Phylogeography of tropical eel (Anguilla spp) in Indonesia Waters

PHYLOGEOGRAPHY OF TROPICAL EELS

(

Anguilla spp

) IN INDONESIAN WATERS

MELTA RINI FAHMI

GRADUATE SCHOOL

BOGOR AGRICULTURAL UNIVERSITY

BOGOR

STATEMENT OF DISSERTATION

AND INFORMATION SOURCE

Hereby I express that the dissertation entitled: “

Phylogeography of

Tropical Eel (

Anguilla spp

) in Indonesian Water

” is the original result of

my research and has never been submitted to obtain a Doctorate in similar

mayor at other universities. All of data and information that I had provided

in this dissertation are based on evidence and available references.

Bogor, March 2013

Melta Rini Fahmi

NRP G362080061

SUMMARY

MELTA RINI FAHMI. Phylogeography of Tropical Eel (Anguilla spp) in Indonesia Waters. Supervised by DEDY DURYADI SOLOHIN, PATRCIK BERREBI, KADARWAN SOEWARDI and LAURENT POUYAUD

The freshwater eels (Anguilla spp: Anguillidae) are popular as a commercial important food, because of good nutritional value. These fish are also a well known for their unique catadromous life histories. These species breed far from offshore after migrate thousands kilometers from their growth habitats in freshwater and estuarine to their spawning area in oceanic waters. Most of the investigations concerning eels are concentrated on temperate species, in the north hemisphere mainly because of the economic importance of these species. Nowadays, the population of temperate eel, dramatically decrease is caused by habitat damage, illegal fishing and climatic changes in the ocean. As a consequence, tropical eels become important eel nowadays in the market, as well as the research on tropical eels become a new challenge. One of primary problems in tropical eels is that they have overlapping range of most morphological character, so species identification on this genus are no more sufficient. Then molecular approaches have been proposed for eel identification.

This study has four main objectives: (1) to establish quick methods of identification of tropical eels; (2) to understand exact distribution and dispersal of tropical eel in Indonesia water; (3) to reveal the phylogenetic relationship among population in Indonesia and (4) to uncover population genetic structure of

Anguilla bicolor between two Ocean. All of information obtained in this study

revealed the conservation management of tropical eel in Indonesia water.

The semi-multiplex method was proposed in this study has demonstrated the efficiency for in identifying seven species and sub-species of tropical eels with only one step PCR. By using this method, one could reduce the number of necessary sequences while the results are very sure for each species determination (we easily identified 1112 specimens). All of species were obtained in this study showed overlapping morphology and distribution. Especially for small specimens (mainly glass eels), the molecular method appears as indispensable. This method has proven to be most simple, quicker, lower cost (no acrilamide migration), specific/sensitive, and highly reliable way.

The geographic distribution of tropical eels of the genus Anguilla in Indonesian waters was establish by identified genetically of all sample that obtain during this study. The genetically identification applied the semi-multiplex PCR method that recently developed in this study. We recognized four species and subspecies with wide distribution: A. b. bicolor, A. b. pacifica, A. marmorata and

A. interioris, two species with limited distribution, close to endemism: A.

celebesensis and A. borneensis and one subspecies A. nebulosa nebulosa that

is only spread in river flowing into Indian Ocean.

The phylogenetic relationship and genetic diversity was cosntructed and calculated based on mitochondria DNA cytochrome b gene sequence of Anguilla

that covering all of the geograpical distribution in Indonesia waters. The genetic structure of populations that responsible for a given genetic architecture and evolutionary factors is an important objective of population genetics. In this study we present genetic diversity and phylogenetic relationship among and within species in genus Anguilla to understanding the evolutionary process of Anguillid that inhabit in Indonesia waters.Seven species of Indonesian tropical eel showed a higher haplotype and nucleotide diversity at the cyt b locus with haplotype and nucleotide diversity (π) were 0,98 and 4,57% respectively. Phylogenetic tree showed A. borneensis a likely most basal species in Indonesia water.

The economic important shortfinned eel, Anguilla bicolor, has a relatively wide geographic distribution compared to the 19 species and subspecies of genus Anguilla, it is distributed longitudinally from the eastern coasts of Africa through the seas around Indonesia to New Guinea in Pacific Ocean. The genotypes of seven microsatellite DNA were analysed for 180 specimens collected from 10 representative location where two subspecies have been found. Analysis with seven microsetallite loci showed Expected (He) and observed (Ho) heterozigosities of each locus range from 0,594 to 0,921 and from 0,250 to 1,000 respectively. All off locus showed high polymorphic. Based on FST value and clustering test, there is no structure and fragmentation of A. bicolor in Indonesia water.

A critical first step in species conservation is to gain a clear understanding of its taxonomy. Considering Indonesian waters that are inhabited by several sympatric species of tropical eels, almost all morphological character in this genus are overlapping. So a rapid and efficient identification technique is needed. Semi multiplex PCR that has been developed in the present study has successfully distinguished seven species that inhabit the waters of Indonesia through one-step PCR. After established the identification species subspecies methods then we constructed distribution and dispersal pattern, phylogenetic relationship among species that inhabit Indonesian water and population genetic structure of species that have widespread distribution. All of information obtained in this study was needed for conservation management of anguillid in Indonesian water.

Key words: Tropical eel, Anguilla spp, semi-multiplex PCR, Indonesia water and population genetic

Copyright©2013 by Bogor Agricultural University Copyright are protected by law,

1. It is prohibited to cite all or part of this thesis/ dissertation without referring to and mentioning the source.

a. Citation only permitted for sake of education, research, scientific problem.

b. Citation doesn’t inflict the name and honor of Bogor Agricultural University.

2. It is prohibited to republish and reproduce all or part of this thesis/ dissertation without the written permission from Bogor Agricultural University.

Dissertation’s title : Phylogeogphy of Tropical Eels (Anguilla spp) In Indonesian Waters

Name : Melta Rini Fahmi Student ID : G 362080061 Departement : Biology

Aproved by the Supervisor Commite

Dr. Dedy Duryadi Solihin Head

Prof. Dr. Patrick Berrebi Prof. Dr.Kadarwan Soewardi, M.Sc

Member Member

Dr.Laurent Pouyoud M.Sc Member

Acknowledged by:

Head of Biology Programme of Dean of Graduate School Graduate School Bogor Agricultural University

TABLE OF CONTENTS

Page

TABLE OF CONTENTS ... i

LIST OF TABLES ... iii

LIST OF FIGURES ... iv

LIST OF APPENDIX ... v

I. GENERAL INTRODUCTION Background ... 1

Questions to Solve ... 7

Framework ... 7

II. A NOVEL SEMI-MULTIPLEX PCR ASSAY FOR IDENTIFICATION OF TROPICAL EEL GENUS Anguilla IN INDONESIAN WATER Abstract ... 10

Introduction ... 10

Material and Methods ... 12

Result ... 16

Discussion ... 18

III. DISTRIBUTION OF TROPICAL EEL GENUS Anguilla IN INDONESIAN WATER BASED ON SEMI-MULTIPLEX PCR Abstract ... 20

Introduction ... 20

Material and Methods ... 23

Result ... 25

Discussion ... 28

IV. A NEW MOLECULAR PHYLOGENY AND GENETIC DIVERSITY OF FRESHWATER EEL GENUS Anguilla IN INDONESIAN WATER BASED ON MITOCHONDRIAL GENES Abstract ... 35

Introduction ... 35

Material and Methods ... 38

Result ... 41

Discussion ... 52

V. POPULATION GENETIC STRUCTURE OF TROPICAL EEL Anguilla bicolor IN INDONESIAN WATER Abstract ... 55

Introduction ... 55

Material and Methods ... 58

i 

Result ... 62

Discussion ... 65

VI. GENERAL DISCUSSION ... 67

REFERENCES ... 71

APPENDIX ... 76

ii 

LIST OF TABLES

Page

1. Position of nine species-specific primers for semi-multiplex PCR on cytochrome b and 16s rRNA genes respectively. Two positions for forward primers (FCYT-EEL and F16S-EEL) and seven positions for

reverse primers ... 15

2. Species-specific primer sequences for semi- multiplex PCR, and PCR product lengths expected for the seven Anguilla species and subspecies ... 16

3. Identification eel by morphology (only 796 eels were classified into the four groupa) and semi-multiplex-PCR (1112 eels were identified among 1115 eels) ... 18

4. List of sampling locations of tropical eels in Indonesia ... 25

5. List specimens, sampling location and date in this study ... 39

6. Matrix nucleotide substitution based on HKY+G+I methods ... 42

7. Genetic diversity and neutral test of species/sub species of tropical eel genus Anguilla from Indonesia waters ... 43

8. Nucleotide diagnostic of each species and clade on the species ... 47

9. Matrix genetic distance between all of species-subspecies on genus Anguilla. Grey highlights one is species-subspecies during this study ... 48

10. Genetic distance within species and sub species ... 48

11. Intraspecific genetic differentiation measured within A. bicolor species ... 51

12. Mutation on nucleotide sequence (above) and amino acid (below) between A. b. bicolor and A. b. pacifica ... 51

13. Intraspecific genetic differentiation measured within A. marmorata species ... 52

14. List of specimen used for microsatellite analyses in the present study .... 59

15. List locus that using during this study ... 61

16. Genetic variability of population parameters at 7 microsatellite loci on tropical eel in Indonesia water ... 63

17. Genetic divergence (Fst) (above) and genetic distance (below) among population during present study ... 64

iii 

LIST OF FIGURES

Page

18. World production of eels (FAO, 2009) ... 3 19. Research framework ... 9 20. Measurement morphology character of specimen ... 15 21. Identification species and subspecies of Anguilla by semi-multiplex PCR

samples ... 18 22. Map of the stations around Indonesia Sea where samples have been

collected for this study ... 25 23. Distribution of the seven species and subspecies of freshwater eels

which were found around Indonesia during this study ... 28 24. The sampling location of genus Anguilla in the origin region Indonesia

water ... 41 25. Neighbor Joining (NJ) phylogentic tree based on 1042 bp of

mitochondrial DNA cyt b gene fragmen under Kimura 2-parameter model, with Serrivomer sector, Synaphobranchus kaupi and Conger myriaster as outgroup (up to 75%) ... 46 26. Neighbor Joining (NJ) phylogentic tree based on 1042 bp of

mitochondrial DNA cyt b gene fragmen under Kimura 2-parameter model, with Synaphobranchus kaupi as outgroup (up to 75%) ... 47 27. Neighbor Joining (NJ) phylogentic tree of all sequence in this study

based on 1042 bp of mitochondrial DNA cyt b gene fragmen under

Kimura 2-parameter model (up 75%) ... 51 28. Dendogram of genetic distance of Indonesian tropical eel based on cyt b

sequence ... 56

iv 

v 

 

LIST OF APPENDIX

Page

1. Sampling Location during this Study ... 76 2. Number haplotype for the cytochrome b gene among all specimen on

present study ... 77 3. Sequencing Alignment for Cytochrome b gene among all haplotype of

Anopicall eel Anguilla spp ... 79 4. Frequency allele for each locus, each localities for all specimen ... 83 5. Fis for each locus, each localities for all specimen ... 86

LIST OF TABLES

Page

1. Position of nine species-specific primers for semi-multiplex PCR on cytochrome b and 16s rRNA genes respectively. Two positions for forward primers (FCYT-EEL and F16S-EEL) and seven positions fo reverse primers ... 2. Species-specific primer sequences for semi- multiplex PCR, and PCR

r

... 15

... 16 into the

18 .... 25 . 39

... 61

64 product lengths expected for the seven Anguilla species and

subspecies ... 3. Identification eel by morphology (only 796 eels were classified

four groupa) and semi-multiplex-PCR (1112 eels were identified among 1115 eels) ... 4. List of sampling locations of tropical eels in Indonesia ... 5. List specimens, sampling location and date in this study ... 6. Matrix nucleotide substitution based on HKY+G+I methods ... 42 7. Genetic diversity and neutral test of species/sub species of tropical eel

genus Anguilla from Indonesia waters ... 43 8. Nucleotide diagnostic of each species and clade on the species ... 47 9. Matrix genetic distance between all of species-subspecies on genus

Anguilla. Grey highlights one is species-subspecies during this study ... 48 10. Genetic distance within species and sub species ... 48 11. Intraspecific genetic differentiation measured within A. bicolor species ... 51 12. Mutation on nucleotide sequence (above) and amino acid (below)

between A. b. bicolor and A. b. pacifica ... 51 13. Intraspecific genetic differentiation measured within A. marmorata

species ... 52 14. List of specimen used for microsatellite analyses in the present study .... 59 15. List locus that using during this study ...

16. Genetic variability of population parameters at 7 microsatellite loci on

tropical eel in Indonesia water ... 63 17. Genetic divergence (Fst) (above) and genetic distance (below) among

population during present study ...

iii 

LIST OF FIGURES

Page

1. World production of eels (FAO, 2009) ... 3 2. Research framework ... 9 3. Measurement morphology character of specimen ... 15 4. Identification species and subspecies of Anguilla by semi-multiplex PCR

25

1

del,

... 51 t b samples ... 18 5. Map of the stations around Indonesia Sea where samples have been

collected for this study ... 6. Distribution of the seven species and subspecies of freshwater eels

which were found around Indonesia during this study ... 28 7. The sampling location of genus Anguilla in the origin region Indonesia

water ... 4 8. Neighbor Joining (NJ) phylogentic tree based on 1042 bp of

mitochondrial DNA cyt b gene fragmen under Kimura 2-parameter model, with Serrivomer sector, Synaphobranchus kaupi and Conger myriaster as outgroup (up to 75%) ... 46 9. Neighbor Joining (NJ) phylogentic tree based on 1042 bp of

mitochondrial DNA cyt b gene fragmen under Kimura 2-parameter mo

with Synaphobranchus kaupi as outgroup (up to 75%) ... 47 10. Neighbor Joining (NJ) phylogentic tree of all sequence in this study

based on 1042 bp of mitochondrial DNA cyt b gene fragmen under Kimura 2-parameter model (up 75%) ... 11. Dendogram of genetic distance of Indonesian tropical eel based on cy

sequence ... 56

iii 

I. GENERAL INTRODUCTION

Background

The freshwater eels (Anguilla spp: Anguillidae) are a well known for their catadromous life histories. They migrate between freshwater and marine environment. These species are breeding far offshore after a migration of thousands kilometers from their growth habitats in freshwater and estuarine to their spawning area in oceanic waters (Ege 1939; Tesch 1977). Most of the temperate species spawn within a narrow tropical area. Furthermore, the eels larvae, known as leptocephali, passively swim to their growth habitat along subtropical currents (Tesch 1977; Tsukamoto 1992).

The anguillid leptocephalus is one of the most distinctive larvae of Anguilliform fishes and has an olive leaf-like shape, with a depth of about one fifth of total length (TL), no melanophores, transparent body, relatively few myomeres and high water content contribute to the buoyancy, which would be advantageous for passive transport by ocean current (Tesch 1977; Mochioka 2003). Lepthocephalus will be metamorphose, their morphological and physiological change before into glass eel, which occurs before entering freshwater. Eel larvae undergo marked changes the somatic structure from the leaf-like shape of the lepthocephali to the adult-like shape of the glass eel. Glass eel is a developmental stage from the end of metamorphosis to the beginning of pigmentation, following this stage the young eels are called “elver” (Tesch 1977; Mochioka 2003). The next development stage is the yellow eel or sexually immature adult stage. Those inhabit in estuarine until freshwater environment, which tend to live longer and attain much larger sizes (Tesch 1977). Further freshwater eels will continue to the sexually mature stage are called silver eel. In this stage, they begin downstream migration from the growth habitat, freshwater to the open oceanic, after transformation from yellow-phase to silver-phase eels. The silver eel spent their entire growth phase in the marine environment and apparently they never entered freshwater (Tesch 1977; Aoyama et al. 2003a).

Ege (1939) divided the Anguilla species into four groups, based upon color, body proportions, dentition, and meristic characters: First group, variegated

species with broad undivided maxillary and mandibular bands of teeth;

A. celebesensis Kaup 1856; A. interioris Whitley 1938; and A. megastoma Kaup

1856; second group, variegated species with a toothless longitudinal groove in the maxillary and mandibular bands of teeth; A. nebulosa (A. n. labiata Peters 1852; A. n. nebulosa McClelland 1844); A. marmorata Quoy and Gaimard 1824;

A. reinhardti Steindachner 1867; and A. ancestralis Ege 1939; third group,

species without variegated markings and with a long dorsal fin; A. anguilla

Linnaeus 1758; A. rostrata Lesueur 1817; A. mossambica Peters 1852;

A. borneensis Popta 1924; A. japonica Temminck and Schlegel 1846; and

A. dieffenbachii Gray 1842; and fourth group, species without variegated

markings and with a short dorsal fin; A. bicolor (A. b. bicolor McClelland 1844;

A. b. pacifica Schmidt 1928); A. australis (A. a. australis Richardson 1841;

A. a. schmidti Phillips 1925); and A. obscura Gunther 1871. Castle and

Williamson (1974) postulated that A. ancestralis is an invalid species, based on similarities with juvenile A. celebesensis. Currently, after scientist discovered a new species A. luzonensis in Philippines water at 2009, accepted number of species in the genus Anguilla is 16 species (Watanabe et al. 2009).

At the population level, most of the freshwater eel showed randomly mating panmictic structure on the whole species or sub-species distribution (Avice et al. 1986). Panmixia is realized on the unique species or subspecies spawning area where all individuals are potential partners. There are no mating restrictions, neither genetics or behavioral and all recombination is possible (Avise et al. 1986).

Apart from their unique life history, eels are also popular as a commercial important food, because of good nutritional value, with protein and fat content of 65% and 28% respectively (Hainsbroek 2007). Among the many popular eel dishes consumed around the world, kabayaki (marinated grilled eel) is a national dish in Japan, while smoked eel is favored in Europe and North America, and eel larvae are eaten as appetizers in Spain (Ringuet 2002).

The international market for cultured eels exceeds 200,000 ton in year 2000. Based on FISHSTAT (FAO 2009) data, total production of eels rose from 17,750 ton in 1950 year to 284,274 ton in 2007 year. In Japan, the Japanese eel

(Anguilla japonica) has long been esteemed as an important food fish, as much

as 130,000 tons of eels are consumed per year followed by China, Korea, America and some European countries, like Denmark, France, Italy, Belgium and Germany. However most of this production is based on catching wild of adults and rearing of wild-caught juvenile “glass eels”. The catching activity of glass eel

since the mid-1990s has been increased rapidly (Figure 1). The impact of exploitation of glass eel populations is unknown, although the yield of yellow and silver eel has declined. Ecologists consider that the decline of eel production is caused by habitat damage, illegal eel fisheries, climatic changes in the ocean, and parasites (especially Anguillicola crassus in European eel). According to Ringuet (2001), the overall production of A. anguilla and A. japonica has declined, landings of European eels, Japanese eels and American eels dropped to 43.5%, 64% and 8.3%, respectively, over a period of 17 years (1984 to 2000). As a consequence, tropical eels became most important nowadays in the market, as well as the research on tropical eel which becomes a new challenge.

Figure 1 World production of eels (FAO 2009), graphic adapted from FAO 2009

On the other hand, the knowledge on tropical eel species occupying southern or tropical zones is still limited. Two thirds of the recognized 18 Anguilla

species and subspecies are found in the tropical Pacific, while only 6 in temperate regions of both the Pacific and Atlantic Oceans and seven occupy the western Pacific around Indonesia (Ege 1939; Castle & Williamson 1974; Arai et al. 1999). The main differences between tropical and temperate eels are the length of larval phase, the distribution, the spawning season and the population structure. The temperate eel generally have a longer and farther migration distances (Cheng and Tzeng 1996; Arai et al. 1999, 2001). The larvae of temperate eel enter estuaries is in spring, while that of tropical eels are found in estuaries throughout the year with different abundance (Arai et al. 1999).

Most studies of population genetic structure of eels have focused just on temperate species in the northern hemisphere and few have examined tropical species. Some studies on population genetic structure of tropical eel have been conducted such as; A. marmorata by Ishikawa et al. (2004), Tseng (2012) and Minegishi et al. (2008); A. bicolor by Minegishi et al. (2012) and A. reinhardtii by Shen and Tzeng (2007, 2012).

To uncover the existence of tropical eel, several studies have been conducted through the collaboration between the Japanese institution Ocean Research Institute and research institutes of Indonesia (LIPI) to investigate the distribution of tropical eels , using the research vessels KM Baruna Jaya VII and RV Haruko Maru in the period 1998-2003. Both research vessels collected lepothocephali around the Indonesian sea: A. borneensis caught in the Celebes Sea, A. b. bicolor caught in the Mentawai Islands and A. celebesensis in the Tomini bay (Arai et al. 1999; Wouthuyzen et al. 2009; Aoyama et al. 2007; Setiawan et al. 2001; Miller 2003).

Beside looking for the spawning areas of these eels, this expedition confirmed also some observations quite interesting for taxonomy. According to Watanabe et al. (2004a), the tropical eels show geographic distribution and morphological characters heavily overlapping. The comprehensive identification of eels proposed by Ege (1939), divided genus Anguilla into 15 species, three of which were subdivided into two subspecies by using morphological character. But when the geographic distribution of each species is plotted on a map, several species have overlapping geographic range. They have also overlapping range of morphological character. While Ege's taxonomy has long been accepted since its publication (because most of the first freshwater eel studied came from temperate region and are not geographically overlapping), some doubts were expressed (Watanabe et al. 2004a).

That means the identification of eels depends on the location of collection. Watanabe et al. (2004a) deduced that if only morphological characters were used for identification, the freshwater eels could be classified into only four groups. This can be also a problem for the freshwater eels that have been transported around the world in recent years for aquaculture.

Since morphological studies are no more sufficient for freshwater eels species identification, the molecular genetics approaches become a new challenge to develop technically and theoretically nowadays. Molecular genetics

have been used to evaluate certain taxa, for identification, evolution purposes and phylogenies reconstructions (Freeland 2005). The application of molecular genetics to confirm identification of freshwater eel have been conducted in several research (Aoyama et al. 1999, 2001; Watanabe et al. 2004b, 2008; Sezaki et al. 2005; Itoi et al. 2005; Gagnaire et al. 2007 and Trautner et al. 2006), most of them apply RFLP, RAPD and Real Time-PCR methods with 16S rRNA and Cyt b gene as marker.

Multiplex PCR is a variant of PCR permitting simultaneous amplification of several targets in one reaction by using more than one pair of primers. For taxa identification purpose, the multiplex PCR produce amplicons on varying sizes that are specific to different DNA sequences (Rompler 2006). Multiplex PCR assay that using several species-specific primers enable to identify several species in a simple, quick, low cost, sensitive, and highly reliable method (Catanese et al. 2010)

The molecular genetics techniques also have been used for new hypotheses of phylogeny and evolution of the genus Anguilla (Tagliavini et al.

1996; Aoyama and Tsukamoto 1997; Lin et al. 2001; Bastrop et al. 2000; Aoyama et al. 2001; Inoue et al. 2001 and Minegishi et al. 2005). Molecular phylogenetic studies upon all species of genus Anguilla have been conducted by

Lin et al. (2001) who examined mitochondrial 12SrRNA and cytochrome bgenes,

and Aoyama et al. (2001) examined 16SrRNA and cytochrome b genes. Both studies presented almost the same topology defining species groups and their geographic distribution. However these contributions diverged on the position of basal species. Aoyama et al. (2001) concluded that A.borneensis was most likely the basal species of the genus while Lin et al. (2001) suggested that the ancestor species are A. marmorata and A.nebulosa.In recent year, Minegishi et al (2005) produced a new phylogenetic analysis based on the complete mitochondrial DNA (mtDNA) sequence of all species of genus Anguilla. This phylogenetic analysis showed a better statistical support that mean more sure analysis than previous studied. Minegishi et al. (2005) suggest A. mossambica to be most basal species using Baysian analysis, but based on MP (maximum parsimony) analysis, similarly with Aoyama et al. (2001), Minegishi et al. (2005) A. borneensis appears as basal species. Moreover, because the tropical and Indo-Pacific zones have a highest species diversity, these authors said that the Indonesia waters are the

“origin of the eels” and “Indonesia is homeland of eels”.

A. bicolor and A. marmorata are tropical eels that have been widely analyzed due to their exceptional large distribution (nearly 20,000 km east-west in Indopacific oceans). This wide distribution is mostly in sympatry from the eastern coasts of Africa through the seas around Indonesia to New Guinea in the Pacific Ocean. They are strongly suspected to have several spawning areas. According to Minegishi et al. (2008), A. marmorata is not taxonomically divided into subspecies because of its morphological stability, but molecular studies have demonstrated its structure into four differentiated populations: North Pacific, South Pacific, Indian Ocean, and Mariana (Minegishi et al. 2008; Gagnaire et al.

2009). The shortfined eel, A. bicolor, of high abundance, is considered to be structured into two subspecies A. b. bicolor in Indian Ocean especially at the west of Indonesia and A. b. pacifica in Pacific Ocean (Ege 1939; Minegishi et al. 2012). However, the population structure and evolutionary history of A. bicolor

needs to be investigated in detail especially in Indonesia. These fish have high economic value, and are believed to be the best candidate eels to replace Japanese eel (A. japonica) and European eel (A. anguilla) which have been decline for food, including fish farm growth.

Indonesia is an archipelagic country that has a long coastline of 91,000 km and 71,480 islands. The western part of Indonesia is connected with Indian Ocean and the eastern was one with the Pacific Ocean, making Indonesia an important biogeographic crossroad. Until now, there are seven recognized species that occupy Indonesia waters: A. bicolor (two subspecies: A. b. bicolor

and A. b. pacifica), A. marmorata, A. celebesensis, A. borneensis, A. interioris, A.

obscura and A. nebulosa (subspecies: A. n. nebulosa) (Ege 1939; Castle &

Williamson 1974; Tsukamoto & Aoyama 1998 and Sugeha et al. 2008). But information about distribution, evolution, phylogenetic relationship and structure population still are limited and without details.

Questions to solve

This study was intended to solve some questions:

a. The distribution of seven eel species living in Indonesia is not really known. This project aimed first at establishing quick methods of identification of tropical eels. This is partly due to the difficulty to determine the species just using morphological character. From here we begin to get a clear description of the distribution of the species that live in Indonesian water. while it is quite

b. The genetic relationships among Anguillide in Indonesian water can be used generate a new phylogenetic tree which can help to understand the evolution of this genus in tropical areas especially in Indonesian water.

c. Indonesia is an important biogeographic crossroad, at the contact between Indian and Pacific ichthyofaunas. Concerning the two widespread eel species (A. marmorata and A. bicolor), Indonesia harbors a part of the Indian and a part of the Pacific populations or subspecies, but nearly nothing is known on the exact distribution of each lineage in Indonesian rivers. Biogeography of both species and populations genetics of A. bicolor will be

used to understand the population structure and to know the gene flow

pattern among Anguillidae populations in the Indonesian waters.

Framework

The decreasing of temperate eel populations in the subtropical zone have encouraged biologists to help conservation and aquaculture of this group. As a result, research on tropical eel are become a new challenge especially in Indonesian waters. Many scientists consider Indonesia as ”homeland and origin

of eels”, however, knowledge about distribution and biological traits of eel in

Indonesian waters is still limited. Understanding biological aspects and population is an important point in the development of sustainable aquaculture.

In sustainable aquaculture, phylogeography and genetic population studies are two first crucial steps to manage the fisheries resources. Such studies should provide valuable information about their status, population fragmentation and dispersal pattern. To analyze phylogeography of eels, we should begin by their distribution map and phylogenetic relationships. Therefore samples collection and identification become an important point. Recently many biologists agree that identification of eels is more appropriate using molecular biology approach. Semi-multiplex PCR is one method that provides genetic information to identification of target species, by using the species-specific primers. Semi-multiplex PCR assays can identify several species in a simple, quick, low cost, sensitive and highly reliable way on one step PCR. Phylogenetic relationships can be analyzed based on the information resulting from mtDNA sequencing. The PCR and DNA sequencing constitute easy and fast methods, furthermore,

computer software provide convenient analytical methods to infer phylogenetic relationships and evolution and some statistical calculation.

The analysis of polymorphic microsatellites will provide inter and intra populations information structure. This population analysis should be conducted on widespread species.

As a summary, the outputs of this research are (i) a quick identification method of ells species living in Indonesian waters; (ii) distribution of eels species, furthermore (iii) the information on systematics, phylogenetics and populations genetics structure, which will provide data for conservation and aquaculture strategy. The framework of this study is summarized in the Fig. 2.

Phylogeography tropical eels genus Anguilla in Indonesian waters

Distribution and species composition of Anguilla spp in Indonesian water

Phylogenetic tree tropical eel in Indonesian waters

Population genetic structure of tropical eel: Anguilla bicolor in Indonesian waters

CYT b and 16SrRNA genes to construct phylogenetic

relationships among populations and species Morphometric and

Semi-Multiplex PCR for identification

Polymorphic microsatellites to determine the population genetic structure of

A. bicolor

Quick identification methods, dispersal and distribution, systematic and phylogenetic and population genetic structure of tropical eels in

Indonesian water

Population connectivity and conservation-aquaculture strategy of tropical eel in

Indonesian waters

Figure 2. Research framework

II. A Novel Semi-Multiplex PCR Assay for Identification of

Tropical Eel Genus

Anguilla

in Indonesian Water

Abstract

A

o

ne step semi-multiplex PCR is proposed for distinguishing seven species and

subspecies of tropical eels including Anguilla bicolor bicolor, A. bicolor pacifica, A. marmorata, A. interioris, A. celebesensis, A. borneensis, and A. nebulosa nebulosa in Indonesian waters. Seven pairs of species-specific primers, including two forward and seven reverse primer sequences, were designed after the alignment of complete mitochondrial cytochrome b (1140 bp) and 16S rRNA (1120 bp) genes. All species-specific primer pairs are included in one PCR, but only one pair of them can amplify a specific fragment from the template DNA that is analyzed. The semi-multiplex PCR amplified a fragment of 230 bp for A. b. bicolor, 372 bp for A. n. nebulosa, 450 bp for A. borneensis, 620 bp for A. marmorata, 670 bp for A. b. pacifica, 720 bp for A. celebesensis, and 795 bp for A. interioris, which are then separated by DNA agarose gel electrophoresis.

KEY WORDS: semi-multiplex PCR, Anguilla, tropical eels, molecular identification, species-subspecies specific primer

Introduction

Order Anguilliformes contains 400 genera and 800 species, most of them lives in the oceans and only genus Anguilla migrates to the freshwater for growth Nelson (2006). Genus Anguilla is composed of freshwater eel having a catadromous life history characterized by spawning in ocean waters and by a migration of the larvae back to the parents growing habitats in freshwater or estuarine areas. The three temperate species spawn in remote tropical waters after a long adult migration. Their larvae, called leptocephali are passively returning to their growth habitat with the influence of subtropical currents, and perform long migration distance (Tesch 1977; Tsukamoto 1992). Oppositely, the tropical eels have shorter migration distance for both adults and leptocephali than those of the temperate species (Arai et al. 1999; Wouthuyzen et al. 2009 and Aoyama 2009)

A first comprehensive identification of the genus Anguilla was proposed by Kaup (1856), who recognized 45 species. In 1870, Gunther reduced this number to 23 species. Lastly, a revision of the genus was done by Ege (1939) who

divided the genus Anguilla into 16 species, three of which were subdivided into two subspecies. Based on morphological characters, the systematic organization of Ege (1939) have long been widely accepted by many biologists. However, Watanabe et al. (2004a) recently found that the morphological character described by Ege (1939) were not sufficient to classify all species of this genus without including the information on the geographic distribution of the specimens, which he used as a taxonomic character. Watanabe et al. (2004a) considered that the Ege’s (1939) key for species identification is partly invalid because many morphological characters used are overlapping in most species. Species recognition becomes especially important for tropical eels because nowadays they are commercially transported around the world for food (frozen) and aquaculture (a live) purposes. Ege's (1939) key is considered as insufficient especially in tropical areas, where geographic and morphological characters of eels are heavily overlapping and where scientific data are still scarce.

Indonesia is a wide equatorial characterized by archipelagos composed of around 71,480 islands and coastline of around 91,000. Biogeographically, Indonesia is at the crossroad of the Indian and Pacific Oceans, the western part of Indonesia is connected with Indian Ocean and the eastern is connected with the Pacific Ocean. Two thirds of the recognized 18 Anguilla species and subspecies are found in the tropical Pacific and seven species and subspecies of tropical eels range around Indonesia (Ege 1939; Castle & Williamson 1974, Arai

et al. 1999). Those are A. bicolor (two subspecies: A. b. bicolor and A. b.

pacifica), A. marmorata, A. celebesensis, A. borneensis, A. interioris, A. obscura

and A. nebulosa (subspecies: A. n. nebulosa). As a result, the position of

Indonesia appears to be center of origin the diversity of eel and is strategic in the knowledge of their evolution.

Several methods for species identification have been used on fish like conventional morphology and electrophoresis, immunoassay, liquid chromatography or molecular genetics assay (O’Reilly and Wright, 1995). Concerning eels, after demonstration that morphological characters were not sufficient to classify all species, molecular genetics have been recommended (Watanabe et al. 2004a). Most of the genetic approaches to species identification are based on the amplification of a partial sequence of mitochondria (mtDNA). The mtDNA, of maternal inheritance, shows no recombination, so that its sequences are more conservative. The gene 16S rRNA, relatively well

conserved, is considered as a good marker for genera and species identification (Aoyama et al. 2000, 2001; Watanabe et al. 2004b, 2005; Gagnaire et al. 2007). However, it is not polymorphic enough between subspecies (Watanabe 2003). Moreover, it is important to develop the markers that could distinguish subspecies. One of the other genes used is cytochrome b (Cytb). This functional gene is positioned between tRNAGlu and tRNAThr genes. Many investigations on

Cytb focus on inheritance and evolution (Freenlad 2005). Several studies have used Cytb as a marker for identification of subspecies (Jain et al. 2008; Hyde et al. 2005).

Recently, several simple PCR techniques have been used to distinguish A.

japonica and A. anguilla (Sezaki et al. 2005), A. interioris and A. celebesensis

(Aoyama et al. 2000) and to distinguish A. anguilla and A. rostrata (Trautner 2006). Application of Real-Time PCR technique allowed identification of A.

japonica leptocephali (Watanabe et al. 2004b), using single nucleotide

polymorphism (SNP) (Itoi et al. 2005), Random Amplified Polymorphic DNA (RAPD) (Kim et al. 2009; Lehmann 2000), Restriction Fragment Length Polymorphism (RFLP) (Lin et al. 2001), most of these researches dealing with temperate area.

Rapid molecular identification of tropical eel began with Gagnaire et al. (2007), who developed semi-multiplex PCR and RFLP to identify four eel species in Indian Ocean. Multiplex PCR is a variant of PCR enabling simultaneous amplification of several targets in one reaction by using more than one pair of primers. The multiplex PCR produces amplicons on varying sizes that are specific to different DNA sequences (Rompler 2006). By using the species-specific primers in multiplex-PCR assays, the identification of several species in a simple, quick, low cost, sensitive, and highly reliable amplification is possible (Catanese et al. 2010).

In the present study we developed a method derived from multiplex PCR assay. In this method, the PCR is based on two “universal” forward Anguilla

primers (and so, called semi-multiplex) and seven specific reverse primers, one for each eel species or subspecies know from Indonesian waters. The method is based on the complete sequence of cytochrome b and 16S rRNA extracted from the specimens that was collected around Indonesia waters.

Material and Methods

Specimens

The 1115 specimens examined in this study were collected around the Indonesian waters, covering all the geographic distribution of Anguilla species that were expected to occur in the country (see Appendix 1). Around 800 specimens are silver eels while the others are glass eels. Samples collection was conducted in rivers estuaries along the coasts of Indian Ocean, Pacific Ocean and around Arafura and Celebes Seas. The specimens were collected from 2008 to 2012. Species assignation was preliminary performed by using available morphological keys (Watanabe et al. 2004a and Reveilac et al. 2007). The first morphological characters, which are measurements in this study, a quantitative one as follows: the total length (LT), the dorsal fin length (LD), the anal fin length (LA). These measurements were used to calculate the distance between the origin of the dorsal and anal fins (DA) using the formulation

DA=100(LD – LA)LT-1 (Reveillac et al. 2007) (Fig.3). This character determined whether an individual was short-fin (FS) or long fin (FL). The accuracy of the

measurement is 0.01 mm by using the digital caliper. The second measurement of morphological character was qualitative parameters that are presence or absence of marbling and breadth of maxillary bands. According to Watanabe et al. (2004a) genus Anguilla can be divided into four groups based on three characters: presence or absence of marbling, wide and narrow maxillary band of teeth and origin of the dorsal fin; group 1, groups long dorsal fin with marbling skin and broad maxillary bands of teeth; group 2, groups long dorsal fin with marbling skin and narrow maxillary bands of teeth; group 3, groups long dorsal fin and no marbling and group 4, groups short dorsal fin without marbling skin. Tissues from anal fin, which were immediately stored in 95% ethanol, were used for genetic analysis.

Design of PCR primer

Nine semi-multiplex PCR primers were designed from sequence alignment performed on the cytochrome b (cyt b) and the 16S rRNA genes. The Cyt b and 16S rRNA sequence dataset include sequence from GenBank (ref. AP007236, AP007237, AP007238, AP007239, AP007241, AP007242, AP007246) and 100 sequences obtained during the present study. Nine position of original sets for semi-multiplex PCR primers are shown in Table 1. Each

species-sp

of cyt b fr

show in Ta

pecific prim ragments a

able 2.

mer pairs wa nd one of t

as designed two differen

d to amplify nt lengths o

one of five of 16S rRN

different le A fragment ngths ts, as Figu mar narr LT= of m PCR amp The fi suitable a PCR in a the primer volume of (25mM), 1 primer (co (5u/µl),

(b)

(a)

ure 3 M bling, (b) w row maxillar

total length maxillary ban

plification a

irst step of annealing te

Mastercycle rs were mix f 10 µl cont 1.25 µl dN ommon pri 0.2 µl d

L

T

(c)

easuremen without ma ry bands of h. Eels draw

nds created

and sequen

semi-multip emperature er gradient xed in one P

taining 2 µl TP (2mM), mer) is 1 ddH2O an

nt morpho arbling, (c)

f teeth, LD wing are ad d by myself.

ncing

plex PCR a for all spe (Eppendorf PCR solutio

5x Green 0.5 µl eac

µl (10mM) nd 1 µl

logy charac broad max D= dorsal fin dapted from

mplification ecies-specif

f, Le Pecq, on. The PC GoTaq@ re ch primer ), 0.05 µl template

(d)

L

D

cter of spe xillary band n length LA m Silfvergrip

n was to est fic primers France). In R was carr eaction buff (10mM) ex GoTaq@ D DNA (

L

L

A

ecimen, (a) ds of teeth

=anal fin le (2009) and

) with h, (d) ength,

d that

tablish the s by using s second ste ried out in a fer, 0.5 µl M xcept FCYT DNA polyme

(around 2 same imple ep, all a total MgCl2 T-EEL erase 20ng). 13

Table 1 Position of nine species-specific primers for semi-multiplex PCR on cytochrome b and 16s rRNA genes respectively. Two positions for forward primers (FCYT-EEL and F16S-EEL) and seven positions for reverse primers. See Table 2 for nucleotide sequence of primers.

Semi-multiplex-PCR was carried out in a Thermal Cycler from Bio-Rad, programmed to perform a denaturation step at 95oC for 5 min, followed by 35 cycles consisting of 45s at 95oC, 45s at 50oC (see Results) and 1 min at 72oC. The final extension step (at 72oC) was 10 min. Five microliters of each PCR product were loaded on a 1,5% agarose electrophoresis gel, stained with Cyber Safe before electrophoresis at 100 volt for 90 min. The DNA band were observed under Blue Light and photographed by Canon camera digital

Five individuals of each banding pattern were sequenced on cytochrome b gene with the primer pair F-EEL-Cytb: 5’ CCA CCG TTG TAA TTC AAC 3’ and R-EEL-Cytb: 5’ AAG CTA CTA GGC TTA TC 3’. To ensure the identification of species, alignment was done by using Mega 5.0 (Kumar et al. 2008) and compared with published sequences.

Table 2 Species-specific primer sequences for semi- multiplex PCR, and PCR product lengths expected for the seven Anguilla species and subspecies

Gene Primers Sequence (5'----3') Lengths of PCR

amplification (bp) Specific species Cytochrome b FCYT-EEL TAGTGGATCTACCAACCC (Forward)

R-BICO AGACAAATGAAGAAGAATGA 230 A. bicolor bicolor

R-BPAC ATGTTAGGGCAGTTAGC 670 A. bicolor pacifica

R-MAR GTGGAATGGAATTTTGTC 620 A. marmorata

R-CEL ATCTGGATCTCCAAGAAGA 720 A. celebensis

R-INT CGTAGGCGAATAGAAAG 795 A. interioris

16S rRNA F16S-EEL AGGAGAAGAAGGAACTCG (Forward)

R-NNEB TTGGATCATATTTAACGTTT 372 A. nebulosa nebulosa

R-BORN AAGTTTAGGGGTATTCCC 450 A. borneensis

Result

Nine species-specific primers have been designed after the alignment of complete cytochrome b and 16S rRNA genes, including two forward primers (FEEL-CYT and FEEL-16S) and seven reverse primers (BIC0, BPAC, R-MAR, R-CEL, R-INT, R-NNEB and R-BORN) (see Table 2). The seven species-specific fragments were successfully amplified at 50oC annealing temperature. Five species and subspecies of tropical eel were distinguished by cytochrome b gene with one forward and five species-specific reverse primers are A. b. bicolor,

A. b. pacifica, A. marmorata, A. celebesensis and A. interioris. Two species were

distinguished by 16S rRNA gene with one forward and two species-specific reverse primers are A. n. nebulosa and A. borneensis. For the series analyses, the whole 9 primers were added in the mix amplifiying their corresponding DNA

fragm semi beca ampl

ments in on i-multiplex ause of the

lification fra

e step PCR PCR assay eir bad qua agments.

R. A total of y. Only 3 o ality DNA.

f 1115 sam out of 1115 Figure 4 s

ples have b 5 sample co shows sev

been amplif ould not be ven differen

fied by this e amplified nt sizes of

M  1   2    3    4    5     MM   6   7    8   9  10    11  12  133  14   15  16  177   M  18  19  200 21  22  M  23  24  25  26  27  M 

395   F T b m u T Unsp deter minu F in or also three indiv were unsp

but o silve beca (Moc spec ident Morp pairs

Figure 4. Iden The orde of th b. pacifica, 11 marmorata, 23 unexpected ba

The sizes o pecific ban

rmination. utes migratio Five individ rder to conf done for in e specimen vidual in line e confirmed pecific band

The quan only 769 sp

r eel stage ause the m

chioka 200 cimens is sh

tification of phological a s of taxa: A

5 bp 230 bp

ntification spec he sample is a

-12 are A. bor 3-25 and 27 a and.

of these se nds are a The differe on of the PC duals of eac

firm the exp dividuals sh ns showed e 27 to Fig d as A. int

s of 230 an titative mea pecimens po e. The qua

orphologica 03). The fo

hown in Tab all specim analyses fa

A. celebese

230 bp 670

cies and subs as follow : 1-2 rneensis, 13-1 are A. interioris

even specie also produ ent fragme CR product ch banding pected iden howing une d unexpec gure 4). One

terioris. A

nd 620 bp. asurement ossible to m alitative me

al character our morph ble 3. The

ens (excep iled to iden

ensis versu

0 bp 450 bp

pecies of Ang are A. n. nebu 17 are A.celeb s, M=100 bp l

es-specific f uced, whic

nts sizes c on a 1,5 % pattern typ ntification. S expected ba cted band

e of showe As a result,

of DA was measureme asurements rs in this s

ological gr right side o pt 3), based tify glass e

us A. interi

720bp b

guilla by semi-ulosa, 3-7 are besensis, 18-2 adder, u

fragments a ch does n

can be eas % agarose e pes were se Sequencing anding patte among 1 ed DNA dam

, A. interio

applied on ent by a qua

s are inapp tage are no rouping dis of Table 3 i d on semi-m eels and can

rioris, A. n.

620bp b

multiplex PCR A. b. bicolor, 22 and 26 are nspecific band

are given i not impede

ily observe lectrophore equenced a g and alignm ern. In this s

115 exam mage and t

oris can pro

n all 1115 s alitative one plicable on ot clearly e stinguishing s species-s multiplex P nnot disting nebulosa bp 795 b R samples. 8-10 are A. A.

ds, =

n Table 2.

e species ed after 90 esis gel. nd aligned ment were study, only ined (see two others oduce two specimens, e that only glass eel established g the 769

subspecies CR assay. guish three versus A.

5bp   -400 -300 -200 -650 -1000 -500 -850 -100 16

marmorata and A. b. bicolor versus A. b. pacifica. Only A. borneensis is identifiable by morphological character only, as a “long fin” without marbling eel. These results are in agreement with Watanabe (2003).

Table 3. Identification eel by morphology (only 796 eels were classified into the four group) and semi-multiplex-PCR (1112 eels were identified among 1115 eels)

Group by morphology (n) Species (n) by multiplex PCR − Long dorsal fin with marbling skin and

broad maxillary bands of teeth (15)

: A. celebenesis (47), A. interioris (16) − Long dorsal fin with marbling skin and

narrow maxillary bands of teeth (428)

: A. marmorata (487), A. n. nebulosa (15) − Long dorsal fin, without marbling skin (3) : A. borneensis (3)

− Short dorsal fin, without marbling skin (323) : A. b. bicolor (510), A. b. pacifica (34)

Discussion

Since morphological identification was not sufficient to determine Anguilla

species and subspecies, several molecular approaches have been proposed on previous study. Most of the identification methods used simple PCR followed by sequencing (Sezaki et al. 2005; Trautner 2006). However, sequencing is not convenient for large samples because of its cost in time and money. Some of the studies have used multiple loci such as RFLP-PCR (Aoyama et al. 2001, 2000;

Lin et al. 2001) and RAPD-PCR (Kim et al. 2009) with non species-specific

primers, which mean that many loci are needed for identification. Besides, the number of species determined with each above-mentioned method is limited, such as two species (Aoyama et al. 1999; Sezaki et al. 2005) or four species (Kim et al. 2009).

The semi-multiplex method proposed here has demonstrated to be efficient for identifying seven species and sub-species of tropical eel with only one step PCR. By using this method, one could reduce the number of necessary sequences while the results are very sure for each species determination (we easily identified 1112 specimens). All of species were obtained in this study have show overlapping morphology and distribution. Moreover for small specimens (mainly glass eels), the molecular method appears as indispensable.

Shen et al. (2010) suggested several additional criteria which must be taken into account when considering multiplex PCR assay 1) minimize primer dimer association between all of the primers; 2) similarity of the annealing temperature of each primer; 3) primer specificity; and 4) constraint the migration of the amplicons in order to separate the DNA fragments in agarose gel

18

electrophoresis. In the present survey each primer is species or subspecies-specific and the limited cases of unexpected (non-subspecies-specific) amplification never reduced the liability of species determination. Banding pattern of A. b. pacifica

shows a weak specific fragment of 670 and a bigger un specific band of 230, but this fragment pattern being stabile for all our A. b. pacifica specimens, there is no difficulty to determine this species.

The length of amplified fragments was clearly distinguishable after electrophoresis migration (no overlapping fragment). The primer structure was checked in order to avoid inter-molecules interaction, which is an important precaution with 9 primers simultaneously mixed in one step PCR. Optimization of the semi-multiplex PCR mix consisted in designing an annealing temperature and quantity of primer permitting was similar to amplification efficiency to pairs of primers.

Semi-multiplex PCR methods has been introduced recently on eels by Gagnaire et al. (2007) in order to rapidly determinate tree species of Anguilla: A.

marmorata, A. megastoma and A bicolor bicolor from West Indian Ocean.

Genetic distances between each species pairs in genus Anguilla are almost 0,02 until 0.05 based on 16S rRNA (Watanabe 2003). This study has established a rapid method to distinguish even two subspecies A. b. bicolor and A. b. pacifica, although these two subspecies have low genetic distance which is 0.0068 based on the 16S rRNA

This method has proven to be the most simple, quicker, lower cost (no acrilamide migration), specific/sensitive, and highly reliable way than the other ones used before. This rapid method provides a useful tool for aquaculture, global marketing, and academic-scientific research.

III. Distribution of Tropical Eel Genus

Anguilla

in

Indonesian Waters Based on Semi-multiplex PCR

Abstract

Tropical eels living in Indonesian waters are known to be composed of several species, but their real listing together with their distribution ranges need to be established. The main difficulties are the very high number of islands with perennial rivers where these species are living during the growth phase of their life cycle. It is difficult, sometimes impossible, to determine the species using morphological characters, moreover on glass eels. In order to establish the geographic distribution of tropical eels of the genus Anguilla in Indonesian waters, a total 1115 specimens were collected between 2008 and 2012. Sample collection was done in the growth habitats that are rivers and estuaries by commercial nets of different categories according to the fish size. All samples were identified genetically using the recently developed semi-multiplex PCR method. Four species and subspecies was recognized with wide distribution:

Anguilla bicolor bicolor, A. b. pacifica, A. marmorata and A. interioris; two species

with limited distribution, close to endemism: A. celebesensis and A. borneensis

and one subspecies A. nebulosa nebulosa that is only spread in river flowing into Indian Ocean.

Key words:Anguillaspp, semi-multiplex PCR, tropical eel, distribution range, Indonesian waters

 

Introduction

The catadromous freshwater eels genus Anguilla is distributed nearly world-wide except the South Atlantic and the Eastern Pacific oceans (Ege 1939). Freshwater eels spawn in the offshore ocean. After hatching, their larvae migrate to coastal areas as pelagic, floating and transparent (Mochioka 2003). Eel larvae, called leptocephali, are transported passively by warm currents flowing at low latitudes. When they approach the continental shelf, leptocephali metamorphose into glass eels before settling in the continental waters (rivers and lakes) to grow for years until changing into yellow eels or “elver” and then silver eels. The dispersal of leptocephali not only drives the distribution of freshwater eel species

on continental areas, but also the phylogeography of the genus and its evolution (Aoyama and Tsukamoto 1997).

After Johannes Schmidt succeeded collecting anguillid leptocephali in the Sargasso Sea in 1922 (Schmidt 1922), he and his colleagues, through Carlsberg Foundation’s Oceanographic Expedition, continued their efforts by searching for the spawning areas of freshwater eels in the Indo-Pacific region where most of the species of this genus are found. They successfully collected leptocephali in the Indo-Pacific region during their expedition from 1928 to 1930 (Jespersen 1942). However, most of these leptocephali have overlapping morphological characters, hampering exact identifications. Since then, the spawning areas of the Indo-Pacific anguillid species have remained a mystery. As a result, the studies of Indo-Pacific eels are still poorly understood as well as the exact locations of the spawning areas, and their larval migrations and the recruitment mechanisms.

To solve the problems in identifying anguillid leptocephali, genetic approaches, mtDNA sequences or RFLP, has been successfully used (Aoyama

et al. 1999, 2001a, 2001b; Aoyama 2003; Watanabe et al. 2005). Since species

identification of anguillid leptocephali has been developed, projects aimed at learning more about the spawning areas, larvae distribution and larval ecology of anguillid in the Indo-Pacific region have been organized. The long scientific cruise of the Baruna Jaya, in central Indonesia sea, around Sulawesi Island, from 2001-2002, successfully collected leptocephali of A. marmorata, A. bicolor pacifica and

A. interioris. This survey also collected leptocephali of A. celebesensis and A. borneensis allowing to deduce the spawning areas of these species (Aoyama et al. 2003, Wouthuyzen et al. 2009). In 2003 this cruise also collected young leptocephali A. bicolor bicolor in west Sumatera, positioning a spawning area of

A. b. bicolor in this zone (Aoyama et al. 2007).

The three Indonesian endemic species spawning areas are also to be discovered: leptocephali of A. interioris have been caught in western Sumatera waters (Aoyama et al. 2007) and Sulawesi waters (Aoyama et al. 2003, Wouthuyzen et al. 2009); leptocephali of A. celebesensis were recognized in Tomini Bay Sulawesi Island and that of A. borneensis were found in Makasar strait (Aoyama et al. 2003; Wouthuyzen et al. 2009).

According to the geographic range of each species, Aoyama et al. (2001) and Lin et al. (2001) who studied genus Anguilla molecular phylogenetics based

on partial mtDNA, showed four major subgroups in the world, that are Oceanic, Atlantic, Tropical-Pacific and Indo-Pacific lineages. However, the complete mtDNA sequence of all species of genus Anguilla was determined recently by Minegishi et al. (2005) which suggested the geographic structure of eel as follow: two Atlantic species (A. rostrata and A. anguilla), two Oceanic species (A.

differenbachii and A. australis), and nine Indo-Pacific species (A. japonica, A.

reinhardtii, A. marmorata, A. nebulosa, A. bicolor, A. interioris, A. celebesensis,

A. megastoma and A. obscura). Seven species/subspecies of the Indo-Pacific

Anguilla occur in the western Pacific and eastern Indian Ocean around Indonesian waters (Ege 1939; Castle & Williamson 1974). Because of this high diversity, several scientists considered that “Indonesia is homeland of anguilid”. Besides, Indonesia is also known as "the origin of anguillid" because phylogenetic analyses indicated that the endemic tropical species A. borneensis

from eastern Borneo (Kalimantan) is one of the most basal species of the genus (Aoyama et al. 2001; Minegishi et al. 2005).

Among the 19 existing eel species and sucspecies, 7 occupy the Indonesian rivers. Half of them are endemic, limited to Indonesia (A. borneensis,

A. cebesensis, A. interioris), the others show larger range distribution (A.

obscura, A. nebulosa), sometimes established at the Indo-Pacific level (A. bicolor

and A. marmorata). However, the species range distribution of the 7 Indonesian

species is only an extrapolation of very limited records.

The widespread species A. bicolor and A. marmorata are of interest because their distribution and abundance place them in central economic position, and because their exceptional geographic distribution (over 18,000 km east-west) and structure made them an important model for eel biology understanding, encompassing probably several spawning areas. Short fin eels A.

bicolor are considered to be structured into two subspecies A. b. bicolor in Indian

Ocean, especially at the west of Indonesia and A. b. pacifica in Pacific Ocean, at the east of Indonesia (Minegishi et al. 2012).The giant mottled eel A. marmorata

is not taxonomically divided into subspecies because of its morphological stability, however molecular studies have demonstrated its structure into four differentiated populations: North Pacific, South Pacific, Indian Ocean, and Mariana (Minegishi et al. 2008; Gagnaire et al. 2009, 2011).

One of the most exigent parts of this study is sampling strategy. Indonesia is an archipelago country with counts 17000 islands, among them several

thousand islands possibly hosting eels so a complete sampling is impossible. The selection of representative sampling location is necessary.

Indonesian sea have a complex topography and connectivity between the Pacific and Indian Oceans, so surface heat fluxes, thermo cline and variability in thermocline waters and patterns of Indonesia current was influenced by Pacific and Indian Ocean fluctuations. The eastern part of Indonesia waters influenced by the Indonesian throughflow (ITF) current. ITF are water mass flow passing through Indonesian waters from Pacific to Indian Ocean. This water mass flow occurs as a result of the pressure difference between the two oceans. The water mass drives upper thermocline water from the North Pacific through the western route of the Makassar Strait directly exit through the Lombok Strait or flow eastward into the Banda Sea and further joined with the south equatorial current (SEC) (Wirtky 1973; Gardon 2005). The western Indonesian waters affected by South Equatorial Counter Current (SECC), and this current going down the Sumatran coast entry to southern coast of Java by South Java Current (SJC).

A new molecular identification method has been developed recently to distinguish seven tropical eel inhabiting Indonesian waters, called semi-multiplex PCR assay. By using multiple species-specific primers in one PCR reaction, the identification of all Indonesian species is now simple, quick, low cost, sensitive, and highly reliable (Fahmi et al. 2012).

In this study the semi-multiplex PCR methodology was used in order to establish a first map distribution of species and subspecies of tropical eel

(Anguilla spp) that inhabit in Indonesian water.

Material and Methods

The 1115 specimens were collected in 28 locations around the Indonesian waters, covering the whole geographic distribution of genus Anguilla

as known or expected in Indonesian waters (Appendix 1, Table 4). Specimens collection was conducted in river estuaries along the coast of Indian Ocean, Pacific Ocean and around Arafuru and Celebes Seas. The specimens were collected from 2008 to 2011 by using traps, nets and fishing. Oceanographic data of Indonesian seas (Gardon 2005) used for looking the movement of water and the possible spread of eels.

All of specimens were identified using semi-multiplex PCR protocol according to Fahmi et al (2012 (in press)). Nine species-specific primers were

added in one PCR reaction. The PCR was carried out in a total volume of 10 µl containing 2 µl 5x Green GoTaq@ reaction buffer, 0.5 µl MgCl2 (25 mM), 1.25 µl

dNTP (2 mM), 0.5 µl each primer (10 mM) with 1 µl (10 mM), 0.05 µl GoTaq@ DNA polymerase (5 u/µl), 0.2 µl ddH2O and 1 µl template DNA (around 20 ng).

Semi-multiplex-PCR was carried out in a Bio-Rad Thermal Cycler, programmed to perform a denaturation step at 95oC for 5 min, followed by 35 cycles with 45 s at 95oC, 45 s at 50oC and 1 min at 72oC. The final extension step (at 72oC) lasted 10 min. Five microliters of each PCR product were loaded on a 1,5% agarose electrophoresis gel, stained with Cyber Safe before electrophoresis and migrated at 100 volts for 90 min. The DNA bands were observed under Blue Light and photographed by a Canon camera digital.

Result

A total of 1115 freshwater eels were collected and genetically identified as

A. marmorata (487), A. b. bicolor (510), A. b. pacifica (34), A. interioris (16), A. n.

nebulosa (15), A. celebesensis (47) and A. borneensis (3). Only 3 specimens

were not identifiable because of the DNA was damage. This is a first investigation on freshwater eel distribution in Indonesian waters, using species and subspecies specific primers. The first four species and subspecies are wide distribution anguillids spread from western to eastern Indonesia waters (Fig 5a,b,c) and far outside this zone.

A. marmorata was found in almost all sampling locations except Station 4,

8,13 and 15 (Fig. 5b). However, by enhancing the sampling frequency, it is likely that this species would be seen everywhere. The highest abundances of A.

marmorata are in Sulawesi and Ambon waters, whereas around Sumatra Island

this species is commonly found in Bengkulu and Mentawai waters.

Another species has a wide distribution. The shortfin A. bicolor, according to its geographic distribution, is divided into two subspecies, A. b. bicolor in western Indonesia, in waters connected with Indian Ocean and A. b. pacifica

spread in the east of Indonesia receiving Pacific Ocean waters (Fig. 5a). A. b.

pacifica has been recorded in the north of Sulawesi, eastern of Borneo and

Maluku waters (Fig. 5a). This paper was constituted the first report of the presence of A. b. pacifica in Borneo and Maluku.The abundance of A. b. pacifica

in eastern Borneo is so high, the harvest of this species has been done intensively by fishermen for economic purposes.

24

Table 4. List of sampling locations of tropical eels in Indonesia

No Sampling Location Code Sampling date No. of

individuals Stade

1 Estuary of Tadu, Aceh Ace January 2010 40 Silver eel

2 Sea Waters of Smeulue Ace March 2012 8 Silver eel

3 Sea Waters of Mentawai Men June 2011 42 Silver eel

4 Estuary of Bungus River, Padang(1-45) Pad 1 August 2008 50 Silver eel

5 Tarusan River, Painan, Padang(46-97) Pad 2 February 2008 37 Silver eel

6 -Estuary of Ketaun River, Bengkulu, Sumatera Ben December 2009 23 Silver eel

-Estuary of Ketaun River, Bengkulu, Sumatera Ben March 2009 8 Silver eel

-Estuary of Ketaun River, Bengkulu, Sumatera Ben June 2008 51 Glass eel

7 -Estuary of Cimadiri, Pelabuhan Ratu, Java Pel 8 August 2009 30 Glass eel

-Estuary of Cimadiri, Pelabuhan Ratu, Java Pel 9 September 2009 30 Glass eel

-Estuary of Cimadiri, Pelabuhan Ratu, Java Pel 10 October 2009 43 Glass eel

-Estuary of Cimadiri, Pelabuhan Ratu, Java Pel 11 November 2009 23 Glass eel

-Estuary of Cimadiri, Pelabuhan Ratu, Java Pel R June 2008 163 Glass eel

8 Estuary ofPangandaran, Java Pang June 2009 20 Silver eel

9 Estuary of Cilacap, Java Cil June 2009 18 Silver eel

10 Estuary of Mengereng River, Bali (1-30) Bal 1 June 2009 30 Silver eel

11 Unde River, Bali(31-62) Bal 2 December 2009 31 Silver eel

12 Estuary of Labuan Haji River, Lombok Lom September 2009 14 Silver eel

13 Estuary of Bengalon River, Borneo Beng October 2010 11 Silver eel

14 Estuary of Sangata River, Borneo Sang October 2010 14 Silver eel

15 Estuary of Mahakam River, Borneo Mah October 2010 3 Silver eel

16 -Estuary of Lasusua River, Celebes Las 1 October 2008 64 Silver eel

-Estuary of Lasusua River, Celebes Las 2 September 2009 40 Silver eel

17 Estuary ofSalusuna River Sal October 2010 1 Silver eel

18 Estuary of Donggala River, Celebes Dong October 2010 18 Silver eel

19 -Estuary of Poso River, Celebes Pos April 2010 47 Glass eel

-Estuary of Poso River, Celebes Pos December 2011 30 Glass eel

-Estuary of Poso River, Celebes Pos-S June 2008 37 Glass eel

-Estuary of Poso River, Celebes Pos-J June 2008 24 Glass eel

20 Estuary of Tantena River,Clebes Pal August 2010 7 Silver eel

21 Estuary of Tanah merah, Seram, Ambon Amb November 2010 26 Silver eel

22 Obi Island,Maluku Obi November 2011 12 Silver eel

23 Ware mare River, Papua(1-5, 9-10) Pap November 2010 7 Silver eel

24 Kali Besar River, Papua(11-16) Pap November 2010 6 Glass eel

25 Tanjung Boy River, Papua(6-8) Pap November 2010 3 Silver eel

26 Estuary of Amurang, North Celebes Amu November 2011 51

Silver eel, glass eel

27 Estuary of Poigar, North Celebes Poig January 2012 30 Glass eel

28 Estuary of Inobonto, North Celebes Ino November 2011 23 Silver eel

Total specimens 1.115

The last widespread species found in Indonesian waters was A. interioris. This species is not found in many Indonesian sampling stations as the other two widespread species. A. interioris was found in the waters of Mentawai, Lombok, Poso and the western part of Papua. The abundance of this species was relatively high in the waters of Mentawai and the harvest of adult eels is done intensively for its high economic benefice (Fig. 5c).

Inoue JG, Miya M, Tsukamoto K, Nishida M. 2004. A mitogenomic perspective on the basal teleotean phylogeny: resolving high level relationship with longer DNA sequence. Mol. Phyl. Evol. 32: 274-286.

Inoue JG, Miya M, Miller MJ, Sado T, Hanel R, Hatooka K, Aoyama J, Minegishi M, Nishida M, Tsukamoto K. 2010. Deep-ocean origin of the freshwater eels. Biology Letters, 6, 363–366.

Ishikawa S, Tsukamoto K, Nishida M. 2004. Genetics evidence for multiple geographic population of the giant mottle eel Anguilla marmorata in the Pacific and Indian Oceans. Ichthyol. Res; 51: 343-353.

Ishikawa S, Aoyama J, Tsukamoto K, Nishida M. 2001. Population structure of the Japanese eel Anguilla japonica as examined by mitochondrial DNA sequence. Fish. Sci; 67:246-253

Itoi S, Nakaya M, Kaneko G, Kondo H, Sezaki K, Watabe S. 2005. Rapid identification of eels Anguilla japonica and Anguilla anguilla by polymerase chain reaction with single nucleotide polymorphism-based specific probes. Fish. Sci. 71: 1356-1364.

Jain S, Brahmbhait MN, Rank DN, Joshi CG, Solank JV. 2007. Use of Cytochrome b gene variability in detecting meat species by multiplex PCR assay. Indian J. Anim. Sci. 77(9): 880-881.

Jespersen P. 1942. Indopacific Leptocephali of the genus Anguilla: systematic and biology studies. Dana Rep.; 22: 1-128.

Kim W-J, Kong H-J, Kim Yo, Nam BoHye, Kim K-K. 2009. Development of RAPD-SCAR and RAPD-generated PCR-RFLP Markers for identification of four Anguilla ell species. Anim. Cell. Sys. 13:179-186.

Kimura S, Tsukamoto K, Sugumoto T. 1994. Model of the larval migration of the Japanese eel: role of the trade winds and salinity front. Mar.Biol; 119: 185-190.

Kumar S, Nei M, Dudley J, Tamura K. 2008. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequence. Brief. Bioinformatics. 9(4): 299-306.

Lehman D, Hettwer H, Taraschewski H. 2000. RAPD-PCR invertigation of systematic relationships among four species of eels (Teleotei:Angillidae), particularly Anguilla anguilla and A. rostrata. J. Mar. Biol. 137:195-204 Li WH. 1942. Molecular Evolution. Sinauer Associates Publisher.

Lin WF, Hwang DF. 2008. A multiplex PCR assay for species identification of raw and cooked bonito. J. Food Control. 19: 879-885.

Lin YS, Poh YP, Tzeng CS. 2001. A phylogeny of freshwater eels inferred from mitochondrial genomes. Mol. Phylogenet.Evol; 20: 252–261.

Lydeard JG and Roe KJ. 1997. The phylogenetic utility of the mitochondrial cytochrome b gene for inferring relationships among Actinopterygian Fishes. In: Molecular Systematic of Fishes. Kocher TD and Stepien (eds). Academic Press. San Diego.

Mank JE, Avise JC. 2003. Microsatellite variation and differentiation in North Atlantic eels

Michioka N. 2003. Leptocephali. In: Aida K,Tsukamoto K, Yamauchi K (eds). Eel Biology. Springer, Tokyo. pp.19-29.

Miller MJ. 2003. The worldwide distribution of Anguillid leptocephali. In: Aida K,Tsukamoto K, Yamauchi K (eds). Eel Biology. Springer, Tokyo. pp.157-168.

Miller MJ, Tsukamoto K. 2004. An introduction on leptocephali: Biology and identification. Ocean Research Institute. University of Tokyo. Tokyo

Minegishi Y, Aoyama J, Inoue JG, Miya M, Nishida M, Tsukamoto K. 2005. Molecular phylogeny and evolution of the freshwater eel genus Anguilla based on the whole mitochondrial genome sequence. Mol. Phylogen. Evol; 17: 3109-3122.

Minegishi Y, Aoyama J, Tsukamoto K. 2008. Multiple population structure of the giant mottle eel Anguilla marmorata. Mol.Ecol; 17: 3109-3122.

Minegishi Y, Aoyama J, Inoue JG. Azanza,RV, Tsukamoto K. 2009. Inter-specific and subspecific genetic divergences of freshwater eels, genus Anguilla including a recently described species, A. luzonensis, based on whole mitochondrial genome sequences. Coastal Marine Science, 33, 64–77. Minegishi Y, Gagnaire PA, Aoyama J, Bosc P, Feunteun E, Tsukamoto K,

Berrebi P. 2012. Present and past genetic connectivity of the Indo-Pacific tropical eel Anguilla bicolor. J. Biogeogr; 39: 408–420.

Nelson JS. Fishes of the World( 4th ed). John Wiley & Sons-New Jersey, USA. 2006. p: 114-115.

O’Reilly P, Wright JM. 1995. The evolving technology of DNA fingerprinting and its application to fisheries and aquaculture. J. Fish Biol. 47: 29–55.

Palumbi SR. 1994. Genetic divergence reproductive isolation and marine speciation. Annual Review of Ecology and Systematics 25: 547–572

Pritchard JK, Stephens M, Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetic; 155:945-959

R’eveillac ER, Gagnaire PA, Lecomte RF, Berrebi P, Robinet T, Valade P. 2009. Develipment of a key using morphological character to distinguish south-western Indian Ocean anguillid glass eels. J. Fish Biol. 74: 2171–2177. Ringuet S, Muto F, Raymakers C. 2002. Eel: Their Harvest and Trade In Europe

and Asia. Traffic Bulletin. Vol 19. No 2

Rompler H, Dear PH, Krause J, Meyer M, Rohland N, Schöneberg T, Spriggs H, Stiller M, Hofreiter M. 2006. Multipleks amplification of ancient DNA. Nature. 1: 720-728.

Ryman N and Utter F. 1986. Population genetic and fisheries management. University of Washington Press.

Sang TK, Chang HY, Chen CT, Hui CF. 1994. Population structure of Japanese Eel, Anguilla japonica. Mol. Biol. Evol 11(2):250-260.

Schmidt J. 1922. The breeding places of the eel. Phil.Trans.R.Soc.Lond; 211: 179-208.

Setiawan IE, Michioka N, Amarullah H, Nakazono A. 2001. Inshore migration and spawning season of thetropical eel Angilla bicolor bicolor recruiting to the Cimandiri River estuary, Java Island. Indian Ocean. In: Aida K, Tsukamoto

76   

K, Yamauchi K (eds). Proceedings of the International Symposium Advances in Eel Biology. The University of Tokyo. Tokyo. pp. 125-127. Sezaki K, Itoi S, Watabe S. 2005. A simple method to distinguish two

commercially valuable eel species in Japan Anguilla japonica and A. anguilla using polymerase chain reaction strategy with a species-specific primer. Fish. Sci. 71: 414-421.

Shen Z, Wubin Qu, Wen Wang, Yiming Lu, Yonghong Wu, Zhifeng Li, Xingyi Hang, Xiaolei Wang, Dongsheng Zhao, Chenggang Zhang. 2010. MPprimer: a program for reliable multiplex PCR primer design. BMC Bioinformatics. 11:143.

Shen KN, Tzeng WN. 2007. Population genetic structure of the year-round spawning tropical eel, Anguilla reinhardtii, in Autralia. Zool. Studies; 46:441-453

Silfvergrip AMC. 2009. CITES identification guide to the freshwater eels (Anguillidae). Swedish Environmental Protection Agency. 135p.

Sugeha HY, Suharti SR, Wouthuyzeu S, Sumadhiharga K. 2008. Biodiversity, distribution and abundance of the tropical Anguillid eel in the Indonesia waters. Marine Research in Indonesia; 33: 129-13.

Tagliavini J, Gandolfi G, Deiana AM, Salvadori S. 1996. Phylogenetic relationship among two Atlantic and three Indo-Pacific Anguilla species (Osteichtyes, Anguillidae). Ital. J. Zoo; 63: 271-276.

Tesch FW. 1977. The Eel, Biology and management of Angillid eels. Chapman & Hall. London.

Trautner J. 2006. Rapid identification of European (Anguilla anguilla) and Nort American eel (Anguilla rostrata) by polymerase chain reaction. Inf. Fischereiforsch. 53: 49-51.

Tseng MC, Chen CA, Kao HW, Tzeng WN and Lee SC. 2001. Polymorphisms of GA/GT microsatellite loci from Anguilla japonica. Marine Biotechnology 3: 275–280

Tseng MC. 2012. Evolution of microsatellite loci of tropical and temperate Anguilla eels. Int. J. Mol. Sci. 4281-4294; doi 10.3390/ijms13044281.

Tsukamoto K. 1992. Discovery of the spawning area for Japanese eel. Nature. 356: 789–791.

Tsukamoto K and Aoyama J. 1998. Evolution of freshwater eel of the genus Anguilla: a probable scenarion. Env. Biol. Fish; 58: 139-148.

Tsukamoto K, Aoyama J and Miller MJ 2002. Migration, speciation and the evolution of diadromy in anguillid eels. Canadian Journal of Fisheries and Aquatic Science; 59: 1989–1998.

Watanabe S. 2003. Taxonomy of the freshwater eels genus Anguilla. Schrank, 1798. In: Aida, K., Tsukamoto, K., Yamauchi, K. (Eds.), Eel Biology. Springer-Verlag.Takyo. 3–18.

Watanabe S, Aoyama J, Nishida M, Tsukamoto K. 2004a. Reexamination of Ege’s (1939) use of taxonomic carácter of the genus Anguilla. Bull. Mar. Sci. 74(2): 337-351.

78   

using real-time PCR: an onboard application for use during sampling surveys. Mar.Biotechnol. 6: 566–574.

Watanabe S, Aoyama J, Tsukamoto K. 2005. A molecular genetic evaluation of the taxonomy of the genus Anguilla (Pisces: Anguilliformes). Bulletin of Marine Science 76(3):p 675-690.

Watanabe S, Aoyama J, Nishida M and Tsukamoto K. 2005. Evaluation of the population structure of Anguilla bicolor bicolor using total number of vertebrae and the mtDNA control region. Coastal Marine Science 29: 165– 169.

Watanabe S, Aoyama J, Tsukamoto K. 2008. The use of morphological and molecular genetic variation to evaluated subspecies issue in genus Anguilla. Coast. Mar. Sci. 32(1): 19-29.

Watanabe S, Aoyama J, Tsukamoto K. 2009. A new species of freshwater eel Anguilla luzonensis (Teleostei: Anguillidae) from Luzon Island of the Philippines. Fish Sci 75:387–392. DOI 10.1007/s12562-009-0087-z

Wirth T and Bernatchez L. 2001. Genetic evidence against panmixia in the European eel. Nature 409: 1037–1040

Wouthuyzen S, Aoyama J, Sugeha HY, Miller MJ, Kuroki M, Minegishi Y, Suharti SR and Tsokamoto K. 2009. Seasonality of spawning by tropical anguillid eels around Sulawesi Island, Indonesia. Naturwissenschaften; 96:153–158. Wright S. 1978. Evolution and the genetic of population. Volume 4. Variability

within and among natural populations. University of Chicago Press. Chicago

Wyrtki K. 1961. Physical oceanography of the Southeast Asian waters. Naga Report2. Scripps Institution of Oceanography. La Jolla. CA. pp 195.

Xu TT, Abbott R, Milne RI, Mao K, Du FK, Wu GL, Ciren ZX, Miehe G and Liu JQ. 2010. Phylogeography and allopatric divergence of cypress species Cupressus L. In the Qinghai–Tibetan Plateau and adjacent regions. BMC Evolutionary Biology 10: 194

SUMMARY

MELTA RINI FAHMI. Phylogeography of Tropical Eel (Anguilla spp) in Indonesia Waters. Supervised by DEDY DURYADI SOLOHIN, PATRCIK BERREBI, KADARWAN SOEWARDI and LAURENT POUYAUD

The freshwater eels (Anguilla spp: Anguillidae) are popular as a commercial important food, because of good nutritional value. These fish are also a well known for their unique catadromous life histories. These species breed far from offshore after migrate thousands kilometers from their growth habitats in freshwater and estuarine to their spawning area in oceanic waters. Most of the investigations concerning eels are concentrated on temperate species, in the north hemisphere mainly because of the economic importance of these species. Nowadays, the population of temperate eel, dramatically decrease is caused by habitat damage, illegal fishing and climatic changes in the ocean. As a consequence, tropical eels become important eel nowadays in the market, as well as the research on tropical eels become a new challenge. One of primary problems in tropical eels is that they have overlapping range of most morphological character, so species identification on this genus are no more sufficient. Then molecular approaches have been proposed for eel identification.

This study has four main objectives: (1) to establish quick methods of identification of tropical eels; (2) to understand exact distribution and dispersal of tropical eel in Indonesia water; (3) to reveal the phylogenetic relationship among population in Indonesia and (4) to uncover population genetic structure of Anguilla bicolor between two Ocean. All of information obtained in this study revealed the conservation management of tropical eel in Indonesia water.

The semi-multiplex method was proposed in this study has demonstrated the efficiency for in identifying seven species and sub-species of tropical eels with only one step PCR. By using this method, one could reduce the number of necessary sequences while the results are very sure for each species determination (we easily identified 1112 specimens). All of species were obtained in this study showed overlapping morphology and distribution. Especially for small specimens (mainly glass eels), the molecular method appears as indispensable. This method has proven to be most simple, quicker, lower cost (no acrilamide migration), specific/sensitive, and highly reliable way.

The geographic distribution of tropical eels of the genus Anguilla in Indonesian waters was establish by identified genetically of all sample that obtain during this study. The genetically identification applied the semi-multiplex PCR method that recently developed in this study. We recognized four species and subspecies with wide distribution: A. b. bicolor, A. b. pacifica, A. marmorata and A. interioris, two species with limited distribution, close to endemism: A. celebesensis and A. borneensis and one subspecies A. nebulosa nebulosa that is only spread in river flowing into Indian Ocean.

The phylogenetic relationship and genetic diversity was cosntructed and calculated based on mitochondria DNA cytochrome b gene sequence of Anguilla that covering all of the geograpical distribution in Indonesia waters. The genetic structure of populations that responsible for a given genetic architecture and evolutionary factors is an important objective of population genetics. In this study we present genetic diversity and phylogenetic relationship among and within species in genus Anguilla to understanding the evolutionary process of Anguillid that inhabit in Indonesia waters. Seven species of Indonesian tropical eel showed a higher haplotype and nucleotide diversity at the cyt b locus with haplotype and nucleotide diversity (π) were 0,98 and 4,57% respectively. Phylogenetic tree

The economic important shortfinned eel, Anguilla bicolor, has a relatively wide geographic distribution compared to the 19 species and subspecies of genus Anguilla, it is distributed longitudinally from the eastern coasts of Africa through the seas around Indonesia to New Guinea in Pacific Ocean. The genotypes of seven microsatellite DNA were analysed for 180 specimens collected from 10 representative location where two subspecies have been found. Analysis with seven microsetallite loci showed Expected (He) and observed (Ho) heterozigosities of each locus range from 0,594 to 0,921 and from 0,250 to 1,000 respectively. All off locus showed high polymorphic. Based on FST value and clustering test, there is no structure and fragmentation of A. bicolor in Indonesia water.

A critical first step in species conservation is to gain a clear understanding of its taxonomy. Considering Indonesian waters that are inhabited by several sympatric species of tropical eels, almost all morphological character in this genus are overlapping. So a rapid and efficient identification technique is needed. Semi multiplex PCR that has been developed in the present study has successfully distinguished seven species that inhabit the waters of Indonesia through one-step PCR. After established the identification species subspecies methods then we constructed distribution and dispersal pattern, phylogenetic relationship among species that inhabit Indonesian water and population genetic structure of species that have widespread distribution. All of information obtained in this study was needed for conservation management of anguillid in Indonesian water.

Key words: Tropical eel, Anguilla spp, semi-multiplex PCR, Indonesia water and population genetic