOR CLASSIFIYING AND ANALYZING GENETIC RELATIONSHIP OF
BANANA CULTIVARS IN INDONESIA
ABSTRACT
In addition to be used for identifying banana genomic groups, microsa- tellites were employed to investigate genetic relationships among banana
accessions collected from various areas in Indonesia. One hundred and sixteen banana accessions were analyzed using the primers MaCIR108 and Ma-3-90 for
identifying genomic groups and additional 6 microsatellite primers for genetic relationship analysis. The results showed that 73 accessions identified as AA or
AAA; and AAA genomic groups should be designated under the name M. acuminata
, 2 accessions of BB should be under the name M. balbisiana, 21 accessions of AAB and 20 accessions of ABB should be placed under the name
M. x paradisiaca . This study also detected 1 allele of the Ma-3-139 with the size
of 132 bp which supported the MaCIR108 alleles for separating banana containing the B genome from the A genome alone. Analysis of the 116
accessions using the 8 primers detected only 99 genotypes because 26 accessions clustered within 9 identical genotypes. All banana accessions belonging to BB,
AAB, and ABB genomic groups clustered in the first main cluster together with majority of accessions containing the A genome alone. The second main cluster
was belonging to 11 accessions consisting of AA or AAA; and AAA genomic groups. The accessions BB, AAB and ABB were clearly distinct from each other.
The BB appears closer to the ABB genomic groups. All accessions containing the B genome were clustered according to their genomic groups, except 4 accessions
of AAB clustering together with accessions of the A genome alone. These accessions of AA or AAA; and AAA could not be significantly distinguished,
although majority of them tend to be clustered according to ploidy level. Key words: genomic group, microsatellite, Musa acuminata, M. balbisiana, M.x
paradisiaca
INTRODUCTION
The application of Musa paradisiaca,- the first scientific name given and published by Linnaeus in his Species Plantarum,- for cultivated bananas is not
justifiable. It is because the cultivated bananas consisted of different cultivars that are quite distinct from each other Valmayor et al. 2000. There were three
possible morphologically different cultivars, those originating from each of the two of wild species, M. acuminata Colla and M. balbisiana Colla and those which
are hybrids Karamura 1998, Valmayor et al. 2000.
Simmonds and Sheperd 1955 convincingly argued concerning the origin of cultivated bananas. They refused the cultivated bananas which were designated
under the name M. paradisiaca. The bananas, either pure diploid or pure triploid cultivars keep the morphological characteristics of their wild type M. acuminata
or M. balbisiana. Therefore, they should be classified in the same species as each of their wild parents Valmayor et al. 2000. The plants brought from the wild into
the cultivation are designated under the names that are applied to the same taxa growing in nature Brickell et al. 2004.
The hybrid bananas that evolved from the two natural species mostly formed triploid cultivars Heslop-Harison and Schwarzacher 2007. According to
International Code of Botanical Nomenclature ICBN Mc Neal et al. 2006 and International Code of Nomenclature of Cultivated Plants ICNCP Brickell et al.
2004 the hybrid bananas should be classified into M. x paradisiaca because they have been proven as the nature hybrids Stover and Shepherd 1987; Jumari 2000.
The ICNCP recognized the complex hybrid origins of most crops and classified them in convenience ways to users. Nomenclatural stability is needed for trade
Hetterscheid and Brandenburg 1995. In the case, the name M. x paradisiaca should be accepted because this binomial was published before M. sapientum L.,
and is in fact known as the type species for the hybrid banana Stover and Simmonds 1987. According to Karamura 1998, the name M. x paradisiaca is
applicable to all hybrids of banana cultivars notwithstanding their genomic composition.
According to ICNCP Brickell et al. 2004, the full name of a cultivar is the accepted botanical name in Latin form of the taxon to which it is assigned,
followed by the cultivar epithet. The problems of banana cultivars classification and their nomenclature emerged from description of M. paradisiaca given by
Linnaeus. The description could not be applied especially in Southeast Asia Valmayor et al 2000 because many local cultivars having important
characteristics were not found in the other regions. There is no publication or consensus that could be used as a reference by the banana community. Taxonomy
Advisory Group TAG for Musa made an effort to develop nomenclature and
glossary of terms which could be accepted by Musa research community so that they can communicate and understand each other INIBAP 2006b.
Genomic constitutions play an important role in the banana classification Pillay et al. 2004. Alteration of genomic groups sometimes caused the change of
the taxonomic status as exhibited in the first and the second study Chapter II and III. The Genomic groups have usually been determined based on 15
morphological appearances following the scoring system described by Simmonds and Shepherd 1955. Cultivar identification based on these characters is not
always correct due to the influences of the environmental factors Vicente et al. 2005. Thus, it is necessary to classify the genomic groups of banana cultivars
using molecular approaches. The ability of the molecular techniques to distinguish one cultivar from the others was recognized to be more effective than
morphological techniques Ford-Lloyd et al. 1997. Microsatellite is one of the most informative molecular markers to reveal
genetic diversity of banana cultivars Kaemmer et al. 1997; Creste et al. 2003, 2004. The markers have been used for genotypic identification of many plant
species, such as coconut Perera et al. 2001, rice Chakravarthi and Naravaneni 2006, and Annona senegalensis Kwapata et al. 2007. Microsatellites are DNA
regions flanked by 2 conserved sequences and detected in a specific locus Spooner et al. 2004; Semagn et al. 2006. Polymorphisms in the microsatellite
regions could be detected using primers designed from these flanking regions Innan et al. 1997. Besides a few microsatellite primers were proven to provide
diagnostic characters for banana genomic groups Kaemmer et al. 1997; Creste et al.
2003, 2005, determination key of microsatellite markers have been successfully constructed in the second study Chapter II.
The purposes of the study were to classify banana accessions collected from various regions in Indonesia using the microsatellite determination key and to
investigate the genetic relationships among these accessions based on microsatelite markers.
MATERIAL AND METHODS Plant materials and primers
A total of 116 banana accessions collected from various areas in Indonesia were examined Table 4.1. The accessions were classified into their genomic
groups using microsatellite determination key. The genetic relationships among banana accessions were investigated based on 8 microsatellite primers Table 4.2.
Table 4.1 List of 116 accessions used in the study of cultivated banana classification and genetic relationship analysis
Accession Region Sourcecollection
Barangan Merah Medan
Diperta Barley Cukurgondang
Pasuruan Diperta
Embuk Putih Giri Banyuwangi
Diperta Gintung Tawangsari
Sukoharjo Diperta
Goplek Unknown Diperta
Koja Santen Unknown
Diperta Kolis Unknown
Diperta Mas Lumut
Pakem Sleman Diperta
Medan Tegalsari Girimulyo
Diperta Morli Unknown
Diperta Raja Madu
Giri Banyuwangi Diperta
Sebrot Cukurgondang Pasuruan
Diperta Sembuk Cukurgondang
Pasuruan Diperta
Siam Paris Unknown
Diperta Toklek Sleman
Diperta Wangu Cipaku
Bogor Diperta Ambon Lumut A
Unknown PKBT
Ambon Lumut B Unknown
PKBT Ampyang Unknown
PKBT Angleng Unknown
PKBT Anjasmara Yogyakarta
PKBT Badak Unknown
PKBT Embok Unknown
PKBT Ice
Yogyakarta PKBT
Jepang Unknown PKBT
Kapas Tasikmalaya Tasikmalaya
PKBT Kepok Amerika
Yogyakarta PKBT
Kepok Kuning Gowa makasar
PKBT Kepok Manggala
Unknown PKBT
Kutes Wonosobo PKBT Lampung Unknown
PKBT Lidi Unknown PKBT
Madura Unknown PKBT
Mandar Unknown PKBT
Mas 40 Hari Yogyakarta
PKBT Mas Purbalingga
Unknown PKBT
Nangka Unknown PKBT
Oli Unknown PKBT
Table 4.1 List of 116 accessions used in the study of cultivated banana classification and genetic relationship analysis continued
Accession Region Sourcecollection
Papan Unknown PKBT
Potho Bunthek Yogyakarta
PKBT Potho Yogya
Yogyakarta PKBT
Prabumulih Unknown PKBT
Raja Bulu Unknown
PKBT Raja Sableng
Yogyakarta PKBT
Raja Sereh Unknown
PKBT Rotanhari Yogyakarta
PKBT Sabulan Unknown
PKBT Segli Unknown
PKBT Siam Manggala
Unknown PKBT
Sigung Unknown PKBT
Susu Unknown PKBT Austroli Jasinga
Bogor Bogor Badak Jasinga
Bogor Bogor Jepang Jasinga
Bogor Bogor Kepok Merah
Jasinga Bogor Bogor
Klutuk Hijau Jasinga Bogor
Bogor Pisang Kuning
Jasinga Bogor Bogor
Raja Bening Jasinga Bogor
Bogor Rejang Jasinga
Bogor Bogor Udang Jasinga
Bogor Bogor Unknown 1
Jasinga Bogor Bogor
Unknown 2 Jasinga Bogor
Bogor Unknown 3
Jasinga Bogor Bogor
Unknown 4 Jasinga Bogor
Bogor Unknown 5
Jasinga Bogor Bogor
Unknown 6 Jasinga Bogor
Bogor Unknown 7
Jasinga Bogor Bogor
Unknown 8 Jasinga Bogor
Bogor Unknown 9
Jasinga Bogor Bogor
Agakher Bokondini Jayawijaya
RIF Angleng Unknown
RIF Awomen Unknown
RIF Ayam
Kb. Pipit Baso, West Sumatera RIF
Barifta A Unknown
RIF Berlin Unknown
RIF Branjut Unknown
RIF Buai Unknown RIF
Dingin Unknown RIF
Hutan Jambi Unknown
RIF Ik Osroc
Amban Manokwari RIF
Jantan Unknown RIF
Jari Buaya Unknown
RIF Keikeni
Amban Manokwari RIF
Ketan Unknown RIF
Kilita Unknown RIF
Klutuk Susu Unknown
RIF Kole Unknown RIF
Table 4.1 List of 116 accessions used in the study of cultivated banana classification and genetic relationship analysis continued
Accession Region Sourcecollection
Lase Unknown RIF Lilin Jambi
RIF Limpyang
Bk Sundi, West Sumatera RIF
Longong Unknown RIF
Mantra Ho Unknown
RIF Mantreken Unknown
RIF Mourina Unknown
RIF Neij Aubu
Ransiki Manokwari RIF
Neij Amper Ransiki Manokwari
RIF Neij Houbwan
Ransiki Manokwari RIF
Numbungga Bokondini Jayawijaya
RIF Panggang
Deli Serdang, North Sumatera RIF
Pogori Bokondini Jayawijaya
RIF Pup Unknown RIF
Ratu Tanah Datar, West Sumatera
RIF Raja Muli
Unknown RIF
Ramehaye Unknown RIF
Sramfin Amban Manokwari
RIF Tanduk Lembu
Haroung Gaol, West Sumatera RIF
Udang Unknown RIF
Unknown 1 Karimunjawa
Central Java Unknown 2
Karimunjawa Central Java
Unknown 3 Karimunjawa
Central Java Unknown 4
Karimunjawa Central Java
Unknown 5 Karimunjawa
Central Java Unknown 6
Karimunjawa Central Java
Unknown 7 Karimunjawa
Central Java Unknown 8
Karimunjawa Central Java
Unknown 9 Karimunjawa
Central Java
1
Diperta, Dinas Pertanian dan Kehewanan, Yogyakarta
2
RIF, Research Institute of Fruits, Solok West Sumatera
3
PKBT, Pusat kajian Buah Tropika, IPB
Molecular key for determination of banana genomic groups 1a. The MaCIR108 alleles with the size of 270 bp or less………………………..2
2a. The number of alleles, one to two…………..AA or AAA genomic group 2b. The number of alleles, three………………………...AAA genomic group
1b. The MaCIR108 alleles with the size of more than 270 bp……………………3
3a. Allele with the size of 295 bp, only…………………...BB genomic group 3b. Alleles combination: 295 bp; 295 bp and 289 bp; 295 bp and 287 bp; and
1 allele of the MaCIR108 with the size of 270 bp or less ……...……………………………………………….ABB genomic group
3c. Alleles combination of 287 bp and alleles of the MaCIR108 with the size of 270 bp or less.……………………………………….…...….………….4
4a. Alleles combination of 287 bp and 2 alleles of 270 bp or less
.…………………….…………………………....AAB genomic group
4b. Alleles combination of 287 bp and 1 allele of 270 bp or less…......….5
5a. The Ma-3-90 allele of 152 bp, present .…….ABB genomic group 5b. The Ma-3-90 allele of 152 bp, absent .……..AAB genomic group
3d. Allele combination of 275 bp and alleles of the MaCIR108 with the size of
270 bp or less ............................................................AAB genomic group
Table 4.2 Primers used to classify the cultivated bananas and to investigate the genetic relationships among the 116 banana accessions
Primers Forward primer sequence
Reverse primer sequence, 5’-3’ Optimized annealing
temperature ºC MaCIR108
a
F: TAAAGGTGGGTTAGCATTAGG R: TTTGATGTCACAATGGTGTTCC
55 Ma-1-132
a
F: GGAAAACGCGAATGTGTG
R: AGCCATATACCGAGCACTTG 53
MaCIR327b
a
F: AAGTTAGTCAAGATAGTGGGATTT R: CTTTTGCACCAGTTGTTAGGG
50 MaCIR332a
a
F: TCCCAACCCCTGCAACCACT R: ATGACCTGTCGAACATCCTTT
53 Ma-1-17
a
F: AGGCGGGGAATCGGTAGA R: GGCGGGAGACAGATGGAGT
56 Ma-1-27
a
F: TGAATCCCAAGTTTGGTCAAG R: CAAAACACTGTCCCCATCTC
56 Ma-3-90
b
F: GCACGAAGAGGCATCAC R: GGCCAAATTTGATGGACT
56 Ma-3-139
b
F: ACTGCTGCTCTCCACCTCAAC R: GTCCCCCAAGAACCATATGATT
56
a
Primers developed by Kaemmer et al. 1997
b
Primers developed by Crouch et al. 1998
DNA extraction and microsatellite region amplification
Total DNA was extracted from fresh young leaves using a modified SDS procedure Dixit 1998. The extraction buffer consisted of 100 mM Tris pH 8.0,
50 mM EDTA pH 8.0, 500 mM NaCl, 10 mM beta-mercaptoethanol, and 20 SDS. Precipitation of DNA was carried out without
a PEG solution treatment. Quality and concentration of DNA were evaluated by electrophoresis in 0.8
agarose gel stained with ethidium bromide EtBr and by spectrophotometer, respectively. PCR reaction volumes were 10
μl containing 1.5 μl DNA template 15 ng DNA, 1
μl 10 x PCR buffer with 20 mM MgCl
2
, 0.2 μl 10 mM dNTPs,
0.2 μl 10 µM of each primer, and 0.06 μl 5 μl
-1
Taq DNA Polymerase Native GenScript Corporation®.
The PCR cycling consisted of an in initial denaturation at 95ºC for 4 min, followed by 35 cycles of 30 s at 95ºC for template denaturation, 30 s for primer
annealing with the temperature depending on the primer, 30 s at 72ºC for primer extension, ended with an extention of 10 min at 72ºC. PCR reactions were carried
out in a Perkin Elmer 2400 thermocycler Applied Biosystems, Foster City, CA, USA®.
Electrophoresis and silver staining
The PCR products were separated in 6 denaturized polyacrylamide gels 7 M Urea Sigma-Aldrich Chemie Germany® at 45-60 W constant power for 2 to 3
hours depending on the size of microsatellites. Alleles of microsatellite were visualized by silver staining according to modified procedure of Creste et al.
2001. All solutions were prepared using distilled water.
Data analysis
Banana accessions were classified into their genomic groups based on the existence of amplified fragments of the primers MaCIR108 and Ma-3-90. Each
variant fragment was assumed as an allele. For the need of genetic relationship analysis using the 8 primers, each allele was scored as present 1 or absent 0.
The size of each allele was estimated using a 100-bp DNA ladder Invitrogen®. The microsatelite markers detected 2 alleles in the heterozygous genotype for
diploid and triploid or 3 alleles for triploid while in the homozygous genotype the markers detected only 1 allele. Jaccard coefficient using Similarity of Qualitative
Data SYMQUAL procedure was used to estimate of similarity between the accessions. The matrix of similarity was then used for clustering analysis to
investigate genetic relationships among the accessions. Clustering analysis was performed using Sequential, Agglomerative, Hierarchical and Nested SAHN
procedure of Unweighted Pair-grouping Method with Arithmatic Average UPGMA by the Numerical Taxonomy and Multivariate Analysis System
NTSYSpc version 2.02 Rohlf 1998.
RESULTS AND DISCUSSION Identification of banana genomic groups using the determination keys of
microsatellite markers
The primers MaCIR108 and Ma-3-90 produced clear alleles and polymorphic banding patterns. Amplification of 2 or 3 alleles was observed in
mostly banana accessions. The allele number of more than one within one locus was considered as heterozygous genotypes Cerenak et al. 2004. In the study,
the maximum number of alleles from any given accessions was three. It is because tetraploid bananas are rarely found naturally Heslop-Harrison and Schwarzacher
2007. Most cultivated bananas are triploid. The MaCIR108 detected 18 alleles with the size of alleles ranged from 220 to 295 bp, while the Ma-3-90 detected 14
alleles with the size of alleles ranged from 132 to 172 bp. Genomic group identification of the 116 accessions using the primers
MaCIR108 and Ma-3-90 determined AA or AAA; AAA; BB; AAB; and ABB genomic groups. Seventy three of the 116 accessions studied only possessed the
MaCIR108 alleles with the size of 270 bp or less. In these accessions, allele of the Ma-3-90 with the size of 152 bp was not detected. Therefore, they should be
classified into AA or AAA; and AAA genomic groups due to the lacking of diagnostic characters for the B genome. The range of the MaCIR108 alleles in
these accessions were approximately from 210 to 268 bp as previously reported in the first study Chapter II. The 46 accessions having 3 alleles of the MaCIR108
were classified into AAA genomic groups whereas the others 27 accessions with one or two alleles were classified into AA or AAA genomic group Table 4.3.
Table 4.3 List of 73 accessions classified into AA or AAA; and AAA genomic groups based on the primers MaCIR108 and Ma-3-90
Accession Genomic group
Region Source
collection
Barley AA or
AAA Cukurgondang
Pasuruan Diperta
Morli AA or
AAA Unknown
Diperta Jepang AA
or AAA
Unknown PKBT
Lampung AA or
AAA Unknown
PKBT Lidi AA
or AAA
Unknown PKBT
Mas 40 Hari AA or AAA
Yogyakarta PKBT
Mas Purbalingga AA or AAA
Unknown PKBT
Oli AA or
AAA Unknown
PKBT Sigung AA
or AAA
Unknown PKBT
Pisang Kuning AA or AAA
Jasinga Bogor Bogor
Table 4.3 List of 73 accessions classified into AA or AAA; and AAA genomic groups based on the primers MaCIR108 and Ma-3-90 continued
Accession Genomic group
Region Source
collection
Rejang AA or AAA
Jasinga Bogor Bogor
Unknown 1 AA or AAA
Jasinga Bogor Bogor
Unknown 3 AA or AAA
Jasinga Bogor Bogor
Unknown 4 AA or AAA
Jasinga Bogor Bogor
Unknown 5 AA or AAA
Jasinga Bogor Bogor
Unknown 6 AA or AAA
Jasinga Bogor Bogor
Unknown 7 AA or AAA
Jasinga Bogor Bogor
Unknown 8 AA or AAA
Jasinga Bogor Bogor
Berlin AA or
AAA Unknown
RIF Hutan Jambi
AA or AAA Unknown
RIF Jari Buaya
AA or AAA Unknown
RIF Ketan AA
or AAA
Unknown RIF
Kole AA or
AAA Unknown
RIF Lilin AA
or AAA
Jambi RIF
Ratu AA or AAA
Tanah Datar, West Sumatera RIF
Raja Muli AA or AAA
Unknown RIF
Ramehaye AA or
AAA Unknown
RIF Gintung AAA
Tawangsari Sukoharjo Diperta
Kolis AAA Unknown
Diperta Mas Lumut
AAA Pakem Sleman
Diperta Raja Madu
AAA Giri Banyuwangi
Diperta Sebrot AAA
Cukurgondang Pasuruan
Diperta Ambon Lumut A
AAA Unknown
PKBT Ambon Lumut B
AAA Unknown
PKBT Ampyang AAA Unknown
PKBT Angleng AAA
Unknown PKBT
Anjasmara AAA Yogyakarta PKBT
Badak AAA Unknown
PKBT Ice
AAA Yogyakarta
PKBT Kutes AAA
Wonosobo PKBT
Madura AAA Unknown
PKBT Papan AAA
Unknown PKBT
Potho Bunthek AAA
Yogyakarta PKBT
Potho Yogya AAA
Yogyakarta PKBT
Rotanhari AAA Yogyakarta PKBT
Sabulan AAA Unknown
PKBT Segli AAA
Unknown PKBT
Badak AAA Jasinga
Bogor Bogor
Jepang AAA Jasinga
Bogor Bogor
Raja Bening AAA
Jasinga Bogor Bogor
Udang AAA Jasinga
Bogor Bogor
Unknown 9 AAA
Jasinga Bogor Bogor
Agakher AAA Bokondini
Jayawijaya RIF Angleng AAA
Unknown RIF
Awomen AAA Unknown
RIF Ayam
AAA Kb. Pipit Baso, West Sumatera
RIF Barifta A
AAA Unknown
RIF
Table 4.3 List of 73 accessions classified into AA or AAA; and AAA genomic groups based on the primers MaCIR108 and Ma-3-90 continued
Accession Genomic group
Region Source
collection
Branjut AAA Unknown
RIF Buai AAA
Unknown RIF
Dingin AAA Unknown
RIF Ik Osroc
AAA Amban Manokwari
RIF Keikeni AAA
Unknown RIF
Lase AAA Unknown
RIF Limpyang
AAA Bk. Sundi, West Sumatera
RIF Mourina AAA
Unknown RIF
Neij Aubu AAA
Ransiki Manokwari RIF
Neij Houbwan AAA
Ransiki Manokwari RIF
Numbungga AAA Bokondini Jayawijaya
RIF Pogori AAA
Bokondini Jayawijaya
RIF Sramfin AAA
Amban Manokwari
RIF Tanduk Lembu
AAA Haroung Gaol, West Sumatera
RIF Udang AAA
Unknown RIF
Unknown 6 AAA
Karimunjawa Central Java
Two accessions only having allele of the MaCIR108 with the size of 295 bp should be placed into BB genomic group Table 4.4 because they did not have
alleles of the MaCIR108 with the size of 270 bp or less. The existence of the BB genomic groups was naturally considered to be higher than BBB Pillay et al.
2004. Twenty accessions possessed allele combination of 295 bp; 295 bp and 289 bp; or 295 bp and 287 bp; and 1 allele of the MaCIR108 with the size of 270 bp or
less. These accessions having alleles of diagnostic characters for the A and B genomes should be placed into ABB genomic groups Table 4.4 because the Ma-
3-90 allele of 152 bp was detected. Several of the remaining 21 accessions containing 1 allele of the MaCIR108
of 287 bp and alleles of 270 bp or less should be placed into AAB genomic groups Table 4.4 because they did not have the Ma-3-90 allele of 152 bp. Other AAB
possessed 1 allele of the MaCIR108 with the size of 275 bp and alleles of 270 bp or less.
This study also detected 1 allele of the Ma-3-139 with the size of 132 bp found in all accessions containing the B genome, and none was observed in all
accessions of the A genome alone. This suggested that locus Ma-3-139 also provide a diagnostic character for distinguishing accessions of the B genome from
the A genome alone. In the first and the second study, the importance of this allele could not be concluded due to the limitation of wide diversity of the studied
materials. According to Cerenak et al. 2004 the number of alleles obtained from an investigation by microsatellites correlated with the number of accessions
analyzed. Table 4.4 List of 43 accessions classified into BB, AAB and ABB genomic
groups based on the primers MaCIR108 and Ma-3-90 Accession Genomic
group Region
Source Collection
Klutuk Hijau BB
Jasinga Bogor Bogor
Unknown 2 BB
Jasinga Bogor Bogor
Goplek AAB Uknown
Diperta Koja Santen
AAB Uknown
Diperta Toklek AAB
Sleman Diperta
Embok AAB Unknown
PKBT Kapas Tasikmalaya
AAB Tasikmalaya
PKBT Kepok Amerika
AAB Yogyakarta
PKBT Mandar AAB
Unknown PKBT
Nangka AAB Unknown
PKBT Raja Bulu
AAB Unknown
PKBT Raja
Sableng AAB Yogyakarta PKBT
Raja Sereh AAB
Unknown PKBT
Susu AAB Unknown
PKBT Austroli AAB
Jasinga Bogor
Bogor Jantan AAB
Unknown RIF
Kilita AAB Unknown
RIF Longong AAB
Unknown RIF
Mantra Ho AAB
Unknown RIF
Mantreken AAB Unknown
RIF Neij Amper
AAB Ransiki Manokwari
RIF Panggang
AAB Deli Serdang, North Sumatera
RIF Pup AAB
Unknown RIF
Barangan Merah ABB
Medan Diperta
Embuk Putih ABB
Giri Banyuwangi Diperta
Medan ABB Tegalsari
Girimulyo Diperta Sembuk ABB
Cukurgondang Pasuruan Diperta
Siam Paris ABB
Unknown Diperta
Wangu ABB Cipaku
Bogor Diperta
Kepok Kuning ABB
Gowa makasar PKBT
Kepok Manggala ABB
Unknown PKBT
Prabumulih ABB Unknown
PKBT Siam Manggala
ABB Unknown
PKBT Kepok Merah
ABB Jasinga
Bogor Klutuk Susu
ABB Unknown
RIF Unknown 1
ABB Karimunjawa
Central Java Unknown 2
ABB Karimunjawa
Central Java Unknown 3
ABB Karimunjawa
Central Java Unknown 4
ABB Karimunjawa
Central Java
Table 4.4 List of 43 accessions classified into BB, AAB and ABB genomic groups based on the primers MaCIR108 and Ma-3-90 continued
Accession Genomic group
Region Source
Collection
Unknown 5 ABB
Karimunjawa Central Java
Unknown 7 ABB
Karimunjawa Central Java
Unknown 8 ABB
Karimunjawa Central Java
Unknown 9 ABB
Karimunjawa Central Java
The seventy three accessions of AA or AAA; and AAA genomic groups should be designated under the name M. acuminata, 2 accessions of BB genomic
group under the name M. balbisiana, and 21 accessions of AAB and 20 acessions of ABB genomic groups under the name of nature hybrids M. x paradisiaca. The
number of pure acuminata was more dominant than balbisiana accessions and their hybrids. These results also supported the hypothesis that Indonesia is one of
main centre of diversity and centre of origin of M. acuminata Daniells et al. 2001 as previously reported in the first study Chapter II.
Most accessions were classified into genomic groups in agreement with the common local names. For example, accessions designated under the local name
‘Klutuk Hijau’ were identified as BB genomic group. The accessions using the local names ‘Sobo’, ‘Kepok’, and ‘Siam’ were commonly classified into ABB
genomic groups. It confirmed that basically, morphological characters especially in bananas containing the B genomes were sufficiently effective for genomic
group identification. However, the use of these characters required a long time waiting for flowers and fruits Stover and Simmonds 1987. Indeed, the
morphological characters were sometimes influenced by environmental factors Vicente et al. 2005.
Similar to the first study, accessions of M. acuminata only having 1 or 2 alleles were designated as AA or AAA genomic groups. Diploid accessions could
not be easily distinguished from triploid accessions because they did not have specific alleles to differentiate AA from AAA genomic groups. Furthermore, the
dosage effects of microsatellite allele simplex, duplex, triplex etc. can not be differentiated Zhang et al. 2000 because most cultivated bananas were nature
polyploid Stover and Simmonds 1987.
The triploid accessions having 2 alleles in a certain locus could not be differentiated from the diploid also having the same alleles.
According to
Oselebe et al
. 2006, the ploidy status of bananas could be identified by the chloroplast number in guard cells. The number of chloroplast
increased proportionally with the size of cells in response to increase in ploidy Tenkouano et al. 1998; Oselebe et al. 2006. Dolezel et al. 2004 suggested the
use of flow cytometry for determining ploidy level. Two banana cultivars, ‘Kluai Tiparot’ from Thailand and ‘Jambe’ from Indonesia have morphologically been
classified into tetraploids. Using the cytometric technique, ploidy level of these cultivars was identified as triploid. It indicated that there was no molecular
markers available yet that fulfill all requirements needed by researchers Semagn et al
. 2006. The advantage of application of the microsatellite markers is not recognized intermediate characters, thus genotype of each banana cultivar could
be precisely identified. The key as well as the scoring system created by Simmonds and Sheperd
1955 and Silayoi and Chamchalow 1987 are only applicable to bananas that contained the A and B genomes. The cultivated bananas consisted of 4 genomes
namely A, B, S, and T which were derived from M. acuminata, M. balbisiana, M. schizocarpa
and section Callimusa, respectively Pillay et al. 2004. The scoring system based on morphological characters did not consider cultivars with the S
and T genomes. Identification of those genomes using microsatellite markers could be performed if the specific primers were available.
Analysis of genetic relationships among banana germplasms in Indonesia
All microsatellite markers generated clear alleles and polymorphic banding patterns. Total 93 alleles were detected by the 8 markers. The number of alleles
per locus varied from 5 to 18, with an average of 11.6 alleles per locus. The size of alleles approximately from 110 to 436 bp with polymorphism degree per
primer ranged from 5 to 18 alleles. The highest degree of polymorphism was observed in the MaCIR108 and the lowest was detected in the MaCIR327b Table
4.5.
Table 4.5 Alleles size, number of alleles and observed heterozygosity value produced from analysis of the 116 accessions using the 8 microsatellite
primers
Primer Alleles size
range bp Number of
alleles Observed
heterozygosity MaCIR327b
388-436 5
0.45
Ma-1-132 330-378
9
0.51
MaCIR332a 260-296
11
0.85
MaCIR108 220-295
18
0.84
Ma-3-139 132-177
17
0.83
Ma-3-90 132-172
14
0.86
Ma-1-27 122-142
8
0.57
Ma-1-17 110-154
11
0.91
Total 93
Mean 11.6
0.73 The polymorphism of microsatellite loci detected in this study was
consistent with previously studied by Creste et al. 2004, but it was higher than that obtained by Creste et al 2003. Using 9 primers, Creste et al. 2004
observed an average of 12.8 alleles, ranging from 10 to 15 alleles in a group of 58 Musa
genotypes, including 49 AA and 9 AAB cultivars. On the other hands, Creste et al 2003 detected an average of 6.1 alleles at each of 11 microsatellite
loci studied in a group of 35 genotypes from various genomic composition and ploidy level. One possible reason for this difference is that all accessions used in
the study were originated from natural cultivars, thus they have a relatively wide genetic base.
The high genetic diversity and genetic relationships of banana accessions in Indonesia were exhibited by dendrogram in Figure 4.1. The dendrogram generated
by UPGMA from similarity data based on Jaccard coefficient separate the 116 banana accessions into 2 main clusters at coefficient of 0.13. All accessions
belonging to BB, AAB, and ABB genomic groups clustered in the first main
cluster I together with mostly accessions of the A genome alone. The second main cluster II was belonging to 11 accessions consisting of
acuminata cultivars, namely ‘Raja Madu’, ‘Ketan’, ’Oli’, ‘Lilin’, ‘Barifta’ A,
‘Ratu’ ‘Hutan Jambi’ and 4 unknown cultivars from Bogor. The two of them, ‘Raja Madu’and ‘Barifta’ A were identified as AAA triploids due to the presence
of 3 alleles of the MaCIR108 with the size of 270 bp or less.
Coefficient
0.13 0.35
0.57 0.78
1.00
37 15
S9 S7
14 54
57
17 12
11 13
S1 13
S4 S6
S7 11
12 K7
13
17 17
17 S3
S1 14
13 14
11 13
18 S8
S7
12 12
S2 S1
S8 S8
16 19
S3 S5
S1 S3
S4 S3
11 11
70 S1
10 S4
11 35
S3 12
12 16
S1 11
13 11
13 18
18 93
10 K2
K4 K9
38
48 11
12 K1
K3 K6
K8 K1
17 14
59 18
60
12 S3
S3 S8
S9 86
S6 S4
S3 12
13 13
S9
16 18
S5 10
12 62
13 40
S5 14
S9 S4
S3 S9
18 18
18 19
AAA Mas Lumut
AAA Udang AAA Udang
AAA Keikeni AAA Potho
Yogya AAA Gintung
AAA Kolis AAA Raja
Bening AAA Rotanhari
AAA Sabulan AAA Kutes
AAA Tanduk Lembu
AAA Potho Bunthek
AAA Aghaker AAA Ik
Osroc AAA Numbungga
AAA Ambon
Lumut A
AAA Ambon Lumut B
AAA Unknown 6
Karimunjawa AAA Badak
AAA Badak AAA Jepang
AAA Unknown
9 Bogor
AAA Lase AAA Buai
AAA Anjasmara AAB Kepok
Amerika AAB Raja
Sereh AAB Embok
AAB Susu AA or AAA
Pisang Kuning AA or AAA
Ramehaye AAA Sramfin
AAA Ampyang AAA Madura
AAA Lympyang AAA Awomen
AAA Neij
Houbwan AAA Pogori
AAA Sebrot AA or AAA
Unknown 8 Bogor AA or AAA
Jari Buaya AA or AAA
Kole AAA Dingin
AAA Ayam
AAA Neij Aubu
AAA Mourina AA or AAA
Mas Purbalingga AA or AAA
Mas 40 hari AA or AAA
Morli AA or AAA
Berlin AA or AAA
Lampung AA or AAA
Raja Muli AA or AAA
Jepang AA or AAA
Barley AAA Angleng
AAA Ice AAA Papan
AA or AAA Rejang
AAA Branjut AA or AAA
Lidi AAA Angleng
AA or AAA Sigung
AAA Segli AA or AAA
Unknown 5 Bogor AA or AAA
Unknown 6 Bogor ABB Barangan
Merah ABB Medan
ABB Unknown 2
Karimunjawa ABB Unknown
4 Karimunjawa
ABB Unknown 8
Karimunjawa ABB Embuk
Putih ABB Sembuk
ABB
Kepok Manggala ABB
Kepok Kuning ABB Unknown
9 Karimunjawa
ABB Unknown 3
Karimunjawa ABB Unknown
5 Karimunjawa
ABB Unknown 7
Karimunjawa ABB Unknown
1 Karimunjawa
ABB Kepok Merah
AAB Nangka AAB Koja
Santen AAB Austroli
AAB Goplek AAB Kapas
AAB Mantra Ho
AAB Jantan AAB Mantreken
AAB Panggang AAB Toklek
AAB Neij Amper
AAB Pup AAB Kilita
AAB Mandar
AAB Raja Sableng
AAB Raja Bulu
AAB Longong BB
Klutuk Hijau BB Unknown
1 Bogor
ABB Klutuk Susu
ABB Siam Paris
ABB Siam Manggala
ABB Wangu ABB Prabumulih
AAA Raja Madu
AA or AAA Ketan
AA or AAA Oli
AA or AAA Lilin
AAA Barifta A
AA or AAA Ratu
AA or AAA Hutan Jambi
AA or AAA Unknown 2 Bogor
AA or AAA Unknown 3 Bogor
AA or AAA Unknown 4 Bogor
AA or AAA Unknown 7 Bogor
Ia
Ib
II I
Figure 4.1 UPGMA clustering of the 116 banana accessions in Indonesia based on the 8 microsatellite primers
0.13 0.35 0.57 0.78 1.00 Coefficient
The other 9 accessions except ‘Ketan’, ‘Ratu’, ‘Oli’ and ‘Lilin’ were most probably wild diploid bananas because they had a small fruit with full seeds and
almost without pulp Stover and Simmonds 1987. Genetic relationship analysis among banana accessions of various genomic
groups, especially in the first main cluster I demonstrated that the accessions
containing the B genome namely BB, AAB and ABB were clearly distinct from each other. The result was similar to the study of Pillay et al. 2006. The BB
genomic group appears closer to the ABB genomic group. All banana accessions containing the B genome were clustered according to their genomic groups,
except 4 accessions of AAB, ‘Kepok Amerika’, ‘Raja Sereh’, ‘Embok’ and ‘Susu’ clustering together with accessions of the A genome alone.
Similarity coefficient at 0.18, dendrogram showed that the main cluster I was divided into 2 subclusters Ia and Ib. The subcluster Ia was belong to AA or
AAA; and AAA accessions and the 4 accessions of AAB. Clustering analysis based on microsatellite alleles could not significantly distinguished AA or AAA
from AAA genomic group. However, majority of these accessions tend to be clustered according to ploidy levels. Similar results were reported by Creste et al.
2004 and previous study in the first study Chapter II investigating genetic relationships among M. acuminata cultivars. The variations of microsatellites
within accessions of the A genome alone was higher than those of the B genome. The result is supported by the existence of 9 subspecies of M. acuminata in
Indonesia Daniells et al. 2001 which were clearly dominant in number over those in other regions of Southeast Asia Pollefeys et al. 2004.
The fourth banana accessions of AAB within subcluster Ia were separated from the subcluster Ib consisting of all accessions containing the B genome. It is
because the 4 accessions of AAB had a specific allele of the MaCIR108 with the size of 275 bp. This allele was not detected in the other genomic groups. These
AAB accessions were closely related to accessions of the A genome alone. Seventeen accessions of AAB had allele of the MaCIR108 with the size of 287 bp
which were also observed in several accessions of ABB. Thus, these AAB accessions were closely related to ABB.
Clustering analysis showed that microsatellite markers could discriminate each accession from others, except accessions which were known to be similar.
Only ninety nine genotypes resulted from analysis of the 116 accessions using the 8 primers because 26 accessions grouped within 9 identical genotypes Table 4.6.
Some of them were detected under the same local name and some the other were detected to be synonymous. In the study, there was also detected homonymous
because multiple genotypes with a single name were found, such as ‘Ambon Lumut’ A and ‘Ambon Lumut’ B from PKBT collection, ‘Jepang’ from Bogor
and ‘Jepang’ from PKBT collection, ‘Angleng’ from RIF and ‘Angleng’ from PKBT collection.
Table 4.6 Nine identical genotypes observed in the 116 banana accessions based on the 8 microsatellite primers
Identical genotypes
Number of accessions
Accession Group genome
based on microsatellites
Source
1 2 Udang
AAA Bogor Udang
AAA RIF
2 2 Badak AAA PKBT
Badak AAA
Bogor 3
4 Mas 40 Hari
AA or AAA PKBT
Morli AA
or AAA
Diperta Berlin
AA or
AAA RIF
Lampung AA
or AAA
PKBT 4 4
Medan ABB Diperta
Unknown 2
ABB Karimunjawa
Unknown 4
ABB Karimunjawa
Unknown 8
ABB Karimunjawa
5 3 Kepok
Manggala ABB PKBT
Kepok Kuning
ABB PKBT
Unknwon 9
ABB Karimunjawa
6 3 Unknown
3 ABB Karimunjawa
Unknown 5
ABB Karimunjawa
Unknown 7
ABB Karimunjawa
7 4 Kapas AAB PKBT
Mantra Ho
AAB RIF
Jantan AAB
RIF Mantreken
AAB RIF
8 2 Klutuk
Hijau BB Bogor
Unknown 2
BB Bogor 9 2
Siam Paris
ABB PKBT Siam Manggala
ABB PKBT
CONCLUSION
One hundred and sixteen banana accessions were firstly identified using the primers MaCIR108 and Ma-3-90. These accessions were effectively classified
into their genomic groups, which are 27 accessions of AA or AAA; 46 accessions of AAA; 2 accessions of BB, 21 accessions of AAB, and 20 accessions of ABB.
The accessions of AA or AAA; and AAA should be placed into M. acuminata due to the presence of only the MaCIR108 alleles with the size of 270 bp or less. The
accessions of BB should be placed into M. balbisiana as they only have one allele of the MaCIR108 with the size of 295 bp without allele of 270 bp or less. The
accessions of AAB and ABB should be classified into M. x paradisiaca due to the presence of the MaCIR108 alleles with the size of more than 270 bp and 270 bp or
less as diagnostic characters for the B and the A genomes. The Ma-3-90 allele was employed to distinguish AAB from ABB genomic groups. One allele of the Ma-3-
139 with the size of 132 bp was also confirmed as diagnostic character for the B genome which can separate banana accessions containing the B genome from
accessions with the A genome alone. Ploidy level of several accessions of the A genome alone could not be definitely determined due to the dosage effect of
microsatellite and the absence of a specific allele for each ploidy level. Analysis of the 116 accessions based on the 8 primers detected only 99
genotypes because 26 accessions grouped within 9 identical genotypes. The dendrogram generated by UPGMA split the 116 accessions into 2 main clusters at
coefficient of 0.13. All accessions belonging to BB, AAB, and ABB clustered in the first main cluster together with most accessions of the A genome alone. The
second main cluster was belonging to 11 accessions consisting of AA or AAA; and AAA. The first main cluster demonstrated that the accessions containing the
B genome: BB, AAB and ABB were clearly distinct from each other. The BB appears closer to the ABB than AAB genomic groups and distantly separated
from AA or AAA; and AAA.
The dendrogram of genetic relationships showed that the banana accessions clustered according to their genomic groups especially for accessions containing
the B genomes, while the accessions with the A genomes alone could not be differentiated significantly, although majority of them tend to be clustered
according to ploidy level.
V. PHYLOGENETIC RELATIONSHIPS OF INDONESIAN BANANA CULTIVARS INFFERED FROM