Directory UMM :Data Elmu:jurnal:J-a:Journal of Experimental Marine Biology and Ecology:Vol254.Issue2.Nov2000:

(1)

254 (2000) 235–247

www.elsevier.nl / locate / jembe

Population genetics of black abalone, Haliotis cracherodii,

along the central California coast

* D.E. Hamm, R.S. Burton

Marine Biology Research Division, Scripps Institution of Oceanography, University of California, San Diego, La Jolla, CA 92093-0202, USA

Received 2 May 2000; received in revised form 13 July 2000; accepted 11 August 2000

Abstract

Over the past three decades, the black abalone, Haliotis cracherodii, has experienced precipitous declines in abundance over portions of its range in southern and central California. The potential for recovery of these populations is dependent in part on dispersal processes; that is, can distant populations serve as sources of recruits to locales that no longer harbor H. cracherodii? Here we use population genetic analysis to assess levels of population subdivision and infer recruitment processes. Epipodial tissue samples were obtained from over 400 black abalone from seven geographic sites between Santa Cruz and Santa Barbara counties in central California. Allelic frequencies were determined for each population at three polymorphic enzyme-encoding loci (GPI, AAT-1 and PGM). Significant allelic frequency differentiation among sites was observed at all three loci. Genetic distance was found to be independent of geographic distance over the approximately 300-km sampling range. In addition, a limited number of DNA sequences (total N551) were obtained for the mitochondrial cytochrome oxidase subunit I gene (COI) from five of the populations. Since the same common COI haplotype dominated each population, this analysis had little statistical power and failed to detect population structure. The observed level of population differentiation at allozyme loci was three-fold higher than that observed in California red abalone, H. rufescens. The species differ in their breeding period and it is suggested that the relatively short, summer breeding season of black abalone limits dispersal because larvae experience reduced variance in oceanographic conditions relative to red abalone that spawn year-round. Based on these results, rates of recolonization and recovery of locally depressed or extirpated black abalone populations are likely to be slow despite harvest restrictions.  2000 Elsevier Science B.V. All rights reserved.

Keywords: Haliotis cracherodii; Population genetics; Allele frequency; Polymorphic enzyme-encoding loci

*Corresponding author. Tel.: 11-858-534-7827; fax: 11-858-534-7313. E-mail address: [email protected] (R.S. Burton).

(2)

1. Introduction

Over the past three decades, several abalone species (genus Haliotis) have ex-perienced precipitous declines in abundance over portions of their range in southern and central California. A variety of factors have probably contributed to these declines, including overexploitation, pollution and habitat degradation, and epidemic disease (Haaker et al., 1992; Altstatt et al., 1996). Given that these species have previously supported significant commercial fisheries, the prospects for future recovery of affected populations are of great interest. In an effort to promote stock restoration, a moratorium on all abalone harvesting in southern California is now in place, so any recovery will depend primarily on aspects of abalone natural history. Given that some formerly abundant local populations of abalone are now extirpated, the potential for the natural recovery of such populations is dependent on dispersal processes. Like other inverte-brates with pelagic larvae, abalone have significant potential for long distance dispersal and subsequent gene flow. However, larval duration is generally short [on the order of 5–15 days, (Leighton, 1974)] and the frequency of interpopulation dispersal is unknown. Because direct measurement of dispersal of small, pelagic larvae is typically impractical, estimation of dispersal in such systems frequently relies on indirect population genetic measures of gene flow. Despite the value of these fishery resources, few data address the genetic structure of any abalone species (Withler, 2000). Of California species, only the red abalone, Haliotis rufescens, has been studied from a population genetics perspective. Gaffney et al. (1996) and Burton and Tegner (2000) found evidence for weak differentiation among California populations of H. rufescens at the AAT-1 allozyme locus; other allozyme loci and mtDNA sequences showed no differentiation. Similarly, Kirby et al. (1998) found no differentiation between northern and southern California H. rufescens populations at a single microsatellite locus. No published population genetic data exist for any of the other three commercially significant California species (H. corrugata, H. fulgens, and H. cracherodii). However, data from other coastlines suggest that there may be substantial variation in population structure among abalone species. For example, Jiang et al. (1995), found fixed differences in mitochondrial DNA haplotypes between neighboring populations (35 km apart) of Taiwanese abalone, H. diversicolor, suggesting a complete lack of genetic exchange on this geographic scale (although an alternate explanation that samples represent different cryptic species cannot be excluded). In contrast, allozyme surveys in Australia of H. rubra found only minor differentiation among populations (Brown, 1991). Although local populations of H. laevigata in Australia were found to be somewhat more genetically divergent than those of H. rubra, genetic distances among these populations were still quite small (Brown and Murray, 1992). Hence, the levels of differentiation in H. laevigata and H. rubra are consistent with at least some degree of genetic exchange across broad geographic distances.

Because knowledge of dispersal and population structure is central to the development of abalone conservation and management plans, we have initiated population genetic studies of the black abalone, Haliotis cracherodii, along its present range on the central California mainland. H. cracherodii occurs higher in the intertidal zone than any of the other California abalone species (Morris et al., 1980). Formerly abundant, H. crach-erodii populations in southern California have all but disappeared. In part, the population

(3)

declines can be attributed to heavy fishing pressure (Karpov et al., 2000). As stocks of more desirable abalone species declined, a commercial fishery for black abalone developed in the late-1960s and peaked in the mid-1970s. In addition to fishing pressure, mainland populations were also likely impacted by coastal development and pollution (Altstatt et al., 1996). In the mid-1980s, black abalone populations in the northern Channel Islands experienced mass mortalities that cannot be attributed to human activities; a wasting disease called withering syndrome (WS) appears to be the primary cause of the decline (Haaker et al., 1992; Altstatt et al., 1996). WS continues to cause high mortality in black abalone populations and is now spreading among mainland populations (Altstatt et al., 1996). At the present time, no significant California mainland populations are known to exist south of the Point Conception area.

Here we report the results of population genetic analyses of seven Haliotis crach-erodii populations sampled along the central California coast. Our objective was to determine the pattern and degree of population differentiation over the geographic region where the species remains moderately abundant. The data provide some insight into the genetic structure of black abalone populations and suggest that low levels of interpopula-tion larval dispersal may prevent rapid recovery of depleted populainterpopula-tions despite protection from human harvesting.

2. Methods and materials

Black abalone were collected from deep cracks and crevices in rocky habitat during minus tides between July 1997 and November 1998. Most animals were found in the high to mid intertidal zone (Ricketts et al., 1968; Morris et al., 1980). Collecting sites (Fig. 1) included Vandenberg Marine Ecological Reserve (located at Pt. Arguello, Santa Barbara County), Cambria and San Simeon in San Luis Obispo County, Big Creek Marine Ecological Reserve (located on the Big Sur coast), Carmel Point (located

immediately south of the town of Carmel), and Point Pinos (Monterey County) and Scotts Creek (Santa Cruz County). C. Friedman (Bodega Marine Lab) kindly provided additional samples from Carmel Point and Vandenberg MER sites to supplement our field collections.

Sampled individuals varied in size from approximately 3 to 25 cm. Due to temporal variation in growth, size is not a reliable measure of age (Morris et al., 1980). Samples therefore represent a cross section of ages in the population. Tissue samples were obtained by removing the animal from the substrate, clipping a small piece of epipodium or a few epipodial tentacles and then replacing the animal on the substrate. Similar repeated sampling of abalone kept in lab aquaria did not result in any mortality, suggesting that our field sampling was non-destructive. Typical samples consisted of approximately 40 mg of tissue; the bulk of the sample was used for protein electro-phoresis and a small piece of sample was used as a DNA source for PCR amplification. Samples were transported in liquid nitrogen and stored at 2808C.

2.1. Protein electrophoresis

(4)

Fig. 1. Map of coastal California sampling sites for Haliotis cracherodii.

(1981). The enzymes examined were: aspartate aminotransferase (the faster migrating of two loci, AAT-1, EC 2.6.1.15GOT), phosphoglucomutase (PGM, EC 5.4.2.2) and glucose-6-phosphate isomerase (GPI, EC 5.3.1.9). Interpopulation comparisons were facilitated by having multiple populations represented on each gel. The genetic basis for electrophoretic variation was inferred from agreement of electrophoretic banding patterns with the presumed subunit structure of the enzyme (AAT and GPI are dimers and PGM is a monomer) and from an approximate fit of phenotype frequencies to Hardy–Weinberg expected proportions. Population genetic statistics were calculated using POPGENE 1.21 (Yeh and Boyle, 1997). Contingency tables were used to compare allelic counts across populations and for tests for deviations from Hardy–Weinberg genotypic proportions. Levels of population subdivision were estimated using Wright’s standardized variance in allelic frequencies (F ); significance of FST ST values was determined using the methods described in Waples (1987). Genetic distance was estimated using Nei’s unbiased D (1978). Geographic distance measurements were shortest distance across water according to Rand McNally Road Atlas.

(5)

2.2. DNA sequencing

DNA was extracted by heating approximately 6 mg of tissue to 1008C in 200 ml of 10% chelating resin (Sigma Chemical) in deionized water for 8 min. DNA from the mitochondrial gene cytochrome oxidase subunit I was amplified by the polymerase chain reaction (PCR) using 35 cycles of 958C (60 s), 508C (60 s), and 728C (90 s) with primers designed for abalone COI, ABCOI F (forward): 59TGATCCGGCTTAGTCGGACTGC 39 and ABCOI R (reverse): 39GATGTCTTGAAATTACGGTCGGT 59 (Metz et al., 1998). The resulting 580-bp fragment was sequenced using an Applied Biosystems 373A DNA sequencer with primer ABCOI F and Big Dye Terminator RR chemistry (Applied Biosystems). Sequences were aligned with SEQUENCHER 3.1 (Genecodes) and analyzed with PAUP4.02 (Swofford, 1999) and DNASP 3.0 (Rozas and Rozas, 1999).

3. Results

Allelic frequencies for three polymorphic allozyme loci in the seven populations sampled are summarized in Table 1. Failure to resolve additional loci was due in part to the restricted nature of tissue available due to our non-destructive sampling of epipodial tissue. Across the three loci and seven populations, only two tests (of 21) revealed significant departures from Hardy–Weinberg expected genotypic proportions. The two

Table 1

a Allelic frequencies for Haliotis cracherodii at seven sites in California Locus Population

allele

V Cam SS BC CP Asl SC

PGI

A 0.004

B 0.021 0.043 0.021 0.049 0.022

C 0.949 0.931 0.952 0.938 0.923 0.968 0.946

D 0.025 0.026 0.048 0.042 0.028 0.032 0.033

2N 236 116 62 48 142 94 92

PGM

A 0.610 0.593 0.638 0.625 0.635 0.737 0.842

B 0.009 0.213 0.121 0.146 0.151 0.059

C 0.326 0.157 0.155 0.188 0.167 0.144 0.125

D 0.055 0.037 0.086 0.042 0.048 0.059 0.033

2N 236 108 58 48 126 118 120

AAT-1

A 0.744 0.707 0.714 0.413 0.757 0.807 0.620

B 0.074 0.071 0.283 0.110 0.016 0.121

C 0.182 0.293 0.214 0.304 0.132 0.177 0.259

2N 242 116 56 46 136 124 116

Population names are abbreviated as: Vandenberg Marine Ecological Reserve (V), Cambria (Cam), San Simeon (SS), Big Creek Ecological Reserve (BC), Carmel Point (CP), Asilomar (Asl), Scotts Creek (SC).

(6)

deviations both involved the weakly polymorphic GPI locus (Vandenberg and Cambria samples where most common allele .0.93) and do not appear to reflect any pattern of systematic departures from Hardy–Weinberg equilibrium. The negative and positive values of FIS (Table 2) at the other two loci (PGM and AAT-1, respectively) confirm the lack of systematic departures from Hardy–Weinberg equilibrium in black abalone.

Significant heterogeneity in allelic frequencies among sites was detected at all three loci (Table 2). Although the identity of the most common allele did not differ across populations for any of the loci, the frequency of the most common allele at PGM and AAT-1 varied significantly (when all other alleles were pooled). Among the less

common alleles, the PGM allele, which was not observed among 60 individuals sampled at Scotts Creek, reached a frequency of 0.213 at Cambria (N554). Similarly,

the AAT-1 allele, absent at Cambria, occurred at a frequency of 0.283 at Big Creek (N523). There was no pattern across populations regarding the absence of the less common alleles; of the eleven alleles observed in the study, at least nine were found in each population. Hence, even where field sampling located relatively few abalone (e.g., Big Creek), there was no clear evidence of genetic impoverishment.

Estimates of FST for each locus and the mean over all alleles are presented in Table 2 along with total sample sizes; values for AAT-1 and PGM were significantly different from zero and, like the heterogeneity of allelic frequencies, indicate significant population differentiation. Based on mean F , Nm is estimated to be approximately 6.2,ST a value that suggests enough interpopulation exchange to prevent extensive population differentiation. To reconcile the significant allelic frequency differentiation with the rather high estimate of gene flow, pairwise estimates of genetic distance were calculated and compared with geographic distances measured between sample sites (Table 3). In the two cases where population samples came from locales separated by |10 km (Cam-SS and CP-Asl), genetic distances were very low (0.001 in both cases). However, there was no consistent relationship between geographic and genetic distances for the

remaining comparisons (r 50.01, P.0.25). Interestingly, all the largest pairwise

Table 2

Results of contingency table tests of heterogeneity of allelic counts (G) and estimates of F , FIS STand Nm for all loci

Locus

PGI PGM AAT-1 Mean

G 34.284 105.735 65.915

df 18 18 12

p 0.012 0.000 0.000

FIS 0.269 20.017 0.124

FST 0.009 0.032 0.054 0.039

Nm 27.562 7.498 4.400 6.178

2N 790 814 836 813

(7)

Table 3

Nei’s (1978) unbiased genetic distance below and geographic distance (km) above the diagonal

Population V Cam SS BC CP Asl SC

Vandenberg – 123 132 202 262 274 305

Cambria 0.012 – 9 79 139 151 182

San Simeon 0.009 0.001 – 70 130 142 173

Big Creek 0.050 0.057 0.033 – 60 72 103

Carmel Point 0.012 0.005 0.000 0.044 – 12 43

Asilomar 0.022 0.013 0.003 0.043 0.001 – 31

Scotts Creek 0.029 0.015 0.015 0.029 0.025 0.032 –

distances involved the BC population which is located in the middle of the sampled geographic range. The divergent nature of the BC sample is clearly shown in the UPGMA phenogram constructed from the pairwise genetic distances (Fig. 2). However, even when the BC population is excluded from the data set, there is still no significant

relationship between geographic and genetic distances (r 50.09, P.0.25).

A total of 51 partial DNA sequences (382 bp in length) of the mtDNA encoded cytochrome oxidase subunit I gene were obtained from the Haliotis cracherodii samples. Sequence differences between COI haplotypes and the distribution of each haplotype within five population samples are shown in Table 4. Nucleotide position 1 corresponds to nucleotide position 37 for H. cracherodii mitochondrial COI in GenBank (accession [ _{AF060848). Of twelve observed haplotypes, one (designated} [_{1) was the most} common at all sites and accounted for 34 of the total of 51 sequences. The second most common haplotype ([ _{2) differed from haplotype}[_{1 by a single base change and was} observed in four of the five sampled populations. All other haplotypes were only observed once. Haplotype diversity over the entire sample was 0.54460.08 (mean6S.D.)

Fig. 2. Genetic relationships among populations of Haliotis cracherodii using a UPGMA dendrogram based on Nei’s unbiased genetic distances.

(8)

Table 4

Sequence variation among haplotypes and the distribution of haplotypes across geographic samples of H. a

cracharodii

Haplotype Nucleotide position Population

1 1 1 2 2 2 2 3 3 V Cam BC CP SC

1 1 5 0 6 7 1 2 2 9 1 4

2 5 1 5 5 7 3 2 3 4 8 5

1 G G C G C A A A G A A A 10 5 7 6 6

2 G G T G C A A A G A A A 1 2 3 1

3 G A T G C A A A G A A A 1

4 G G T G T A A A G A A A 1

5 G G T G C A A A G G A A 1

6 G G C A C A A A G A A A 1

7 G G C G C A A G G A A A 1

8 G G C G C A A A G A G A 1

9 G G C A C G A A G A G A 1

10 G G C G C A A A A A A A 1

11 A G C G C A A A G A A G 1

12 G G C G C A G A G A A A 1

Haplotype[_{1 is identical in sequence to GenBank AF060848 submitted by Metz et al. (1998).}

and nucleotide diversity ( p) was 0.00217. With this relatively small sample of sequences, no significant population differentiation was evident.

4. Discussion

Previous work on the genetic structure of natural populations of abalone has yielded variable results. The allozyme data collected here demonstrates significant genetic differentiation among H. cracherodii populations along the central California coast. The observed mean FST value (0.039), is considerably higher than that observed in other abalone allozyme studies. Allozyme analyses of three H. rufescens populations (using the same three loci used in the present study), yielded an estimate of FST of only 0.012, which was not significantly different from zero (Burton and Tegner, 2000). Data on other abalone species are typically consistent with this lower estimate of population subdivision [e.g., FST values of 0.022 and 0.014 for H. rubra and H. laevigata, respectively (Withler, 2000)]. Hence, population subdivision in H. cracherodii is more pronounced than that estimated with allozyme analyses in other abalone species studied to date.

Based on these results, we initiated studies of mtDNA sequence variation. In particular, we sought to compare population structure in H. cracherodii to the striking differentiation observed in H. diversicolor using mtDNA haplotypes (Jiang et al., 1995). Contrary to that study, we found no evidence for mtDNA differentiation in black abalone. In fact, only low levels of mtDNA variation were detected in the COI gene in black abalone. Both haplotype diversity and nucleotide diversity were substantially lower than those observed for COI in H. rufescens [0.54 vs. 0.83 for haplotype diversity

(9)

and 0.0022 vs. 0.0044 for nucleotide diversity (Burton and Tegner, 2000)]. Various hypotheses may be proposed regarding the low genetic diversity in black abalone mtDNA, such as a population bottleneck or recent selective sweep. However, the current data set does not permit discrimination among these and other possible explanations.

Using FST values calculated from the allozyme data, levels of gene flow among H. cracherodii populations are estimated to be relatively high (Nm.4 for even the most differentiated locus and Nm.6 for the mean F ). However, as recently reviewed byST Bossart and Prowell (1998) and Whitlock and McCauley (1999), a large number of caveats surround the interpretation of FST and the corresponding estimates of Nm. In particular, such summary statistics fail to take into account various aspects of demographic and population genetic instability common to many study systems. Hence, analyses of the allelic frequency differences themselves may be as insightful as consideration of FST.(Bossart and Prowell, 1998). In this regard, two aspects of the data merit special attention. First, the degree of differentiation in the frequencies of less common alleles is rather remarkable; even with sample sizes of only 50 alleles, the absence of alleles present in frequencies of greater than 0.2 in other populations is highly significant and likely indicates considerably restricted gene flow among populations. Although the absence of alleles in a given population may reflect a founder event or historical population bottleneck (as suggested by the low mtDNA diversity), the lack of consistency across loci does not make this a strong hypothesis in the current case. Furthermore, even if the loss of alleles is due to a population bottleneck, absence of such alleles across the numerous cohorts represented in our sampling also points to a persistent restriction of interpopulation gene flow.

A second notable feature of the allozyme data is apparent from the UPGMA dendrogram: based on pairwise genetic distances, the Big Creek population, located in the middle of the sampled range, was the most divergent of the samples. As might be anticipated, the two pairs of neighboring populations (Asilomar / Carmel Point and San Simeon / Cambria) showed low genetic divergence; however, the smallest genetic distance measured was between Carmel Point and San Simeon, separated by 130 km. Within the limitations of the present data set, there does not appear to be a significant relationship between genetic and geographic distance (even when the disparate Big Creek population is removed from the analysis). The extent to which the small sample size from Big Creek contributes to its high level of divergence is difficult to assess. Appropriate habitat at Big Creek is limited and the site only supports a small number of H. cracherodii; hence stochastic factors may contribute either via random drift in a small natural population or via sampling error in estimating allelic frequencies. We attempted to evaluate these alternatives by resampling Big Creek but were unable to locate any H. cracherodii upon a return visit to the site.

Aside from the analyses presented here for black abalone, the only other studies of abalone population structure in North America concern the red abalone, H. rufescens. Although both Gaffney et al. (1996) and Burton and Tegner (2000) found minor allele frequency differences at the AAT-1 allozyme locus between samples of H. rufescens from northern and southern California, and no significant differences were observed at two other polymorphic allozyme loci. Furthermore, mtDNA sequence data from the COI gene (Burton and Tegner, 2000) and data on allelic frequencies at one microsatellite

(10)

locus (Kirby et al., 1998) failed to find evidence for differentiation between northern and southern California H. rufescens populations. Hence, available evidence suggests that there are substantial differences in the population structure of the two California haliotids studied to date, with geographically more widespread sampling of red abalone showing less population genetic divergence than reported here for black abalone.

A partial explanation for the differences in population structure between abalone species may lie in the pattern of spawning. While H. rufescens spawn continuously throughout the year, other California haliotids, including H. cracherodii, are more seasonal (Boolootian et al., 1962; Morris et al., 1980). Black abalone spawn primarily in the summer, when individuals lose about 20% of tissue wet weight. The longer spawning season means that H. rufescens larvae will experience a broader range of oceanographic conditions and might, therefore, have greater realized dispersal. Such dispersal, in turn, may account for the low genetic divergence among populations. In contrast, H. cracherodii larvae will experience a more limited range of oceanographic conditions during its reduced spawning season and consequently realize reduced dispersal (resulting in more population differentiation). Tegner (1993) invoked this explanation for observed differences in the recovery of abalone populations following the destruction of the kelp beds off of Palos Verdes peninsula; red abalone stocks showed significantly better recovery despite the fact that other species (pink and green abalone) were previously dominant at the site.

Previous investigations of the relationship between larval dispersal and the extent of population genetic differentiation in invertebrates have focused largely on the duration of the larval period (e.g., Berger, 1973; Gooch, 1975; Burton, 1983; Hellberg, 1996) and the strength and patterns of ocean currents (e.g. Roberts, 1997). A role for larval behavior has also been widely recognized (e.g., Burton and Feldman, 1982). The comparison here between red and black abalone suggests that the duration of the spawning season may also impact a species’ dispersal success. Although the genetic consequences of seasonal changes in larval dispersal patterns may be dramatic, they have previously received little attention. For example, Kordos and Burton (1993) found that levels of population differentiation among Callinectes sapidus megalopae varied with season, suggesting that effective dispersal vectors varied greatly with time of year. By spawning throughout the year (at the Texas study sites), C. sapidus experiences a broad range of oceanographic conditions and dispersal regimes that might not be available to a species with a short spawning period. This may account for the relatively low levels of divergence among adult C. sapidus populations (Kordos and Burton, 1993; McMillen-Jackson et al., 1994).

The importance of spawning season on dispersal depends on the extent of temporal variation in ocean currents. Along the coast of California, seasonal changes in coastal oceanographic conditions are profound (e.g. Browne, 1994). On-going ocean current investigations in the Santa Barbara Channel-Santa Maria Basin Circulation Study (Center for Coastal Studies, Scripps Institution of Oceanography; see website: http: / / www-ccs.ucsd.edu / research / sbcsmb / drifters / ) provide interesting data in this regard (see examples in Fig. 3). The Santa Maria Basin lies near the center of our black abalone sampling range. Trajectories of drifters released near the coast in the Basin during winter versus summer frequently show substantial differences. In general, winter trajectories

(11)

Fig. 3. Trajectories of drifters released in the Santa Maria Basin: (A) December 1996, drifters 363–364 (each was tracked for 14 days), and (B) July 1997, drifters 419 (tracked for 38 days)–420 (beached in 3 days).

span much greater distances than summer trajectories, although both show interannual variation. As is apparent from the plotted trajectories, transport by currents in the summer (when black abalone spawn) would be quite limited compared to that observed in winter. Red abalone, which spawn throughout the year (with a peak in winter, Boolootian et al., 1962) would be expected to experience enhanced dispersal potential. These expectations are consistent with the three-fold higher levels of population differentiation (based on FST values) observed in black versus red abalone.

Despite their pelagic larval stages, ecological observations have previously indicated that pink(H. corrugata) and green (H. fulgens) abalone are poor dispersers / colonizers (Tegner, 1993). Based on our population genetic analysis, we suspect that black abalone, H. cracherodii, fit this pattern as well. In the two cases where we obtained samples within 12 km of one another, no genetic differentiation was observed, suggesting that effective dispersal and gene flow occurs on that spatial scale. Although the data on genetic differentiation are not consistent with extensive longer distance dispersal, the fact that most alleles and haplotypes are shared across all sampled populations suggests that these populations have a recent common ancestry and / or on-going low levels of gene flow. This apparent discrepancy between allelic distributions and significant differences in their frequencies is likely due to differences in the time scales relevant to different processes: even low levels of dispersal may yield sufficient gene flow to spread alleles across the species range over long periods of time. Whether such spread is due to persistent low levels of larval exchange or rare episodic events cannot be distinguished with the present data; however, in either case, levels of dispersal are unlikely to provide sufficient recruitment for recovery of fishery stocks even over the course of decades (Tegner, 2000). These inferences have two implications for the strategy of using marine protected areas to enhance abalone fishery resources. On the one hand, the data suggest

(12)

that such protected areas may not be an effective source of recruits for the enhancement / reestablishment of distant populations; on the other hand, the data suggest that there may be sufficient local recruitment that populations isolated in protected areas can be self-sustaining. These inferences drawn from genetic data provide independent support for similar conclusions derived from combined consideration of abalone life history and empirical oceanographic studies (e.g. Tegner and Butler, 1985; Tegner, 1993, 2000).

Acknowledgements

We thank C.S. Friedman, P.L. Haaker, and I. Taniguchi for assistance in obtaining the samples, and M. Tegner for helpful discussions and comments on the manuscript. T. Ballard provided laboratory assistance. The genetic analyses were completed under the sponsorship of the California Department of Fish and Game, Marine Resources Protection Act, Marine Ecological Reserves Research Program administered by Califor-nia Sea Grant College System under grant number FG-5335MR, project number R / M-1. D.E.H .also received partial support from a Sea Grant Traineeship under grant number NOAA NA66RG0477, project number R / F-170. [SS]

References

Altstatt, J.M., Ambrose, R.F., Engle, J.M., Haaker, P.L., Lafferty, K.D., Raimondi, P.T., 1996. Recent declines of black abalone Haliotis cracherodii on the mainland coast of central California. Mar. Ecol. Prog. Ser. 142, 185–192.

Berger, E.M., 1973. Gene–enzyme variation in three sympatric species of Littorina. Biol. Bull. 145, 83–90. Browne, D.R., 1994. Oceanic circulation in and around the Santa Barbara channel. In: Halvorson, W.L., Maender, G.J. (Eds.), The Fourth California Islands Symposium: Update On the Status of Resources. Santa Barbara Museum of Natural History, Santa Barbara, CA, pp. 27–34.

Boolootian, R., Farmanfarmaian, A.A., Giese, A.C., 1962. On the reproductive cycle and breeding habits of two western species of Haliotis. Biol. Bull. 122, 183–193.

Bossart, J.L., Prowell, D.P., 1998. Genetic estimates of population structure and gene flow: limitations, lessons and new directions. Trends in Ecol. Evol. 13, 202–206.

Brown, L.D., 1991. Genetic variation and population structure in the blacklip abalone, Haliotis rubra. Aust. J. Mar. Freshwater Res. 42, 77–90.

Brown, L.D., Murray, N.D., 1992. Populations genetics, gene flow, and stock structure in Haliotis rubra and Haliotis laevigata. In: Shepherd, S.A. et al. (Ed.), Abalone of the World: Biology, Fisheries, and Culture. Proceedings of the First International Symposium on Abalone. Blackwell Scientific Publications,, Cambridge, pp. 24–33.

Burton, R.S., 1983. Protein polymorphisms and genetic differentiation of marine invertebrate populations. Mar. Biol. Lett. 4, 193–206.

Burton, R.S., Feldman, M.W., 1981. Population genetics of Tigriopus californicus: II Differentiation among neighboring populations. Evolution 35, 1192–1205.

Burton, R.S., Feldman, M.W., 1982. Population genetics of coastal and estuarine invertebrates: does larval behavior influence population structure. In: Kennedy, V.S. (Ed.), Estuarine Comparisons. Academic Press, NY, pp. 537–551.

Burton, R.S., Tegner, M.J., 2000. Enhancement of red abalone (Haliotis rufescens) stocks at San Miguel Island: reassessing a success story. Mar. Ecol. Prog. Ser. 2000, 303–308.

(13)

Gaffney, P.M., Rubin, V.P., Hedgecock, D., Powers, D.A., Morris, G., Hereford, L., 1996. Genetic effects of artificial propagation — signals from wild and hatchery populations of red abalone in California. Aquaculture 143, 257–266.

Gooch, J.L., 1975. Mechanisms of evolution and population genetics. In: Kinne, O. (Ed.), Physiological Mechanisms. Marine Ecology, Vol. II. Wiley, London, pp. 329–409.

Haaker, P.L., Parker, D.O., Togstad, H., Richards, D.V., Davis, G.E., Friedman, C.S., 1992. Mass mortality and withering syndrome in black abalone, Haliotis cracherodii, in California. In: Shepherd, S.A., Tegner, M.J., Guzman del Proo, S.A. (Eds.), Abalone of the World: Biology, Fisheries and Culture. Fishing News Books, Oxford, pp. 214–224.

Hellberg, M.E., 1996. Dependence of gene flow on geographic distance in two solitary corals with different larval dispersal capabilities. Evolution 50, 1167–1175.

Jiang, L., Wu, L W., Huang, P.C., 1995. The mitochondrial DNA of Taiwan abalone Haliotis diversicolor Reeve, 1846 (Gastropoda: Archaeogastropoda: Haliotidae). Molec. Mar. Biol. Biotech. 4, 353–364. Karpov, K.A., Haaker, P.L., Taniguichi, I., Rogers-Bennett, L., 2000. Serial depletion and the collapse of the

California abalone fishery. Can. Spec. Pub. Fish. Aquat. Sci. (in press).

Kirby, V.L., Villa, R., Powers, D.A., 1998. Identification of microsatellites in the California red abalone, Haliotis rufescens. J. Shellfish. Res. 17, 801–804.

Kordos, L.M., Burton, R.S., 1993. Genetic differentiation of Texas Gulf coast populations of the blue crab Callinectes sapidus. Mar. Biol. 49, 363–375.

Leighton, D.L., 1974. The influence of temperature on larval and juvenile growth in three species of southern California abalone. Fish. Bull. 72, 1137–1145.

McMillen-Jackson, A.L., Bert, T.M., Steele, P., 1994. Population genetics of the blue crab, Callinectes sapidus: modest population structuring in a background of high gene flow. Mar. Biol. 118, 53–65. Metz, E.C., Robles-Sikisaka, R., Vacquier, V.D., 1998. Nonsynonymous substitution in abalone sperm

fertilization genes exceeds substitution in introns and mitochondrial DNA. Proc. Natl. Acad. Sci. USA 95, 10676–10681.

Morris, R.H., Abbott, D.P., Haderlie, E.C., 1980. Intertidal Invertebrates of California. Stanford University Press, Stanford, CA.

Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590.

Ricketts, E.F., Calvin, J., Hedgpeth, J.W., 1968. Between Pacific Tides, 4th Edition. Stanford University Press, Stanford, CA.

Roberts, C.M., 1997. Connectiviy and management of Caribbean coral reefs. Science 278, 1454–1457. Rozas, J., Rozas, R., 1999. DNASPversion 3: an integrated program for molecular population genetics and

molecular evolution analysis. Bioinformatics 15, 174–175.

Swofford, D.L., 1999. PAUP (Phylogenetic Analysis using Parsomony) Version 4. Sinauer Associates,

Sunderland, MA.

Tegner, M.J., 1993. Southern California abalones: can stocks be rebuilt using marine harvest refugia? Can. J. Fish. Aquat. Sci. 50, 2010–2018.

Tegner, M.J., 2000. Abalone (Haliotis spp.) enhancement in California: what we’ve learned and where we go from here. Can. Spec. Pub. Fish. Aquat. Sci. (in press).

Tegner, M.J., Butler, R.A., 1985. Drift tube study of the dispersal potential of green abalone (Haliotis fulgens) larvae in the Southern Californian bight: implications for recovery of depleted populations. Mar. Ecol. Prog. Ser. 26, 73–84.

Waples, R.S., 1987. A multispecies approach to the analysis of gene flow in marine shore fishes. Evolution 41, 385–400.

Whitlock, M.C., McCauley, D.E., 1999. Indirect measures of gene flow and migration: FSTnot equal 1 /(4 Nm11). Heredity 82, 117–125.

Withler, R.E., 2000. Genetic tools for identification and conservation of exploited abalone species. Can. Spec. Pub. Fish Aquat. Sci. (in press).

Yeh, F.C., Boyle, T.J.B., 1997. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belgian J. Botany 129, 157.

(1)

Table 4

Sequence variation among haplotypes and the distribution of haplotypes across geographic samples of H.

a cracharodii

Haplotype Nucleotide position Population

1 1 1 2 2 2 2 3 3 V Cam BC CP SC

1 1 5 0 6 7 1 2 2 9 1 4

2 5 1 5 5 7 3 2 3 4 8 5

1 G G C G C A A A G A A A 10 5 7 6 6

2 G G T G C A A A G A A A 1 2 3 1

3 G A T G C A A A G A A A 1

4 G G T G T A A A G A A A 1

5 G G T G C A A A G G A A 1

6 G G C A C A A A G A A A 1

7 G G C G C A A G G A A A 1

8 G G C G C A A A G A G A 1

9 G G C A C G A A G A G A 1

10 G G C G C A A A A A A A 1

11 A G C G C A A A G A A G 1

12 G G C G C A G A G A A A 1

Haplotype[_{1 is identical in sequence to GenBank AF060848 submitted by Metz et al. (1998).}

and nucleotide diversity ( p) was 0.00217. With this relatively small sample of sequences, no significant population differentiation was evident.

4. Discussion

(2)

Using FST values calculated from the allozyme data, levels of gene flow among H.

cracherodii populations are estimated to be relatively high (Nm.4 for even the most differentiated locus and Nm.6 for the mean F ). However, as recently reviewed byST

Bossart and Prowell (1998) and Whitlock and McCauley (1999), a large number of caveats surround the interpretation of FST and the corresponding estimates of Nm. In particular, such summary statistics fail to take into account various aspects of demographic and population genetic instability common to many study systems. Hence, analyses of the allelic frequency differences themselves may be as insightful as consideration of FST.(Bossart and Prowell, 1998). In this regard, two aspects of the data merit special attention. First, the degree of differentiation in the frequencies of less common alleles is rather remarkable; even with sample sizes of only 50 alleles, the absence of alleles present in frequencies of greater than 0.2 in other populations is highly significant and likely indicates considerably restricted gene flow among populations. Although the absence of alleles in a given population may reflect a founder event or historical population bottleneck (as suggested by the low mtDNA diversity), the lack of consistency across loci does not make this a strong hypothesis in the current case. Furthermore, even if the loss of alleles is due to a population bottleneck, absence of such alleles across the numerous cohorts represented in our sampling also points to a persistent restriction of interpopulation gene flow.

H. cracherodii; hence stochastic factors may contribute either via random drift in a small natural population or via sampling error in estimating allelic frequencies. We attempted to evaluate these alternatives by resampling Big Creek but were unable to locate any H.

cracherodii upon a return visit to the site.

(3)

(4)

H. cracherodii, fit this pattern as well. In the two cases where we obtained samples within 12 km of one another, no genetic differentiation was observed, suggesting that effective dispersal and gene flow occurs on that spatial scale. Although the data on genetic differentiation are not consistent with extensive longer distance dispersal, the fact that most alleles and haplotypes are shared across all sampled populations suggests that these populations have a recent common ancestry and / or on-going low levels of gene flow. This apparent discrepancy between allelic distributions and significant differences in their frequencies is likely due to differences in the time scales relevant to different processes: even low levels of dispersal may yield sufficient gene flow to spread alleles across the species range over long periods of time. Whether such spread is due to persistent low levels of larval exchange or rare episodic events cannot be distinguished with the present data; however, in either case, levels of dispersal are unlikely to provide sufficient recruitment for recovery of fishery stocks even over the course of decades (Tegner, 2000). These inferences have two implications for the strategy of using marine protected areas to enhance abalone fishery resources. On the one hand, the data suggest

(5)

Acknowledgements

References

Boolootian, R., Farmanfarmaian, A.A., Giese, A.C., 1962. On the reproductive cycle and breeding habits of two western species of Haliotis. Biol. Bull. 122, 183–193.

Bossart, J.L., Prowell, D.P., 1998. Genetic estimates of population structure and gene flow: limitations, lessons and new directions. Trends in Ecol. Evol. 13, 202–206.

Brown, L.D., 1991. Genetic variation and population structure in the blacklip abalone, Haliotis rubra. Aust. J. Mar. Freshwater Res. 42, 77–90.

Brown, L.D., Murray, N.D., 1992. Populations genetics, gene flow, and stock structure in Haliotis rubra and

Haliotis laevigata. In: Shepherd, S.A. et al. (Ed.), Abalone of the World: Biology, Fisheries, and Culture.

Proceedings of the First International Symposium on Abalone. Blackwell Scientific Publications,, Cambridge, pp. 24–33.

Burton, R.S., 1983. Protein polymorphisms and genetic differentiation of marine invertebrate populations. Mar. Biol. Lett. 4, 193–206.

Burton, R.S., Feldman, M.W., 1981. Population genetics of Tigriopus californicus: II Differentiation among neighboring populations. Evolution 35, 1192–1205.

Burton, R.S., Tegner, M.J., 2000. Enhancement of red abalone (Haliotis rufescens) stocks at San Miguel Island: reassessing a success story. Mar. Ecol. Prog. Ser. 2000, 303–308.

(6)

Gooch, J.L., 1975. Mechanisms of evolution and population genetics. In: Kinne, O. (Ed.), Physiological Mechanisms. Marine Ecology, Vol. II. Wiley, London, pp. 329–409.

Hellberg, M.E., 1996. Dependence of gene flow on geographic distance in two solitary corals with different larval dispersal capabilities. Evolution 50, 1167–1175.

California abalone fishery. Can. Spec. Pub. Fish. Aquat. Sci. (in press).

Kirby, V.L., Villa, R., Powers, D.A., 1998. Identification of microsatellites in the California red abalone,

Haliotis rufescens. J. Shellfish. Res. 17, 801–804.

Kordos, L.M., Burton, R.S., 1993. Genetic differentiation of Texas Gulf coast populations of the blue crab

Callinectes sapidus. Mar. Biol. 49, 363–375.

Leighton, D.L., 1974. The influence of temperature on larval and juvenile growth in three species of southern California abalone. Fish. Bull. 72, 1137–1145.

McMillen-Jackson, A.L., Bert, T.M., Steele, P., 1994. Population genetics of the blue crab, Callinectes

sapidus: modest population structuring in a background of high gene flow. Mar. Biol. 118, 53–65.

Metz, E.C., Robles-Sikisaka, R., Vacquier, V.D., 1998. Nonsynonymous substitution in abalone sperm fertilization genes exceeds substitution in introns and mitochondrial DNA. Proc. Natl. Acad. Sci. USA 95, 10676–10681.

Morris, R.H., Abbott, D.P., Haderlie, E.C., 1980. Intertidal Invertebrates of California. Stanford University Press, Stanford, CA.

Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590.

Ricketts, E.F., Calvin, J., Hedgpeth, J.W., 1968. Between Pacific Tides, 4th Edition. Stanford University Press, Stanford, CA.

molecular evolution analysis. Bioinformatics 15, 174–175.

Swofford, D.L., 1999. PAUP (Phylogenetic Analysis using Parsomony) Version 4. Sinauer Associates,

Sunderland, MA.

Tegner, M.J., 1993. Southern California abalones: can stocks be rebuilt using marine harvest refugia? Can. J. Fish. Aquat. Sci. 50, 2010–2018.

Tegner, M.J., 2000. Abalone (Haliotis spp.) enhancement in California: what we’ve learned and where we go from here. Can. Spec. Pub. Fish. Aquat. Sci. (in press).

Waples, R.S., 1987. A multispecies approach to the analysis of gene flow in marine shore fishes. Evolution 41, 385–400.

Whitlock, M.C., McCauley, D.E., 1999. Indirect measures of gene flow and migration: FSTnot equal 1 /(4

Nm11). Heredity 82, 117–125.

Withler, R.E., 2000. Genetic tools for identification and conservation of exploited abalone species. Can. Spec. Pub. Fish Aquat. Sci. (in press).

Yeh, F.C., Boyle, T.J.B., 1997. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belgian J. Botany 129, 157.

Directory UMM :Data Elmu:jurnal:J-a:Journal of Experimental Marine Biology and Ecology:Vol254.Issue2.Nov2000:

Population genetics of black abalone, Haliotis cracherodii,

along the central California coast

Parts

Dokumen yang terkait

Analisis Komparasi Internet Financial Local Government Reporting Pada Website Resmi Kabupaten dan Kota di Jawa Timur The Comparison Analysis of Internet Financial Local Government Reporting on Official Website of Regency and City in East Java

Analisis Komposisi Struktur Modal Pada PT Bank Syariah Mandiri (The Analysis of Capital Structure Composition at PT Bank Syariah Mandiri)

Improving the Eighth Year Students' Tense Achievement and Active Participation by Giving Positive Reinforcement at SMPN 1 Silo in the 2013/2014 Academic Year

The Correlation between students vocabulary master and reading comprehension

An Analysis of illocutionary acts in Sherlock Holmes movie

Improping student's reading comprehension of descriptive text through textual teaching and learning (CTL)

Teaching speaking through the role play (an experiment study at the second grade of MTS al-Sa'adah Pd. Aren)

Enriching students vocabulary by using word cards ( a classroom action research at second grade of marketing program class XI.2 SMK Nusantara, Ciputat South Tangerang

The Effectiveness of Computer-Assisted Language Learning in Teaching Past Tense to the Tenth Grade Students of SMAN 5 Tangerang Selatan

Analysis On Students'Structure Competence In Complex Sentences : A Case Study at 2nd Year class of SMU TRIGUNA

Dukungan

Links

Directory UMM :Data Elmu:jurnal:J-a:Journal of Experimental Marine Biology and Ecology:Vol254.Issue2.Nov2000:

Population genetics of black abalone, Haliotis cracherodii,

along the central California coast

Parts

Dokumen yang terkait

Analisis Komparasi Internet Financial Local Government Reporting Pada Website Resmi Kabupaten dan Kota di Jawa Timur The Comparison Analysis of Internet Financial Local Government Reporting on Official Website of Regency and City in East Java

Analisis Komposisi Struktur Modal Pada PT Bank Syariah Mandiri (The Analysis of Capital Structure Composition at PT Bank Syariah Mandiri)

Improving the Eighth Year Students' Tense Achievement and Active Participation by Giving Positive Reinforcement at SMPN 1 Silo in the 2013/2014 Academic Year

The Correlation between students vocabulary master and reading comprehension

An Analysis of illocutionary acts in Sherlock Holmes movie

Improping student's reading comprehension of descriptive text through textual teaching and learning (CTL)

Teaching speaking through the role play (an experiment study at the second grade of MTS al-Sa'adah Pd. Aren)

Enriching students vocabulary by using word cards ( a classroom action research at second grade of marketing program class XI.2 SMK Nusantara, Ciputat South Tangerang

The Effectiveness of Computer-Assisted Language Learning in Teaching Past Tense to the Tenth Grade Students of SMAN 5 Tangerang Selatan

Analysis On Students'Structure Competence In Complex Sentences : A Case Study at 2nd Year class of SMU TRIGUNA

Dokumen yang Anda mencari sudah siap untuk unduhkan