Homeodomain Transcription Factor Msx-2 Regulates Uterine Progenitor Cell Response to Diethylstilbestrol
Elyns Publishing Group
http://elynsgroup.com
Copyright: © 2015 Liang Ma, et al.
http://dx.doi.org/10.19104/jstb.2015.105
Explore and Expand
Journal of Stem Cell and Transplantation Biology
Research Article
Open Access
Homeodomain Transcription Factor Msx-2 Regulates Uterine
Progenitor Cell Response to Diethylstilbestrol
Yan Yin1, Congxing Lin1, Ivy Zhang1, Alexander V Fisher2, Maulik Dhandha3 and Liang Ma1*
2
1
Division of Dermatology, Washington University School of Medicine, St. Louis, MO, USA
Department of Surgery, University of Wisconsin School of Medicine and Public Health, Madison, WI, USA
3
Department of Dermatology, Saint Louis University School of Medicine, St. Louis, MO, USA
Received Date: October 30, 2014, Accepted Date: May 04, 2015, Published Date: May 12, 2015.
*Corresponding author: Liang Ma, Department of Medicine, Box 8123, Washington University 660 S. uclid Ave. St. Louis, MO 63110, USA, Fax: 314-4545626; Email: lima@dom.wustl.edu
Abstract
The fate of mouse uterine epithelial progenitor cells is determined
between postnatal days 5 to 7. Around this critical time window,
exposure to an endocrine disruptor, diethylstilbestrol (DES), can
profoundly alter uterine cytodifferentiation. We have shown previously
that a homeo domain transcription factor MSX-2 plays an important role
in DES-responsiveness in the female reproductive tract (FRT). Mutant
FRTs exhibited a much more severe phenotype when treated with DES,
accompanied by gene expression changes that are dependent on Msx2.
To better understand the role that MSX-2 plays in uterine response to
DES, we performed global gene expression profiling experiment in mice
lacking Msx2. By comparing this result to our previously published
microarray data performed on wild-type mice, we extracted common
and differentially regulated genes in the two genotypes. In so doing,
we identified potential downstream targets of MSX-2, as well as genes
whose regulation by DES is modulated through MSX-2. Discovery of
these genes will lead to a better understanding of how DES, and possibly
other endocrine disruptors, affects reproductive organ development.
Keywords: Msx2;
Enviromental hormone
diethylstilbestrol
(DES);
Endometrium;
Introduction
Developmental exposure to endocrine disrupting chemicals
(EDCs) can have catastrophic consequences in humans and
animals, including malformations of various organs and tissues
and increased risk for certain diseases, such as infertility, obesity
and cancers [1]. For example, in humans, in utero exposure to
diethylstilbestrol (DES), a synthetic estrogen commonly prescribed
to pregnant women for the prevention or treatment of miscarriage in
the 40’s to 70’s, led to patterning defects in the female reproductive
tract (FRT) and clear cell carcinomas of the cervix and vagina in
affected individuals [2]. Similar defects were found in laboratory
animal models, including uterine metaplasia, loss of uterotubal
junction and vaginal adenosis. The postnatal mouse DES model was
established by Dr. John McLachlan’s group [3,4], and was widely
adopted as the experimental model system to better understand
the molecular mechanism underlying the observed DES effects.
This model involves subcutaneous injection of DES from postnatal
day 1 to day 5. The murine female reproductive tract develops
mainly from the Müllerian duct. Classical tissue recombination
experiments demonstrated that Müllerian epithelial cell fate is
determined between postnatal days 5-7 in the mouse by signals
from the underlying mesenchymal cells [5]. More specifically, it was
shown recently that BMP4/Activin-A signaling is activated in the
vaginal mesenchyme to promote epithelial stratification [6]. Thus
before postnatal day 5, the Müllerian epithelial cells are pluripotent
and are sensitive to EDC exposure. It was shown that DES exerts
its function mainly through estrogen receptor α, as most if not all
DES effects were absent in ERα knockouts [7]. We have focused our
J Stem Trans Bio
previous work on understanding the immediate gene expression
and cellular changes induced by DES exposure [8-10]. Our rationale
is that gene expression changes in early development will have
a long-lasting effect on organ function in adults. We showed that
neonatal DES exposure in mice caused immediate gene expression
changes, especially in the uterine epithelium, and the affected
genes included many transcription factors, signaling pathway
components, and growth factors [9]. Intriguingly, peroxisome
proliferator-activated receptor gamma (Pparγ) and a group of
genes critical to lipid metabolism, showed significant changes in
expression level in the uterine epithelium, which led to increased
lipid droplets accumulation in merely five days after DES exposure
in the same tissue layer. In addition, DES exposure changed glucose
metabolism, water/small molecule trafficking, proliferation as well
as apoptosis profiles of the uterine epithelial cells.
MSX-2 homeodomain transcription factor is required
during organogenesis by mediating epithelial-mesenchymal
interactions. Msx2 is highly expressed in a variety of tissues during
embryogenesis, and is critical for the terminal differentiation
of many tissue types and organs, including the limb, bone, hair
follicle, nail, and tooth [11-15]. In wild type neonates, Msx2 is
highly expressed in the uterine as well as vaginal epithelium, and
its expression is significantly reduced in both tissues upon DES
exposure [8,10]. Moreover, Msx2 mutant reproductive tract appears
to be a sensitized background for DES exposure and the FRTs in
these mice exhibited a much more severe patterning defects in
response to DES compared to wild type controls [10]. These data
led us to hypothesize that DES may elicit its cellular effects through
down-regulation of a master regulator Msx2, which in turn led to
gene expression changes of an array of down-stream targets via
transcription activation/repression. To further understand the role
of Msx2 in modulating FRT response to DES, here we performed
global gene expression profiling experiment in vehicle- or DEStreated Msx2-null mice and compared this result to our previously
published microarray data on wild-type animals. The differential
gene regulation by DES in wild-type and Msx2-/- mice revealed
many genes whose expression and/or regulation by DES depends
on Msx2 in the developing uterus.
Results
Msx2 Differentially Regulates Uterine Responsiveness to
Neonatal DES Exposure
In an attempt to identify potential MSX-2 targets that mediate
the DES effects, we performed cDNA microarray using uterine RNA
harvested from vehicle (oil)- or DES-treated Msx2-/- neonatal mice.
Among the 46628 annotated genes included on the Affymetrix
microarray chips, 14025 were expressed in uterine tissues, with
or without DES treatment. When comparing data set treated with
ISSN: 2469-5157
Page 1 of 7
J Stem Trans Bio
ISSN: 2469-5157
DES to that of the vehicle-treated control group, we identified 1459
annotated genes that were differentially regulated by DES exposure
in Msx2-/- uterus with a p-value less than 0.05 (data not shown).
These genes were referred to as Differentially Regulated Genes
(DRGs) hereinafter. Gene ontology analysis revealed that these
DRGs were involved in a plethora of cellular processes, including
development, response to stimulus, and anatomical structure
development (Figure 1A). Since Msx2 is normally highly expressed
in the uterine epithelium, its targets would presumably reside
in the same tissue layer. To test this hypothesis, we compared
the expression of these DRGs to our previous microarray data
conducted on wild type neonatal uteri. Since the two microarrays
were performed on different platforms, only 1254 out of 1459 DRGs
overlapped between the two studies. Nevertheless, more than 80%
(1025 out of 1254) of those DRGs were detected in the wild-type
uterine epithelium, indicating that Msx2 is indeed functioning as
a transcriptional regulator in the uterine epithelium. To focus on
potential transcriptional targets of Msx2, we carefully excluded
DRGs that also showed mesenchymal expression from our previous
tissue-specific microarray data (GEO# GSE37969, [9], and only
compared our current array data to that obtained using wild-type
uterine epithelial RNA.
A total of 212 genes showed similar expression change trends
and fold-changes in the uterine epithelium (Table 1, Group I),
indicating that their regulation by DES is not mediated through
MSX-2 transcriptional activation/suppression. We plotted fold
changes of these genes in both wild-type and Msx2-/- uteri on a
star glyph, and the two sets of curves fit almost perfectly (Figure
1B). On the other hand, expression of 198 genes were regulated
either in the opposite direction by DES or that their fold changes
were changed dramatically (equal or greater than four-fold) in the
two different genotypes (Table 1, Groups II-III). When plotted the
log-scaled fold-changes of these genes on a star glyph, noticeable
differences in the positions of peaks were observed (Figure 1C).
These genes, or at least a subset of them, could be MSX-2 targets.
Validation of microarray results
To validate our microarray findings, quantitative real-time
Figure 1: Differentially regulated genes by DES in Msx2-/- uterus. (A)
Pie chart showing gene ontological classification of the 1459 DRGs.
(B) Star glyph showing the fold changes in gene expression by DES of
common DRGs between control (blue) and Msx2-/- (red). Each peak
represents the Log2 value of fold change by DES of one gene, note that
the peaks of wild-type and Msx2-/- for each given gene almost always
overlap. The list of these common DRGs is in Table 1(Group I). (C) Star
glyph showing the fold changes of the unique DRGs listed in Table 1
(Groups II-III). Note the drastic changes in the positions of wild-type
peak and Msx2-/- peak for each gene.
Vol. 1. Issue. 1. 270000105
RT-PCR (qRT-PCR) was performed on RNA samples extracted
from isolated control (Msx2+/-) and Msx2-/- neonatal uterine
epithelia, exposed to either oil or DES. As a positive control, we
first tested some Group I DRGs that showed similar regulation by
DES in both genotypes. Wnt7a, a ligand for the canonical WNT/βcatenin pathway that is critical for many cellular processes, is
highly expressed in the developing uterine epithelium and is
responsible for uterine gland formation [16,17]. We and others
have previously shown that its expression was strongly suppressed
by DES administration [8,18,19]. In Msx2-/- uterus, a similar
effect was observed by qRT-PCR (Figure 2). Expression of Aqp3,
a gene encoding one of the aquaporin water trafficking proteins,
was induced dramatically by DES in the wild type array. A similar
regulation was observed in the Msx2-/- microarray and confirmed
by qRT-PCR (Figure 2). Similar results were obtained from another
group I gene, Rasa4 (Figure 2). Rpl7, a housekeeping gene whose
expression level was not affected by DES in either genotype, was
used in the qRT-PCR to determine relative transcript level of each
DRG, employing the comparative Ct method.
Next, we classified the 198 DRGs that showed differential
regulation by DES in Msx2-/- uterus into two major categories, as
shown in Table 1 (Group II-III). Group II contained genes whose
expression was either up-or down-regulated by more than twofold
by DES in the control uterus, but showed different regulatory
patterns in the absence of Msx2. Group II was further divided in
to three subgroups: Group IIa comprised of 114 DRGs whose DESregulation was either lost or attenuated in Msx2-/- by fourfold
or more; Group IIb included 33 DRGs whose DES-regulation
was enhanced in Msx2-/-; and Group IIc contained 24 DRGs that
showed opposite regulation by DES in the two genotypes. Group III
consisted of 27 DRGs that showed expression changes by more than
twofold when exposed to DES only in Msx2-/-, but not in wild-type.
We selected a few genes from each group to verify gene expression
changes by qRT-PCR. As shown in Figure 2, H2afy from Group IIa,
a gene encoding a histone H2A variant, was induced markedly by
DES in the Msx2+/- control animals, but to a lesser extent in Msx2/- uterus (Figure 2). Similarly, up-regulation of Prkg1 was only
detected in DES-treated control but not in mutant uterus. Another
examples of Group IIa genes was Krt17 (Krt1-17), a keratin family
member. Expression of Krt17 was decreased more than 6-fold
upon DES treatment. In the Msx2-/-, however, this decrease was
attenuated (Figure 2). These results indicate that MSX-2 plays an
obligatory role in the DES regulation of Group IIa genes under
normal circumstances, and in its absence, the DES-induced
gene expression changes are abolished. It is noteworthy that the
majority of Group IIa DRGs (92 out of 114) were down-regulated
by DES in the wild-type, but this down-regulation was diminished
in Msx2-/- mice. As clearly visualized in Fig. 1C, these genes were
repressed by DES in the wild-type (blue peaks pointing inwards),
while the repression was no longer detectable or much reduced
in Msx2-/- uteri (corresponding inconspicuous red peaks). These
results support the notion that MSX-2 acts as a transcriptional
suppressor and suggest that it is involved in the DES-suppression
of these genes.
An example of Group IIb genes was Avil, encoding the protein
advillin that may be involved in the morphogenesis of microvilli.
Microarray data showed an almost tenfold increase in expression
by DES in Msx2-/- when compared to controls. By qRT-PCR we
found the induction by DES in Msx2-/- was actually 107-times more
in the mutant (Figure 2). Such discrepancy was not unusual due to
the difference in nature of the two assay systems. Two other group
IIb genes, Prap1 and Sftpd, showed similar trend in expression
(Figure 2). These results suggest that in the normal uterus, Msx2
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 2 of 7
J Stem Trans Bio
Vol. 1. Issue. 1. 270000105
ISSN: 2469-5157
Group I
Group II
IIa
IIb
IIc
Group III
Abca3 2.03(2.66)
Ada 2.9(3.03)
Agpat2 3.93(3.42)
Aim1l 0.14(0.08)
Alox5ap 2.39(4.78)
Anpep 3.04(4.56)
Aqp3 7.19(5.83)
Aqp5 2.92(4.06)
Aurkb 0.31(0.35)
Bat1a 0.48(0.39)
Bcl6 10.73(7.48)
Bex2 0.5(0.31)
Blm 0.33(0.37)
Brrn1 0.36(0.42)
Bub1b 0.22(0.28)
Cables1 0.29(0.36)
Cbr3 2.08(6.44)
Cbx3 0.31(0.5)
Ccbl1 2.14(3.11)
Cd97 2.28(3.14)
Cdc2a 0.35(0.41)
Cdc45l 0.32(0.18)
Cdca2 0.29(0.4)
Cdca3 0.31(0.36)
Cdca7 0.38(0.36)
Cdca8 0.23(0.32)
Cdh16 0.26(0.03)
Cdkn3 0.43(0.41)
Cebpb 2.01(4.39)
Cenpa 0.33(0.42)
Chad 2.82(4.15)
Chaf1a 0.34(0.45)
Chd9 3.23(4.66)
Chpt1 2.38(2.07)
Chtf18 0.24(0.42)
Ckap2 0.27(0.31)
Clcn2 4.9(4.04)
Cldn23 2.88(6.52)
Cp 10.68(12.44)
Cpm 3.03(3.97)
Dact2 2.99(3.34)
Daf1 3.26(4.11)
Dcbld1 0.35(0.48)
Dgat2 3.6(2.44)
Dnmt1 0.39(0.46)
Dnmt3b 0.28(0.49)
E2f1 0.34(0.43)
Edn2 0.24(0.37)
Eps8 2.69(3.42)
Esrra 2.78(3.73)
Ets2 2.79(3.2)
Ezh2 0.44(0.4)
Fcho1 0.31(0.35)
Fgfrl1 2.27(2.89)
Adrb2 5.86(0.88)
Amotl1 0.21(0.85)
Ankrd6 0.15(0.66)
Apoa1 0.12(0.99)
B3gnt5 0.14(0.99)
Bcas1 10.86(1.61)
Capn2 0.12(0.99)
Capn6 0.06(0.62)
Cd1d1 0.18(1.19)
Chodl 0.01(0.15)
Cib2 0.17(0.71)
Ctse 17.26(2.03)
Cttn 0.15(0.95)
Cxcr4 0.04(0.21)
Cxxc6 0.07(0.38)
Dab1 0.08(0.69)
Dapk1 0.23(0.96)
Dbn1 0.05(0.92)
Dbp 2.66(0.61)
Ddah2 0.09(0.49)
Ebpl 0.05(0.6)
Ecm1 5(0.84)
Efs 0.14(0.89)
Ell3 0.06(0.95)
Emid1 0.07(0.37)
Ercc2 0.19(1.08)
Espn 0.22(1.11)
Ets1 0.21(1.65)
Etv4 0.09(0.39)
Fgd2 0.11(1.14)
Abp1 77.05(1214.56)
Ankrd22 2(11.75)
Arg1 12.18(1435.5)
Avil 3.34(25.09)
Bace2 7.81(37.18)
Birc1e 10.85(300.08)
Car12 3.55(29.77) Ceacam2
4.2(27.68)
Bcl2l12 0.45(2.01)
Cbln1 0.34(22.77)
Col4a4 0.48(2.5)
Dscam 0.31(7.26)
Fbp2 5.23(0.4)
Gbp2 2.01(0.43)
Gm644 0.08(2.01)
Bcat1 1.43(17.88)
Cblc 1.64(24.21)
Cbr2 1.33(31.32)
Clca3 1.65(120.28)
Coro2a 1.79(7.18)
Cyp4v3 0.53(2.13)
Dcxr 1.33(5.56)
Fkbp11 8.03(3.08)
Fmo1 0.35(0.16)
Folr1 4.47(2.64)
Fos 5.07(7.62)
Fxyd3 3.16(5.67)
G6pdx 2.84(5.47)
Gadd45a 6.46(10.94)
Gas6 5.41(2.08)
Gch1 5.92(2.53)
Gcnt2 2.23(2.05)
Gjb3 0.26(0.24)
Gjb6 0.02(0.38)
Gmds 3.7(6.58)
Golph2 2.02(2.4)
Gpr172b 2.37(2.25)
Gpr30 0.04(0.25)
Gpx3 7.5(6.59)
Gsto1 3.08(5.12)
Gyltl1b 0.41(0.36)
H1fx 0.21(0.49)
H2afx 0.45(0.5)
H2-DMa 5.53(2.1)
H2-Q2 2.34(2.53)
H2-Q5 2.14(2.8)
H47 2.1(6.43)
Hap1 0.11(0.22)
Hip1r 2.54(4.33)
Hist1h2ak 0.28(0.42)
Hist1h3b 0.17(0.34)
Hist1h3d 0.19(0.39)
Hist1h3e 0.19(0.39)
Hist1h3i 0.16(0.34)
Hist2h2be 0.22(0.39)
Hist2h3b 0.47(0.45)
Hk2 3.67(6.33)
Hmga1 0.31(0.42)
Hmgn2 0.43(0.31)
Homer2 0.13(0.24)
Hoxb2 0.26(0.41)
Ier5l 0.11(0.27)
Ig�bp6 2.83(2.41)
Il4i1 13.6(16.19)
Incenp 0.43(0.44)
Itgb6 2.27(4.34)
Itpk1 2.42(2.88)
Jundm2 4.01(3.93)
Kcnk6 2.8(2.05)
Kif22 0.21(0.33)
Kif2c 0.28(0.42)
Kifc5a 0.38(0.37)
Kit 2.95(2.68)
Krt1-14 0.13(0.13)
Ldh2 0.2(0.3)
Fgf22 0.07(0.75)
Fjx1 0.02(0.26)
Fkbp1b 0.23(1.14)
Fkbp5 0.14(0.66)
Fstl 0.16(0.98)
Fstl1 0.12(0.78)
Fzd7 0.14(0.66)
G6pc2 0.01(0.19)
Gjb6 0.02(0.38)
Gpr20 0.16(0.91)
Gpr27 0.24(1.01)
Gpr30 0.04(0.25)
Grik4 0.35(1.43)
Grik5 0.05(0.78)
H2afy 3.57(0.75)
H2afy3 0.03(0.41)
H2-Oa 0.1(0.44)
Hist1h3c 0.04(0.21)
Hoxb3 0.24(1)
Hr 2.87(0.69)
Icam2 6.97(1.1)
I�it2 0.19(1.01)
Klf2 6.53(1.11)
Klhl6 0.2(1.26)
Krt1-1 0.04(1.03)
Krt1-12 32.72(7.68)
Krt1-17 0.01(0.05)
Lemd1 0.04(0.86)
Lgi2 0.04(0.59)
Lrfn4 0.12(0.68)
Chst8 7.81(240.32)
Ckmt1 4.06(19.6)
Cldn10 2.21(16.19)
Ddc 0.15(0.03)
Dhrs9 3.29(30.14)
Fut2 4.05(30.31)
Hipk1 2.46(10.78)
Klf4 2.21(15.37) Lamc2
2.83(143)
Grtp1 0.33(2.8)
H2-Q5 3.48(0.36)
Hif1a 3.31(0.2)
Hist2h2aa2 0.4(3.7) Nasp
0.4(2.75)
Pdlim1 0.41(2.32)
Pdzrn3 2.9(0.31)
Dnajb9 1.89(0.4)
Fabp6 0.55(18.82)
Fbxw5 1.22(0.29)
Galnt1 1.65(0.11)
Gjb2 1.48(24.48)
Il15 0.58(2.98)
Kcnn4 1.75(8.16)
Lgals3bp 2.89(4.14)
Lmnb2 0.45(0.48)
Lnx2 2(2.22)
Ly6a 8.3(10.49)
Ly96 3.23(2.03)
Man2b2 3.04(3.56)
Mcm10 0.35(0.35)
Mcm2 0.35(0.48)
Mcm3 0.23(0.32)
Mcm5 0.28(0.35)
Me2 0.37(0.46)
Metrn 0.2(0.49)
Mid1ip1 3.25(2.71)
Mki67 0.28(0.43)
Mod1 3.04(3.04)
Mogat2 14.5(12.02)
Mrps6 3.76(2.5)
Mvp 2.4(3.01)
Mybl2 0.3(0.33)
Myd116 5.93(2.38)
Ndg2 2.63(2.19)
N�kbia 2.77(4.42)
Ngef 3.07(3.29)
Nipsnap1 0.18(0.37)
Nt5e 6.14(2.04)
Nudt11 0.24(0.27)
Nup210 0.11(0.17)
Nusap1 0.29(0.33)
Ocil 2.38(2.34)
Olfml3 4.09(3.05)
Osmr 5.09(7.67)
Pace4 6.89(2.53)
Pafah2 2.03(2.05)
Pbk 0.28(0.18)
Pcbp4 0.19(0.43)
Pcyt1b 3.72(3.27)
Pemt 2.3(2.41)
Pex7 2.25(6.07)
Phf6 0.48(0.49)
Phgdh 0.12(0.2)
Plekhb2 2.55(4.46)
Plekhh1 2.49(2.87)
Plekhm1 3.06(2.43)
Plk1 0.29(0.38)
Pola2 0.37(0.42)
Pold1 0.28(0.42)
Pold2 0.43(0.43)
Pparg 5.67(8.14)
Prc1 0.35(0.42)
Prim2 0.41(0.5)
Prodh 0.18(0.24)
Prom 3.72(8.13)
Prom2 0(0)
Prss19 0.05(0.42)
Ltbp4 0.25(1.03)
Mapk12 0.15(0.58)
Matk 0.16(1.06)
Mdk 0.15(0.63)
Meis1 0.31(1.29)
Mlp 0.13(0.57)
Mrg1 0.09(0.47)
Ntf3 0.04(0.42)
Odz3 0.17(0.84)
Pcp4l1 27.19(5.92)
Pdgfrl 0.13(0.65)
PLA2 0.04(0.45)
Plac8 9.88(1.22)
Plekhk1 0.04(0.21)
Pmp22 3.97(0.75)
Ppp1r3c14.63(1.06)
Prima1 0.13(1.96)
Prkg1 7.3(0.93)
Prr7 0.12(0.52)
Prss19 0.05(0.42)
Punc 0.07(0.36)
Qscn6 13.7(2.85)
Ramp2 0.24(1.17)
Rarb 0.15(0.65)
Rasl11b 0.2(0.9)
Rims3 0.12(0.61)
Rnf144 0.09(0.83)
Rohn 0.15(0.82)
Rsdr1-pending 0.12(0.49)
Ltf 6.2(41.67)
Muc20 3.08(18.86)
Oit1 2.64(46.54)
Omp 8.74(36.52)
ORF9 6.66(168.88)
Padi2 5.31(114.21)
Padi4 5.54(36.79)
Pcolce2 2.11(41.07)
Prap1 7.79(88.57)
Ppp1r3b 0.35(2.16)
Ppp2r5c 0.42(2.67)
Ptpru 0.46(2.14)
Rfc3 0.38(3.32)
Rwdd1 0.39(4)
Slitrk1 0.04(3.22)
Syngr1 0.49(2.7)
Lcn2 1.3(29.59)
Ly6g6e 1.63(82.58)
Muc1 1.7(7.97)
Mx2 0.6(7.04)
Padi1 1.4(21.89)
Pde6d 0.63(0.11)
Plekha6 0.51(5.07)
Psmc3ip 0.47(0.36)
Ptn 0.08(0.29)
Ptp4a1 4.82(2.39)
Ptpn18 2.12(2.19)
Rad54l 0.26(0.31)
Ralbp1 2.35(2.13)
Rasa4 6.14(3.23)
Rerg 3.24(2.1)
Rfc2 0.46(0.46)
Rfx2 0.49(0.5)
Rhpn2 3.01(2.39)
Ris2 0.31(0.4)
Robo1 0.3(0.33)
Rrm1 0.39(0.33)
S100a14 0.25(0.2)
Sap30 0.42(0.5)
Scx 0.02(0.06)
Sephs2 3.4(2.11)
Sfrs7 0.2(0.31)
Sgol2 0.36(0.47)
Sh3bgrl2 3.1(3.65)
Slc2a1 4.54(2.52)
Slc35c1 2.23(2.66)
Slc39a4 4.4(6.43)
Slc7a4 2.17(2.76)
Smpd3 15.46(16.11)
Smpdl3a 3.16(3.88)
Smpdl3b 0.31(0.34)
Sox7 4.01(3.42)
Sox9 4.33(8.68)
Sphk1 3.1(3.07)
Spint1 2.53(6.81)
Sprr2g 3.21(2.99)
Ssbp2 0.26(0.37)
Stk6 0.48(0.37)
Sult1c2 4.6(8.5)
Tcfcp2l1 2.59(3.18)
Tcn2 2.44(2.34)
Tgm2 6.91(3.48)
Tmc7 9.96(9.35)
Tmem24 5.51(3.8)
Tmprss2 3.59(7)
Tnfrsf21 3.61(2.21)
Tnnc1 13.56(8.62)
Trp53inp2 5.83(2.87)
Trpv4 2.6(2.36)
Uhrf1 0.3(0.33)
Wfs1 3.35(4.1)
Wnt7a 0.15(0.07)
Zdhhc14 3.45(2.8)
Zranb3 0.3(0.49)
Sall2 0.11(0.57)
Scara3 0.12(1.1)
Sdk1 0.11(1.21)
Sema6d 6.82(1.55)
Sfxn2 0.15(0.74)
Shd 0.08(0.79)
Slc12a2 7.44(1.59)
Slc29a4 0.03(0.29)
Snn 0.11(0.52)
Snx8 4.89(0.84)
Srd5a2 0.05(0.54)
Ssb4 0.03(0.4)
Stc1 0.07(0.8)
Stxbp4 0.19(1.04)
Tcf3 0.12(0.95)
Tekt1 0.04(0.33)
Tesc 4.74(1.02)
Tns 8.44(1.59)
Trp63 0.01(1.45)
Tuba1 0.19(0.83)
Vldlr 6.91(1.64)
Wbscr17 0.01(0.42)
Wbscr24 0.15(0.65)
Wnt5a 7.87(1.7)
Zfp184 0.09(0.42)
Scml4 11.58(59.18)
Sdcbp2 2.54(23.71)
Sema4a 2.66(10.97)
Sftpd 12.86(81.01)
Slc5a9 3.3(82.87)
Trpv6 2.61(12.68)
Uox 22.98(1022.66)
Ttc3 0.35(4.53)
Upk1a 0.28(4.86)
Upk2 0.41(28.66)
Reprimo 0.52(3.35)
Rutbc2 1.87(7.68)
Slc39a8 0.75(4.67)
Tmprss4 1.45(75.02)
Ugt1a10 1.7(7.28)
Ywhah 1.37(0.17)
Comparison of DRGs by DES between wild-type and Msx2-/- uterus.
Table 1: List of DRGs found in Msx2-/- uterus that showed similar (group I) or differential (groups II and III) DES regulation compared to wild-type. Each
DRG is presented as "gene name, fold-change in wild-type (fold-change in Msx2-/-).
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 3 of 7
J Stem Trans Bio
ISSN: 2469-5157
Vol. 1. Issue. 1. 270000105
Figure 2: Quantitative real-time RT-PCR validations of the microarray data in isolated neonatal uterine epithelium. Relative transcript level on
logarithmic scale determined by qRT-PCR of two or three genes representing each group were shown. Two numbers under each gene name denote foldchanges by DES in control and Msx2-/-, with and without parentheses, respectively. Three biological replicates were included in each treatment group.
antagonizes transcriptional activation of Group IIb genes by DES,
and in its absence, this effect is augmented. Group IIc genes showed
a more complicated regulation, where DES exhibited opposite
regulation on gene expression in the control and Msx2-/- uterus.
For example, Fbp2, a gene encoding a gluconeogenesis regulatory
enzyme, was up-regulated in the control uterus upon DES exposure,
but was down-regulated by DES in Msx2-/- uterus (Figure 2). Similar
results were obtained for Pdzrn3, a gene encoding a PDZ domain
containing E3 ubiquitin ligase. It is likely that Msx2 is involved in the
DES regulation of these genes, but the exact mechanisms remains
unclear at present. Group III genes showed no apparent expression
changes in the control uterus by DES, but were either up- or downregulated by more than twofold in the Msx2 -/- when exposed
to DES. Expression of two such genes, Slc39a8 and Kcnn4, were
validated by qRT-PCR (Figure 2). These genes are similar to Group
IIb genes in the sense that MSX-2 antagonizes DES-regulation, and
DES effect on gene expression changes was only observed in Msx2/- uterus.
Msx2 Is Dispensable for the DES-induced Changes in Adipogenesis and Lipid Metabolism in the Uterine Epithelium
As mentioned in the introduction, we have previously reported
that neonatal DES exposure altered lipid metabolism in the uterine
epithelium through upregulation of a master transcription factor
of adipogenesis, PPARγ [9]. To investigate whether Msx2 plays a
role in this process, we analyzed expression of Pparγ in the control
and Msx2-/- uterus. As shown in Figure 3A, Pparγ is upregulated by
DES, regardless of Msx2 status, indicating that this process is not
mediated through Msx2. Many Pparγ downstream targets including
Acsl1 and Arntl, and genes involved in lipid metabolism and
trafficking (e.g. Agpat2, Slc2a1), also showed similar regulation by
DES in Msx2-/- uterus (Figure 3A and Table 1). We next examined
frozen uterine sections stained with Oil red O, a lysochrome diazo
dye that binds neutral lipids, for signs of lipid metabolism changes.
As we have previously reported, administration of DES caused
increased lipid deposition exclusively in the uterine epithelium
(Figure 3B, C). Similar results were obtained in Msx2-/- uteri
(Figure 3D, E). These results collectively demonstrated that the
DES-induced lipid metabolism changes in the uterine epithelium
through Pparγ upregulation is Msx2-independent.
Discussion
Since the discovery of the adverse effects of DES on human
health, numerous studies in model animals have been conducted
trying to uncover the underlying molecular mechanisms. The
neonatal DES mouse model is widely used, because DES-treated
animals exhibited a variety of developmental abnormalities
and pathologies recapitulating the human syndrome including
uterine metaplasia and vaginal adenosis. We have previously
conducted global gene profiling studies, and found that neonatal
DES treatment in mice caused a series cellular changes including
proliferation, apoptosis, metabolic as well as other physiological
changes through modulation of uterine gene expression [8,9].
We have also discovered that the transcription factor MSX-2, can
modulate the responsiveness of uterus and vagina to DES [10]. To
better understand how Msx2 modulates DES response in the uterus,
here we performed microarray analyses using RNA extracted from
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 4 of 7
J Stem Trans Bio
ISSN: 2469-5157
Vol. 1. Issue. 1. 270000105
a repressor that normally counteracts this induction. On the other
hand, repression of certain gene expression by DES may require
MSX-2 participation, as its absence leads to failure of repression by
DES.
We previously showed that the regulation of Aqp3 by DES was
abolished in Msx2 mutant vaginal epithelium [10]. Surprisingly,
here we found that Aqp3 was similarly induced in both wild-type
and Msx2 mutant uterus. These seemingly contradictory results can
be reconciled by the fact that the intermediate cell layers expressing
Aqp3 in the developing vagina are missing in Msx2 mutants, and
thus failure of induction by DES in Msx2 mutant vagina is secondary
to a defective patterning event. In this sense, Aqp3 is likely not a
target of Msx2 either in the uterus or in the vagina.
Figure 3: DES alters uterine lipid metabolism in an Msx2-independent
manner. (A) RT-PCR showing that activation of the adipogenic marker,
Pparγ, as well as its downstream targets, is independent of Msx2. No
RT controls were amplification of housekeeping Rpl7 genes using
RNA as templates. (B-E) Oil red O staining showing DES treatment
resulted in lipid droplets deposition in the basal-lateral side of uterine
epithelium (arrows) in both control (C) and Msx2-/- (E). The basement
membranes of oil-treated control (B) and Msx2-/- (D) were outlined
with dotted lines. UE, uterine epithelium; UM, uterine mesenchyme.
Scale bars: 50µm in B-E.
oil- or DES-treated Msx2-/- uteri, and compare this result to that
of our previous array data performed on wild-type animals. By
comparing the two data sets, we uncovered three groups of genes in
general: group I contains genes that are similarly regulated by DES
both in wild type and in Msx2-/- uteri. Thus Msx2 is dispensable
for the regulation of this group of 212 genes by DES. Group II
consists of 171 genes whose regulation by DES is altered (in either
direction) in Msx2 mutant uteri. Thus Msx2 plays important roles in
modulating their regulation by DES. Group III consists of 27 genes
that are not regulated by DES in wild type uterus, but are now DES
targets in Msx2 mutant uteri. These genes are likely not MSX-2
transcription targets but rather exhibit altered DES responsiveness
due to secondary changes, such as cell fate change. We further
subdivided group II genes into three categories: genes whose
regulations by DES are either lost or attenuated in Msx2 mutant
uterus; those whose regulations are enhanced by Msx2 mutation;
and those oppositely regulated by DES in the two genotypes. RTPCR was used to validate representative genes from each subgroup.
Interestingly, we observed that most DES-induced genes showed a
greater response in Msx2-/- uterus, evidenced by the red peaks in
the star glyph (Figure 1C). On the other hand, DES-repressed genes
lost this repressive regulation in Msx2 mutant uterus, evidenced
by the blue peaks (Figure 1C). These results are in agreement
with previous studies suggesting that Msx2 mainly functions as
a transcriptional repressor [20]. In this scenario, DES can induce
target gene expression to a greater degree due to the removal of
We showed recently that lipid metabolism in the neonatal
uterus was dramatically affected by DES exposure [9]. This change
is mediated through the upregulation of a transcription factor
PPARγ, which in turn led to gene expression changes in an array of
genes involved in lipid trafficking and metabolism. By analyzing the
expression of those genes in DES-treated Msx2-/- uterus, we found
that Msx2 is not involved in the DES-regulation of this process.
Pparγ was similarly induced in Msx2-/- as in controls, so were many
Pparγ downstream genes. Consistently, lipid droplet accumulation
in the uterine epithelium was also observed in the Msx2-/- uterus
upon DES exposure. Interestingly, it was previously reported that
in myofibroblasts, Msx2 stimulates osteogenesis but suppress
adipogenesis by activating Osx transcription and concomitantly
suppressing Pparγ expression [21]. Our results that Pparγ showed
no change in basal level in the absence of Msx2 indicate that Msx2
is unlikely to be a transcriptional suppressor of Pparγ, at least
in the uterus. In addition, DES increases Pparγ, and alters lipid
metabolism in the uterus in an Msx2-independent way.
Future investigations on the function of these MSX-2 target
candidates are needed to further evaluate their function(s) during
normal uterine development as well as during DES-induced
pathogenesis of the female reproductive tracts. Nevertheless,
identification of these genes may shed light on how Msx2 regulate
terminal differentiation of the uterus, and possibly other Msx2expressing tissues.
Materials and Methods
Mice
All mice were housed in the animal facility at Washington
University with controlled light/dark cycles and handled in
accordance with National Institutes of Health guidelines. All
procedures were approved by the Washington University
Institutional Animal and Use Committee. Msx2 mutants were
generated and described previously [11], and breeding between
female Msx2+/- and male Msx2-/- were used to obtain control and
homozygous pups. DES was prepared and injected from P1 to P5 as
described previously [8]. Uteri from female pups were harvested
for fixation or RNA extraction 24 hours after the last injection.
cDNA Microarray and Data Analysis
Oil- or DES-treated P5 Msx2-/- mice were harvested for
RNA preparation. Uterine tissues from 3-4 animals of the same
treatment group were pooled together and RNA isolated to make
one sample. Total RNA was cleaned using RNeasy Kit (Qiagen,
Valencia, CA) and submitted to the Genome Technology Access
Center (GTAC) at Washington University School of Medicine for
microarray analysis on Affymetrix Genechip. A total of three
biological replicates were used for microarray analysis. Normalized
data were provided by the GTAC and detailed analysis protocol was
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 5 of 7
J Stem Trans Bio
ISSN: 2469-5157
available upon request. Subsequent analyses were performed and
star glyphs generated in Microsoft Excel 2007. DRGs that showed
high expression in the wild-type uterine mesenchymal tissue
from our previous microarray data [9], either with or without DES
treatment, were excluded from the current analysis to better focus
on Msx2-dependent gene regulation.
Uterine Epithelium Isolation, RNA Extraction and Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
Uterine epithelium isolation was performed as described
previously [9]. Briefly, dissected neonatal uterine horns were cut
into 3-4 mm long segments and incubated on a rotating platform
in calcium-free, magnesium-free Hank’s balanced salt solution
containing 1% trypsin for 1 hour at 4°C. Enzymatic digestion was
stopped by adding an equal volume of 5 mg/ml bovine serum
albumin after the incubation, and epithelial tissues were extruded
from the uterine horns by applying gentle pressure along each
segment. Epithelial tissues from individual animals of the same
genotype/treatment were transferred to fresh tubes and pooled
together. Low speed centrifugation was applied to collect tissue
pellets [22]. Total RNA was isolated from the cell/tissue pellets
with RNA Stat-60 (Tel-Test, Inc., Friendswood, TX) following
manufacture’s instruction. Primer design, reverse transcription
and qRT-PCR were performed as previously described [23,24].
Primer sequences used were as follows:
Aqp3: 5’CCTTGGCATCTTGGTGGCT3’, 5’AGGAAGCACATTGCGAAGGT3’;
Rasa4: 5’CAGGATCCTTGTCCCAGTC3’, 5’GAGCAGTTGGTTCTCCCAAG3’;
Wnt7a: 5’GAACTTACACAATAACGAGGCG3’, 5’GTGGTCCAGCACGTCTTAGT3’;
H2afy: 5’CGGTGGTGAAGTAGGAAACAC3’, 5’GCTGCCAATGGATGGGAAG3’;
Krt17: 5’ACCATCCGCCAGTTTACCTC3’, 5’CTACCCAGGCCACTAGCTGA3’;
Prkg1: 5’CCCCTCAACAAAACAGGATG3’, 5’GAAGGAGGAGGGCTAGCAAC3’;
Avil: 5’GAGTGCTCACGGCAACTTCTA3’, 5’GGGAGGAGTCCTTCCCGAT3’;
Prap1: 5’CCCTAACCACTCTTCCACTCC3’, 5’TTCTCCCACCAATTTTCAGG3’;
Sftpd: 5’GGACAATATTTGGCCAGGAG3’; 5’AGCTATACACCTTTTATTAGGATGTTG3’;
Fbp2: 5’CGCTTCCCTTTGTCTTTGTC3’, 5’TTCTGACCGTGACCTGTGTC3’;
Pdzrn3: 5’CTGCGCTACCAGAAGAAGTTC3’, 5’TCCATCTTGATTGTCCACACAG3’;
Slc39a8: 5’GCCAAGCTCATGTACCTGTCT3’, 5’AAGATGCCCCAATCGCCAA3’;
Kcnn4: 5’CAAGCCCCACGATAAATCAC3’, 5’GTGGGAGGTCCAATTCAGTG3’;
Arntl: 5’TGACCCTCATGGAAGGTTAGAA3’, 5’GGACATTGCATTGCATGTTGG3’;
Ascl1: 5’GCAACCGGGTCAAGTTGGT3’, 5’GTCGTTGGAGTAGTTGGGGG3’;
Pparg: 5’GGAAGACCACTCGCATTCCTT3’, 5’GTAATCAGCAACCATTGGGTCA3’;
Rp17: 5’AGCCCAAAGGTTCGTAAGGT3’, 5’AGCCTCGCTTGTAGATGAGC3’.
Oil-red O Staining
For Oil red O staining, uterine tissues were embedded in O.C.T.
and snap frozen in liquid nitrogen. Slides of 10 µm cryosections
were allowed to dry briefly at room temperature, washed in water
once, twice in 100% propylene glycol (Sigma), then incubated
in 0.7% Oil red O (Sigma) in propylene glycol for 7 minutes with
agitation at 60°C. Slides were then washed in 85% propylene glycol
briefly, rinsed in water, and mounted with glycerin jelly.
Acknowledgements
This grant is supported by the National Institutes of Health
(ES014482 to LM). We thank the Genome Technology Access
Center in the Department of Genetics at Washington University
Vol. 1. Issue. 1. 270000105
School of Medicine for help with genomic analysis. The Center is
partially supported by NCI Cancer Center Support Grant #P30
CA91842 to the Siteman Cancer Center and by ICTS/CTSA Grant#
UL1RR024992 from the National Center for Research Resources
(NCRR), a component of the National Institutes of Health (NIH), and
NIH Roadmap for Medical Research. This publication is solely the
responsibility of the authors and does not necessarily represent the
official view of NCRR or NIH.
References
1. Soto AM, Sonnenschein C. Environmental causes of cancer: endocrine
disruptors as carcinogens. Nature reviews. Endocrinology. 2010; 6: 363370. doi:10.1038/nrendo.2010.87
2. Mittendorf R. Teratogen update: carcinogenesis and teratogenesis
associated with exposure to diethylstilbestrol (DES) in utero. Teratology.
1995; 51(6): 435-445
3. McLachlan JA. Prenatal exposure to diethylstilbestrol in mice:
toxicological studies. Journal of toxicology and environmental health.
1977; 2(3): 527-537. DOI:10.1080/15287397709529453
4. McLachlan JA, Newbold RR, Shah HC, Hogan MD., Dixon, R. L. Reduced
fertility in female mice exposed transplacentally to diethylstilbestrol
(DES). Fertil Steril. 1982; 38(3):364-371
5. Kurita T., Cooke PS, Cunha GR. Epithelial-stromal tissue interaction in
paramesonephric (Mullerian) epithelial differentiation. Dev Biol. 2001;
240(1):194-211
6. Laronda MM, Unno K, Ishi K, Serna VA, Butler LM, Mills AA, et al.
Diethylstilbestrol induces vaginal adenosis by disrupting SMAD/RUNX1mediated cell fate decision in the Mullerian duct epithelium. Dev Biol.
2013; 381(1): 5-16. doi: 10.1016/j.ydbio.2013.06.024
7. Lindzey J, Wetsel WC, Couse JF, Stoker T, Cooper R, and Korach KS.
Effects of castration and chronic steroid treatments on hypothalamic
gonadotropin-releasing hormone content and pituitary gonadotropins
in male wild-type and estrogen receptor-alpha knockout mice.
Endocrinology. 1998; 139(10): 4092-4101
8. Huang WW, Yin Y, Bi Q, Chiang TC, Garner N, Vuoristo J, et al.
Developmental diethylstilbestrol exposure alters genetic pathways of
uterine cytodifferentiation. Mol Endocrinol. 2005; 19(3): 669-682
9. Yin Y, Lin C, Veith GM, Chen H, Dhandha M, Ma L. Neonatal diethylstilbestrol
exposure alters the metabolic profile of uterine epithelial cells. Dis Model
Mech. 2012; 5(6):870-880. doi: 10.1242/dmm.009076.
10. Yin Y, Lin C, Ma L. MSX-2 promotes vaginal epithelial differentiation
and wolffian duct regression and dampens the vaginal response to
diethylstilbestrol. Mol Endocrinol. 2006; 20(7): 1535-1546
11. Satokata I, Ma L, Ohshima H, Bei M, Woo I, Nishizawa K, et al. Msx2
deficiency in mice causes pleiotropic defects in bone growth and
ectodermal organ formation. Nat Genet. 2000; 24(4): 391-395
12. Ma L, Liu J, Wu T, Plikus M, Jiang TX, Bi Q, et al. Cyclic alopecia’ in
Msx2 mutants: defects in hair cycling and hair shaft differentiation.
Development. 2003; 130(2): 379-389
13. Bei M, Stowell S, Maas R. Msx2 controls ameloblast terminal
differentiation. Developmental dynamics. 2004; 231(4):758-765. DOI:
10.1002/dvdy.20182
14. Cai J, Ma L. Msx2 and Foxn1 regulate nail homeostasis. Genesis. 2011;
49(6): 449-459. doi: 10.1002/dvg.20744
15. Chen Y, Zhang Y, Jiang TX, Barlow AJ, St Amand TR, Hu Y, et al. Conservation
of early odontogenic signaling pathways in Aves. Proceedings of the
National Academy of Sciences of the United States of America. 2000;
97(18): 10044-10049. doi: 10.1073/pnas.160245097
16. Moon RT, Bowerman B, Boutros M, Perrimon N. The promise and perils
of Wnt signaling through beta-catenin. Science. 2002; 296(5573): 16441646
17. Miller C, Sassoon DA. Wnt-7a maintains appropriate uterine patterning
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 6 of 7
J Stem Trans Bio
ISSN: 2469-5157
during the development of the mouse female reproductive tract.
Development. 1998; 125(16): 3201-3211.
18. Miller C, Degenhardt K, Sassoon DA. Fetal exposure to DES results in
de-regulation of Wnt7a during uterine morphogenesis. Nature genetics.
1998; 20(3): 228-230
19. Couse JF, Dixon D, Yates M, Moore AB, Ma L, et al. Estrogen receptoralpha knockout mice exhibit resistance to the developmental effects of
neonatal diethylstilbestrol exposure on the female reproductive tract.
Dev Biol. 2001; 238(2): 224-238
20. Newberry EP, Boudreaux JM, Towler DA. Stimulus-selective inhibition
of rat osteocalcin promoter induction and protein-DNA interactions by
the homeodomain repressor Msx2. J Biol Chem. 1997 ; 272(47): 2960729613
Vol. 1. Issue. 1. 270000105
21. Cheng SL, Shao JS, Charlton-Kachigian N, Loewy AP, Towler DA. MSX-2
promotes osteogenesis and suppresses adipogenic differentiation of
multipotent mesenchymal progenitors. J Biol Chem. 2003; 278(46):
45969-45977
22. Bigsby RM, Cooke PS, Cunha GR. A simple efficient method for separating
murine uterine epithelial and mesenchymal cells. Am J Physiol. 1986;
251, E630-636
23. Yin Y, Huang WW, Lin C, Chen H, MacKenzie A, Ma L. Estrogen suppresses
uterine epithelial apoptosis by inducing birc1 expression. Mol
Endocrinol. 2008; 22(1): 113-125
24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods. 2001; 25(4): 402-408
*Corresponding Author: Liang Ma, Department of Medicine, Box 8123, Washington University 660 S. uclid Ave. St. Louis, MO 63110, USA, Fax: 314454-5626; Email: lima@dom.wustl.edu
Received Date: Received Date: October 30, 2014, Accepted Date: May 04, 2015, Published Date: May 12, 2015.
Copyright: © 2015 Liang Ma, et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original work is properly cited.
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates Uterine Progenitor Cell Response
to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 7 of 7
http://elynsgroup.com
Copyright: © 2015 Liang Ma, et al.
http://dx.doi.org/10.19104/jstb.2015.105
Explore and Expand
Journal of Stem Cell and Transplantation Biology
Research Article
Open Access
Homeodomain Transcription Factor Msx-2 Regulates Uterine
Progenitor Cell Response to Diethylstilbestrol
Yan Yin1, Congxing Lin1, Ivy Zhang1, Alexander V Fisher2, Maulik Dhandha3 and Liang Ma1*
2
1
Division of Dermatology, Washington University School of Medicine, St. Louis, MO, USA
Department of Surgery, University of Wisconsin School of Medicine and Public Health, Madison, WI, USA
3
Department of Dermatology, Saint Louis University School of Medicine, St. Louis, MO, USA
Received Date: October 30, 2014, Accepted Date: May 04, 2015, Published Date: May 12, 2015.
*Corresponding author: Liang Ma, Department of Medicine, Box 8123, Washington University 660 S. uclid Ave. St. Louis, MO 63110, USA, Fax: 314-4545626; Email: lima@dom.wustl.edu
Abstract
The fate of mouse uterine epithelial progenitor cells is determined
between postnatal days 5 to 7. Around this critical time window,
exposure to an endocrine disruptor, diethylstilbestrol (DES), can
profoundly alter uterine cytodifferentiation. We have shown previously
that a homeo domain transcription factor MSX-2 plays an important role
in DES-responsiveness in the female reproductive tract (FRT). Mutant
FRTs exhibited a much more severe phenotype when treated with DES,
accompanied by gene expression changes that are dependent on Msx2.
To better understand the role that MSX-2 plays in uterine response to
DES, we performed global gene expression profiling experiment in mice
lacking Msx2. By comparing this result to our previously published
microarray data performed on wild-type mice, we extracted common
and differentially regulated genes in the two genotypes. In so doing,
we identified potential downstream targets of MSX-2, as well as genes
whose regulation by DES is modulated through MSX-2. Discovery of
these genes will lead to a better understanding of how DES, and possibly
other endocrine disruptors, affects reproductive organ development.
Keywords: Msx2;
Enviromental hormone
diethylstilbestrol
(DES);
Endometrium;
Introduction
Developmental exposure to endocrine disrupting chemicals
(EDCs) can have catastrophic consequences in humans and
animals, including malformations of various organs and tissues
and increased risk for certain diseases, such as infertility, obesity
and cancers [1]. For example, in humans, in utero exposure to
diethylstilbestrol (DES), a synthetic estrogen commonly prescribed
to pregnant women for the prevention or treatment of miscarriage in
the 40’s to 70’s, led to patterning defects in the female reproductive
tract (FRT) and clear cell carcinomas of the cervix and vagina in
affected individuals [2]. Similar defects were found in laboratory
animal models, including uterine metaplasia, loss of uterotubal
junction and vaginal adenosis. The postnatal mouse DES model was
established by Dr. John McLachlan’s group [3,4], and was widely
adopted as the experimental model system to better understand
the molecular mechanism underlying the observed DES effects.
This model involves subcutaneous injection of DES from postnatal
day 1 to day 5. The murine female reproductive tract develops
mainly from the Müllerian duct. Classical tissue recombination
experiments demonstrated that Müllerian epithelial cell fate is
determined between postnatal days 5-7 in the mouse by signals
from the underlying mesenchymal cells [5]. More specifically, it was
shown recently that BMP4/Activin-A signaling is activated in the
vaginal mesenchyme to promote epithelial stratification [6]. Thus
before postnatal day 5, the Müllerian epithelial cells are pluripotent
and are sensitive to EDC exposure. It was shown that DES exerts
its function mainly through estrogen receptor α, as most if not all
DES effects were absent in ERα knockouts [7]. We have focused our
J Stem Trans Bio
previous work on understanding the immediate gene expression
and cellular changes induced by DES exposure [8-10]. Our rationale
is that gene expression changes in early development will have
a long-lasting effect on organ function in adults. We showed that
neonatal DES exposure in mice caused immediate gene expression
changes, especially in the uterine epithelium, and the affected
genes included many transcription factors, signaling pathway
components, and growth factors [9]. Intriguingly, peroxisome
proliferator-activated receptor gamma (Pparγ) and a group of
genes critical to lipid metabolism, showed significant changes in
expression level in the uterine epithelium, which led to increased
lipid droplets accumulation in merely five days after DES exposure
in the same tissue layer. In addition, DES exposure changed glucose
metabolism, water/small molecule trafficking, proliferation as well
as apoptosis profiles of the uterine epithelial cells.
MSX-2 homeodomain transcription factor is required
during organogenesis by mediating epithelial-mesenchymal
interactions. Msx2 is highly expressed in a variety of tissues during
embryogenesis, and is critical for the terminal differentiation
of many tissue types and organs, including the limb, bone, hair
follicle, nail, and tooth [11-15]. In wild type neonates, Msx2 is
highly expressed in the uterine as well as vaginal epithelium, and
its expression is significantly reduced in both tissues upon DES
exposure [8,10]. Moreover, Msx2 mutant reproductive tract appears
to be a sensitized background for DES exposure and the FRTs in
these mice exhibited a much more severe patterning defects in
response to DES compared to wild type controls [10]. These data
led us to hypothesize that DES may elicit its cellular effects through
down-regulation of a master regulator Msx2, which in turn led to
gene expression changes of an array of down-stream targets via
transcription activation/repression. To further understand the role
of Msx2 in modulating FRT response to DES, here we performed
global gene expression profiling experiment in vehicle- or DEStreated Msx2-null mice and compared this result to our previously
published microarray data on wild-type animals. The differential
gene regulation by DES in wild-type and Msx2-/- mice revealed
many genes whose expression and/or regulation by DES depends
on Msx2 in the developing uterus.
Results
Msx2 Differentially Regulates Uterine Responsiveness to
Neonatal DES Exposure
In an attempt to identify potential MSX-2 targets that mediate
the DES effects, we performed cDNA microarray using uterine RNA
harvested from vehicle (oil)- or DES-treated Msx2-/- neonatal mice.
Among the 46628 annotated genes included on the Affymetrix
microarray chips, 14025 were expressed in uterine tissues, with
or without DES treatment. When comparing data set treated with
ISSN: 2469-5157
Page 1 of 7
J Stem Trans Bio
ISSN: 2469-5157
DES to that of the vehicle-treated control group, we identified 1459
annotated genes that were differentially regulated by DES exposure
in Msx2-/- uterus with a p-value less than 0.05 (data not shown).
These genes were referred to as Differentially Regulated Genes
(DRGs) hereinafter. Gene ontology analysis revealed that these
DRGs were involved in a plethora of cellular processes, including
development, response to stimulus, and anatomical structure
development (Figure 1A). Since Msx2 is normally highly expressed
in the uterine epithelium, its targets would presumably reside
in the same tissue layer. To test this hypothesis, we compared
the expression of these DRGs to our previous microarray data
conducted on wild type neonatal uteri. Since the two microarrays
were performed on different platforms, only 1254 out of 1459 DRGs
overlapped between the two studies. Nevertheless, more than 80%
(1025 out of 1254) of those DRGs were detected in the wild-type
uterine epithelium, indicating that Msx2 is indeed functioning as
a transcriptional regulator in the uterine epithelium. To focus on
potential transcriptional targets of Msx2, we carefully excluded
DRGs that also showed mesenchymal expression from our previous
tissue-specific microarray data (GEO# GSE37969, [9], and only
compared our current array data to that obtained using wild-type
uterine epithelial RNA.
A total of 212 genes showed similar expression change trends
and fold-changes in the uterine epithelium (Table 1, Group I),
indicating that their regulation by DES is not mediated through
MSX-2 transcriptional activation/suppression. We plotted fold
changes of these genes in both wild-type and Msx2-/- uteri on a
star glyph, and the two sets of curves fit almost perfectly (Figure
1B). On the other hand, expression of 198 genes were regulated
either in the opposite direction by DES or that their fold changes
were changed dramatically (equal or greater than four-fold) in the
two different genotypes (Table 1, Groups II-III). When plotted the
log-scaled fold-changes of these genes on a star glyph, noticeable
differences in the positions of peaks were observed (Figure 1C).
These genes, or at least a subset of them, could be MSX-2 targets.
Validation of microarray results
To validate our microarray findings, quantitative real-time
Figure 1: Differentially regulated genes by DES in Msx2-/- uterus. (A)
Pie chart showing gene ontological classification of the 1459 DRGs.
(B) Star glyph showing the fold changes in gene expression by DES of
common DRGs between control (blue) and Msx2-/- (red). Each peak
represents the Log2 value of fold change by DES of one gene, note that
the peaks of wild-type and Msx2-/- for each given gene almost always
overlap. The list of these common DRGs is in Table 1(Group I). (C) Star
glyph showing the fold changes of the unique DRGs listed in Table 1
(Groups II-III). Note the drastic changes in the positions of wild-type
peak and Msx2-/- peak for each gene.
Vol. 1. Issue. 1. 270000105
RT-PCR (qRT-PCR) was performed on RNA samples extracted
from isolated control (Msx2+/-) and Msx2-/- neonatal uterine
epithelia, exposed to either oil or DES. As a positive control, we
first tested some Group I DRGs that showed similar regulation by
DES in both genotypes. Wnt7a, a ligand for the canonical WNT/βcatenin pathway that is critical for many cellular processes, is
highly expressed in the developing uterine epithelium and is
responsible for uterine gland formation [16,17]. We and others
have previously shown that its expression was strongly suppressed
by DES administration [8,18,19]. In Msx2-/- uterus, a similar
effect was observed by qRT-PCR (Figure 2). Expression of Aqp3,
a gene encoding one of the aquaporin water trafficking proteins,
was induced dramatically by DES in the wild type array. A similar
regulation was observed in the Msx2-/- microarray and confirmed
by qRT-PCR (Figure 2). Similar results were obtained from another
group I gene, Rasa4 (Figure 2). Rpl7, a housekeeping gene whose
expression level was not affected by DES in either genotype, was
used in the qRT-PCR to determine relative transcript level of each
DRG, employing the comparative Ct method.
Next, we classified the 198 DRGs that showed differential
regulation by DES in Msx2-/- uterus into two major categories, as
shown in Table 1 (Group II-III). Group II contained genes whose
expression was either up-or down-regulated by more than twofold
by DES in the control uterus, but showed different regulatory
patterns in the absence of Msx2. Group II was further divided in
to three subgroups: Group IIa comprised of 114 DRGs whose DESregulation was either lost or attenuated in Msx2-/- by fourfold
or more; Group IIb included 33 DRGs whose DES-regulation
was enhanced in Msx2-/-; and Group IIc contained 24 DRGs that
showed opposite regulation by DES in the two genotypes. Group III
consisted of 27 DRGs that showed expression changes by more than
twofold when exposed to DES only in Msx2-/-, but not in wild-type.
We selected a few genes from each group to verify gene expression
changes by qRT-PCR. As shown in Figure 2, H2afy from Group IIa,
a gene encoding a histone H2A variant, was induced markedly by
DES in the Msx2+/- control animals, but to a lesser extent in Msx2/- uterus (Figure 2). Similarly, up-regulation of Prkg1 was only
detected in DES-treated control but not in mutant uterus. Another
examples of Group IIa genes was Krt17 (Krt1-17), a keratin family
member. Expression of Krt17 was decreased more than 6-fold
upon DES treatment. In the Msx2-/-, however, this decrease was
attenuated (Figure 2). These results indicate that MSX-2 plays an
obligatory role in the DES regulation of Group IIa genes under
normal circumstances, and in its absence, the DES-induced
gene expression changes are abolished. It is noteworthy that the
majority of Group IIa DRGs (92 out of 114) were down-regulated
by DES in the wild-type, but this down-regulation was diminished
in Msx2-/- mice. As clearly visualized in Fig. 1C, these genes were
repressed by DES in the wild-type (blue peaks pointing inwards),
while the repression was no longer detectable or much reduced
in Msx2-/- uteri (corresponding inconspicuous red peaks). These
results support the notion that MSX-2 acts as a transcriptional
suppressor and suggest that it is involved in the DES-suppression
of these genes.
An example of Group IIb genes was Avil, encoding the protein
advillin that may be involved in the morphogenesis of microvilli.
Microarray data showed an almost tenfold increase in expression
by DES in Msx2-/- when compared to controls. By qRT-PCR we
found the induction by DES in Msx2-/- was actually 107-times more
in the mutant (Figure 2). Such discrepancy was not unusual due to
the difference in nature of the two assay systems. Two other group
IIb genes, Prap1 and Sftpd, showed similar trend in expression
(Figure 2). These results suggest that in the normal uterus, Msx2
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 2 of 7
J Stem Trans Bio
Vol. 1. Issue. 1. 270000105
ISSN: 2469-5157
Group I
Group II
IIa
IIb
IIc
Group III
Abca3 2.03(2.66)
Ada 2.9(3.03)
Agpat2 3.93(3.42)
Aim1l 0.14(0.08)
Alox5ap 2.39(4.78)
Anpep 3.04(4.56)
Aqp3 7.19(5.83)
Aqp5 2.92(4.06)
Aurkb 0.31(0.35)
Bat1a 0.48(0.39)
Bcl6 10.73(7.48)
Bex2 0.5(0.31)
Blm 0.33(0.37)
Brrn1 0.36(0.42)
Bub1b 0.22(0.28)
Cables1 0.29(0.36)
Cbr3 2.08(6.44)
Cbx3 0.31(0.5)
Ccbl1 2.14(3.11)
Cd97 2.28(3.14)
Cdc2a 0.35(0.41)
Cdc45l 0.32(0.18)
Cdca2 0.29(0.4)
Cdca3 0.31(0.36)
Cdca7 0.38(0.36)
Cdca8 0.23(0.32)
Cdh16 0.26(0.03)
Cdkn3 0.43(0.41)
Cebpb 2.01(4.39)
Cenpa 0.33(0.42)
Chad 2.82(4.15)
Chaf1a 0.34(0.45)
Chd9 3.23(4.66)
Chpt1 2.38(2.07)
Chtf18 0.24(0.42)
Ckap2 0.27(0.31)
Clcn2 4.9(4.04)
Cldn23 2.88(6.52)
Cp 10.68(12.44)
Cpm 3.03(3.97)
Dact2 2.99(3.34)
Daf1 3.26(4.11)
Dcbld1 0.35(0.48)
Dgat2 3.6(2.44)
Dnmt1 0.39(0.46)
Dnmt3b 0.28(0.49)
E2f1 0.34(0.43)
Edn2 0.24(0.37)
Eps8 2.69(3.42)
Esrra 2.78(3.73)
Ets2 2.79(3.2)
Ezh2 0.44(0.4)
Fcho1 0.31(0.35)
Fgfrl1 2.27(2.89)
Adrb2 5.86(0.88)
Amotl1 0.21(0.85)
Ankrd6 0.15(0.66)
Apoa1 0.12(0.99)
B3gnt5 0.14(0.99)
Bcas1 10.86(1.61)
Capn2 0.12(0.99)
Capn6 0.06(0.62)
Cd1d1 0.18(1.19)
Chodl 0.01(0.15)
Cib2 0.17(0.71)
Ctse 17.26(2.03)
Cttn 0.15(0.95)
Cxcr4 0.04(0.21)
Cxxc6 0.07(0.38)
Dab1 0.08(0.69)
Dapk1 0.23(0.96)
Dbn1 0.05(0.92)
Dbp 2.66(0.61)
Ddah2 0.09(0.49)
Ebpl 0.05(0.6)
Ecm1 5(0.84)
Efs 0.14(0.89)
Ell3 0.06(0.95)
Emid1 0.07(0.37)
Ercc2 0.19(1.08)
Espn 0.22(1.11)
Ets1 0.21(1.65)
Etv4 0.09(0.39)
Fgd2 0.11(1.14)
Abp1 77.05(1214.56)
Ankrd22 2(11.75)
Arg1 12.18(1435.5)
Avil 3.34(25.09)
Bace2 7.81(37.18)
Birc1e 10.85(300.08)
Car12 3.55(29.77) Ceacam2
4.2(27.68)
Bcl2l12 0.45(2.01)
Cbln1 0.34(22.77)
Col4a4 0.48(2.5)
Dscam 0.31(7.26)
Fbp2 5.23(0.4)
Gbp2 2.01(0.43)
Gm644 0.08(2.01)
Bcat1 1.43(17.88)
Cblc 1.64(24.21)
Cbr2 1.33(31.32)
Clca3 1.65(120.28)
Coro2a 1.79(7.18)
Cyp4v3 0.53(2.13)
Dcxr 1.33(5.56)
Fkbp11 8.03(3.08)
Fmo1 0.35(0.16)
Folr1 4.47(2.64)
Fos 5.07(7.62)
Fxyd3 3.16(5.67)
G6pdx 2.84(5.47)
Gadd45a 6.46(10.94)
Gas6 5.41(2.08)
Gch1 5.92(2.53)
Gcnt2 2.23(2.05)
Gjb3 0.26(0.24)
Gjb6 0.02(0.38)
Gmds 3.7(6.58)
Golph2 2.02(2.4)
Gpr172b 2.37(2.25)
Gpr30 0.04(0.25)
Gpx3 7.5(6.59)
Gsto1 3.08(5.12)
Gyltl1b 0.41(0.36)
H1fx 0.21(0.49)
H2afx 0.45(0.5)
H2-DMa 5.53(2.1)
H2-Q2 2.34(2.53)
H2-Q5 2.14(2.8)
H47 2.1(6.43)
Hap1 0.11(0.22)
Hip1r 2.54(4.33)
Hist1h2ak 0.28(0.42)
Hist1h3b 0.17(0.34)
Hist1h3d 0.19(0.39)
Hist1h3e 0.19(0.39)
Hist1h3i 0.16(0.34)
Hist2h2be 0.22(0.39)
Hist2h3b 0.47(0.45)
Hk2 3.67(6.33)
Hmga1 0.31(0.42)
Hmgn2 0.43(0.31)
Homer2 0.13(0.24)
Hoxb2 0.26(0.41)
Ier5l 0.11(0.27)
Ig�bp6 2.83(2.41)
Il4i1 13.6(16.19)
Incenp 0.43(0.44)
Itgb6 2.27(4.34)
Itpk1 2.42(2.88)
Jundm2 4.01(3.93)
Kcnk6 2.8(2.05)
Kif22 0.21(0.33)
Kif2c 0.28(0.42)
Kifc5a 0.38(0.37)
Kit 2.95(2.68)
Krt1-14 0.13(0.13)
Ldh2 0.2(0.3)
Fgf22 0.07(0.75)
Fjx1 0.02(0.26)
Fkbp1b 0.23(1.14)
Fkbp5 0.14(0.66)
Fstl 0.16(0.98)
Fstl1 0.12(0.78)
Fzd7 0.14(0.66)
G6pc2 0.01(0.19)
Gjb6 0.02(0.38)
Gpr20 0.16(0.91)
Gpr27 0.24(1.01)
Gpr30 0.04(0.25)
Grik4 0.35(1.43)
Grik5 0.05(0.78)
H2afy 3.57(0.75)
H2afy3 0.03(0.41)
H2-Oa 0.1(0.44)
Hist1h3c 0.04(0.21)
Hoxb3 0.24(1)
Hr 2.87(0.69)
Icam2 6.97(1.1)
I�it2 0.19(1.01)
Klf2 6.53(1.11)
Klhl6 0.2(1.26)
Krt1-1 0.04(1.03)
Krt1-12 32.72(7.68)
Krt1-17 0.01(0.05)
Lemd1 0.04(0.86)
Lgi2 0.04(0.59)
Lrfn4 0.12(0.68)
Chst8 7.81(240.32)
Ckmt1 4.06(19.6)
Cldn10 2.21(16.19)
Ddc 0.15(0.03)
Dhrs9 3.29(30.14)
Fut2 4.05(30.31)
Hipk1 2.46(10.78)
Klf4 2.21(15.37) Lamc2
2.83(143)
Grtp1 0.33(2.8)
H2-Q5 3.48(0.36)
Hif1a 3.31(0.2)
Hist2h2aa2 0.4(3.7) Nasp
0.4(2.75)
Pdlim1 0.41(2.32)
Pdzrn3 2.9(0.31)
Dnajb9 1.89(0.4)
Fabp6 0.55(18.82)
Fbxw5 1.22(0.29)
Galnt1 1.65(0.11)
Gjb2 1.48(24.48)
Il15 0.58(2.98)
Kcnn4 1.75(8.16)
Lgals3bp 2.89(4.14)
Lmnb2 0.45(0.48)
Lnx2 2(2.22)
Ly6a 8.3(10.49)
Ly96 3.23(2.03)
Man2b2 3.04(3.56)
Mcm10 0.35(0.35)
Mcm2 0.35(0.48)
Mcm3 0.23(0.32)
Mcm5 0.28(0.35)
Me2 0.37(0.46)
Metrn 0.2(0.49)
Mid1ip1 3.25(2.71)
Mki67 0.28(0.43)
Mod1 3.04(3.04)
Mogat2 14.5(12.02)
Mrps6 3.76(2.5)
Mvp 2.4(3.01)
Mybl2 0.3(0.33)
Myd116 5.93(2.38)
Ndg2 2.63(2.19)
N�kbia 2.77(4.42)
Ngef 3.07(3.29)
Nipsnap1 0.18(0.37)
Nt5e 6.14(2.04)
Nudt11 0.24(0.27)
Nup210 0.11(0.17)
Nusap1 0.29(0.33)
Ocil 2.38(2.34)
Olfml3 4.09(3.05)
Osmr 5.09(7.67)
Pace4 6.89(2.53)
Pafah2 2.03(2.05)
Pbk 0.28(0.18)
Pcbp4 0.19(0.43)
Pcyt1b 3.72(3.27)
Pemt 2.3(2.41)
Pex7 2.25(6.07)
Phf6 0.48(0.49)
Phgdh 0.12(0.2)
Plekhb2 2.55(4.46)
Plekhh1 2.49(2.87)
Plekhm1 3.06(2.43)
Plk1 0.29(0.38)
Pola2 0.37(0.42)
Pold1 0.28(0.42)
Pold2 0.43(0.43)
Pparg 5.67(8.14)
Prc1 0.35(0.42)
Prim2 0.41(0.5)
Prodh 0.18(0.24)
Prom 3.72(8.13)
Prom2 0(0)
Prss19 0.05(0.42)
Ltbp4 0.25(1.03)
Mapk12 0.15(0.58)
Matk 0.16(1.06)
Mdk 0.15(0.63)
Meis1 0.31(1.29)
Mlp 0.13(0.57)
Mrg1 0.09(0.47)
Ntf3 0.04(0.42)
Odz3 0.17(0.84)
Pcp4l1 27.19(5.92)
Pdgfrl 0.13(0.65)
PLA2 0.04(0.45)
Plac8 9.88(1.22)
Plekhk1 0.04(0.21)
Pmp22 3.97(0.75)
Ppp1r3c14.63(1.06)
Prima1 0.13(1.96)
Prkg1 7.3(0.93)
Prr7 0.12(0.52)
Prss19 0.05(0.42)
Punc 0.07(0.36)
Qscn6 13.7(2.85)
Ramp2 0.24(1.17)
Rarb 0.15(0.65)
Rasl11b 0.2(0.9)
Rims3 0.12(0.61)
Rnf144 0.09(0.83)
Rohn 0.15(0.82)
Rsdr1-pending 0.12(0.49)
Ltf 6.2(41.67)
Muc20 3.08(18.86)
Oit1 2.64(46.54)
Omp 8.74(36.52)
ORF9 6.66(168.88)
Padi2 5.31(114.21)
Padi4 5.54(36.79)
Pcolce2 2.11(41.07)
Prap1 7.79(88.57)
Ppp1r3b 0.35(2.16)
Ppp2r5c 0.42(2.67)
Ptpru 0.46(2.14)
Rfc3 0.38(3.32)
Rwdd1 0.39(4)
Slitrk1 0.04(3.22)
Syngr1 0.49(2.7)
Lcn2 1.3(29.59)
Ly6g6e 1.63(82.58)
Muc1 1.7(7.97)
Mx2 0.6(7.04)
Padi1 1.4(21.89)
Pde6d 0.63(0.11)
Plekha6 0.51(5.07)
Psmc3ip 0.47(0.36)
Ptn 0.08(0.29)
Ptp4a1 4.82(2.39)
Ptpn18 2.12(2.19)
Rad54l 0.26(0.31)
Ralbp1 2.35(2.13)
Rasa4 6.14(3.23)
Rerg 3.24(2.1)
Rfc2 0.46(0.46)
Rfx2 0.49(0.5)
Rhpn2 3.01(2.39)
Ris2 0.31(0.4)
Robo1 0.3(0.33)
Rrm1 0.39(0.33)
S100a14 0.25(0.2)
Sap30 0.42(0.5)
Scx 0.02(0.06)
Sephs2 3.4(2.11)
Sfrs7 0.2(0.31)
Sgol2 0.36(0.47)
Sh3bgrl2 3.1(3.65)
Slc2a1 4.54(2.52)
Slc35c1 2.23(2.66)
Slc39a4 4.4(6.43)
Slc7a4 2.17(2.76)
Smpd3 15.46(16.11)
Smpdl3a 3.16(3.88)
Smpdl3b 0.31(0.34)
Sox7 4.01(3.42)
Sox9 4.33(8.68)
Sphk1 3.1(3.07)
Spint1 2.53(6.81)
Sprr2g 3.21(2.99)
Ssbp2 0.26(0.37)
Stk6 0.48(0.37)
Sult1c2 4.6(8.5)
Tcfcp2l1 2.59(3.18)
Tcn2 2.44(2.34)
Tgm2 6.91(3.48)
Tmc7 9.96(9.35)
Tmem24 5.51(3.8)
Tmprss2 3.59(7)
Tnfrsf21 3.61(2.21)
Tnnc1 13.56(8.62)
Trp53inp2 5.83(2.87)
Trpv4 2.6(2.36)
Uhrf1 0.3(0.33)
Wfs1 3.35(4.1)
Wnt7a 0.15(0.07)
Zdhhc14 3.45(2.8)
Zranb3 0.3(0.49)
Sall2 0.11(0.57)
Scara3 0.12(1.1)
Sdk1 0.11(1.21)
Sema6d 6.82(1.55)
Sfxn2 0.15(0.74)
Shd 0.08(0.79)
Slc12a2 7.44(1.59)
Slc29a4 0.03(0.29)
Snn 0.11(0.52)
Snx8 4.89(0.84)
Srd5a2 0.05(0.54)
Ssb4 0.03(0.4)
Stc1 0.07(0.8)
Stxbp4 0.19(1.04)
Tcf3 0.12(0.95)
Tekt1 0.04(0.33)
Tesc 4.74(1.02)
Tns 8.44(1.59)
Trp63 0.01(1.45)
Tuba1 0.19(0.83)
Vldlr 6.91(1.64)
Wbscr17 0.01(0.42)
Wbscr24 0.15(0.65)
Wnt5a 7.87(1.7)
Zfp184 0.09(0.42)
Scml4 11.58(59.18)
Sdcbp2 2.54(23.71)
Sema4a 2.66(10.97)
Sftpd 12.86(81.01)
Slc5a9 3.3(82.87)
Trpv6 2.61(12.68)
Uox 22.98(1022.66)
Ttc3 0.35(4.53)
Upk1a 0.28(4.86)
Upk2 0.41(28.66)
Reprimo 0.52(3.35)
Rutbc2 1.87(7.68)
Slc39a8 0.75(4.67)
Tmprss4 1.45(75.02)
Ugt1a10 1.7(7.28)
Ywhah 1.37(0.17)
Comparison of DRGs by DES between wild-type and Msx2-/- uterus.
Table 1: List of DRGs found in Msx2-/- uterus that showed similar (group I) or differential (groups II and III) DES regulation compared to wild-type. Each
DRG is presented as "gene name, fold-change in wild-type (fold-change in Msx2-/-).
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 3 of 7
J Stem Trans Bio
ISSN: 2469-5157
Vol. 1. Issue. 1. 270000105
Figure 2: Quantitative real-time RT-PCR validations of the microarray data in isolated neonatal uterine epithelium. Relative transcript level on
logarithmic scale determined by qRT-PCR of two or three genes representing each group were shown. Two numbers under each gene name denote foldchanges by DES in control and Msx2-/-, with and without parentheses, respectively. Three biological replicates were included in each treatment group.
antagonizes transcriptional activation of Group IIb genes by DES,
and in its absence, this effect is augmented. Group IIc genes showed
a more complicated regulation, where DES exhibited opposite
regulation on gene expression in the control and Msx2-/- uterus.
For example, Fbp2, a gene encoding a gluconeogenesis regulatory
enzyme, was up-regulated in the control uterus upon DES exposure,
but was down-regulated by DES in Msx2-/- uterus (Figure 2). Similar
results were obtained for Pdzrn3, a gene encoding a PDZ domain
containing E3 ubiquitin ligase. It is likely that Msx2 is involved in the
DES regulation of these genes, but the exact mechanisms remains
unclear at present. Group III genes showed no apparent expression
changes in the control uterus by DES, but were either up- or downregulated by more than twofold in the Msx2 -/- when exposed
to DES. Expression of two such genes, Slc39a8 and Kcnn4, were
validated by qRT-PCR (Figure 2). These genes are similar to Group
IIb genes in the sense that MSX-2 antagonizes DES-regulation, and
DES effect on gene expression changes was only observed in Msx2/- uterus.
Msx2 Is Dispensable for the DES-induced Changes in Adipogenesis and Lipid Metabolism in the Uterine Epithelium
As mentioned in the introduction, we have previously reported
that neonatal DES exposure altered lipid metabolism in the uterine
epithelium through upregulation of a master transcription factor
of adipogenesis, PPARγ [9]. To investigate whether Msx2 plays a
role in this process, we analyzed expression of Pparγ in the control
and Msx2-/- uterus. As shown in Figure 3A, Pparγ is upregulated by
DES, regardless of Msx2 status, indicating that this process is not
mediated through Msx2. Many Pparγ downstream targets including
Acsl1 and Arntl, and genes involved in lipid metabolism and
trafficking (e.g. Agpat2, Slc2a1), also showed similar regulation by
DES in Msx2-/- uterus (Figure 3A and Table 1). We next examined
frozen uterine sections stained with Oil red O, a lysochrome diazo
dye that binds neutral lipids, for signs of lipid metabolism changes.
As we have previously reported, administration of DES caused
increased lipid deposition exclusively in the uterine epithelium
(Figure 3B, C). Similar results were obtained in Msx2-/- uteri
(Figure 3D, E). These results collectively demonstrated that the
DES-induced lipid metabolism changes in the uterine epithelium
through Pparγ upregulation is Msx2-independent.
Discussion
Since the discovery of the adverse effects of DES on human
health, numerous studies in model animals have been conducted
trying to uncover the underlying molecular mechanisms. The
neonatal DES mouse model is widely used, because DES-treated
animals exhibited a variety of developmental abnormalities
and pathologies recapitulating the human syndrome including
uterine metaplasia and vaginal adenosis. We have previously
conducted global gene profiling studies, and found that neonatal
DES treatment in mice caused a series cellular changes including
proliferation, apoptosis, metabolic as well as other physiological
changes through modulation of uterine gene expression [8,9].
We have also discovered that the transcription factor MSX-2, can
modulate the responsiveness of uterus and vagina to DES [10]. To
better understand how Msx2 modulates DES response in the uterus,
here we performed microarray analyses using RNA extracted from
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 4 of 7
J Stem Trans Bio
ISSN: 2469-5157
Vol. 1. Issue. 1. 270000105
a repressor that normally counteracts this induction. On the other
hand, repression of certain gene expression by DES may require
MSX-2 participation, as its absence leads to failure of repression by
DES.
We previously showed that the regulation of Aqp3 by DES was
abolished in Msx2 mutant vaginal epithelium [10]. Surprisingly,
here we found that Aqp3 was similarly induced in both wild-type
and Msx2 mutant uterus. These seemingly contradictory results can
be reconciled by the fact that the intermediate cell layers expressing
Aqp3 in the developing vagina are missing in Msx2 mutants, and
thus failure of induction by DES in Msx2 mutant vagina is secondary
to a defective patterning event. In this sense, Aqp3 is likely not a
target of Msx2 either in the uterus or in the vagina.
Figure 3: DES alters uterine lipid metabolism in an Msx2-independent
manner. (A) RT-PCR showing that activation of the adipogenic marker,
Pparγ, as well as its downstream targets, is independent of Msx2. No
RT controls were amplification of housekeeping Rpl7 genes using
RNA as templates. (B-E) Oil red O staining showing DES treatment
resulted in lipid droplets deposition in the basal-lateral side of uterine
epithelium (arrows) in both control (C) and Msx2-/- (E). The basement
membranes of oil-treated control (B) and Msx2-/- (D) were outlined
with dotted lines. UE, uterine epithelium; UM, uterine mesenchyme.
Scale bars: 50µm in B-E.
oil- or DES-treated Msx2-/- uteri, and compare this result to that
of our previous array data performed on wild-type animals. By
comparing the two data sets, we uncovered three groups of genes in
general: group I contains genes that are similarly regulated by DES
both in wild type and in Msx2-/- uteri. Thus Msx2 is dispensable
for the regulation of this group of 212 genes by DES. Group II
consists of 171 genes whose regulation by DES is altered (in either
direction) in Msx2 mutant uteri. Thus Msx2 plays important roles in
modulating their regulation by DES. Group III consists of 27 genes
that are not regulated by DES in wild type uterus, but are now DES
targets in Msx2 mutant uteri. These genes are likely not MSX-2
transcription targets but rather exhibit altered DES responsiveness
due to secondary changes, such as cell fate change. We further
subdivided group II genes into three categories: genes whose
regulations by DES are either lost or attenuated in Msx2 mutant
uterus; those whose regulations are enhanced by Msx2 mutation;
and those oppositely regulated by DES in the two genotypes. RTPCR was used to validate representative genes from each subgroup.
Interestingly, we observed that most DES-induced genes showed a
greater response in Msx2-/- uterus, evidenced by the red peaks in
the star glyph (Figure 1C). On the other hand, DES-repressed genes
lost this repressive regulation in Msx2 mutant uterus, evidenced
by the blue peaks (Figure 1C). These results are in agreement
with previous studies suggesting that Msx2 mainly functions as
a transcriptional repressor [20]. In this scenario, DES can induce
target gene expression to a greater degree due to the removal of
We showed recently that lipid metabolism in the neonatal
uterus was dramatically affected by DES exposure [9]. This change
is mediated through the upregulation of a transcription factor
PPARγ, which in turn led to gene expression changes in an array of
genes involved in lipid trafficking and metabolism. By analyzing the
expression of those genes in DES-treated Msx2-/- uterus, we found
that Msx2 is not involved in the DES-regulation of this process.
Pparγ was similarly induced in Msx2-/- as in controls, so were many
Pparγ downstream genes. Consistently, lipid droplet accumulation
in the uterine epithelium was also observed in the Msx2-/- uterus
upon DES exposure. Interestingly, it was previously reported that
in myofibroblasts, Msx2 stimulates osteogenesis but suppress
adipogenesis by activating Osx transcription and concomitantly
suppressing Pparγ expression [21]. Our results that Pparγ showed
no change in basal level in the absence of Msx2 indicate that Msx2
is unlikely to be a transcriptional suppressor of Pparγ, at least
in the uterus. In addition, DES increases Pparγ, and alters lipid
metabolism in the uterus in an Msx2-independent way.
Future investigations on the function of these MSX-2 target
candidates are needed to further evaluate their function(s) during
normal uterine development as well as during DES-induced
pathogenesis of the female reproductive tracts. Nevertheless,
identification of these genes may shed light on how Msx2 regulate
terminal differentiation of the uterus, and possibly other Msx2expressing tissues.
Materials and Methods
Mice
All mice were housed in the animal facility at Washington
University with controlled light/dark cycles and handled in
accordance with National Institutes of Health guidelines. All
procedures were approved by the Washington University
Institutional Animal and Use Committee. Msx2 mutants were
generated and described previously [11], and breeding between
female Msx2+/- and male Msx2-/- were used to obtain control and
homozygous pups. DES was prepared and injected from P1 to P5 as
described previously [8]. Uteri from female pups were harvested
for fixation or RNA extraction 24 hours after the last injection.
cDNA Microarray and Data Analysis
Oil- or DES-treated P5 Msx2-/- mice were harvested for
RNA preparation. Uterine tissues from 3-4 animals of the same
treatment group were pooled together and RNA isolated to make
one sample. Total RNA was cleaned using RNeasy Kit (Qiagen,
Valencia, CA) and submitted to the Genome Technology Access
Center (GTAC) at Washington University School of Medicine for
microarray analysis on Affymetrix Genechip. A total of three
biological replicates were used for microarray analysis. Normalized
data were provided by the GTAC and detailed analysis protocol was
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 5 of 7
J Stem Trans Bio
ISSN: 2469-5157
available upon request. Subsequent analyses were performed and
star glyphs generated in Microsoft Excel 2007. DRGs that showed
high expression in the wild-type uterine mesenchymal tissue
from our previous microarray data [9], either with or without DES
treatment, were excluded from the current analysis to better focus
on Msx2-dependent gene regulation.
Uterine Epithelium Isolation, RNA Extraction and Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
Uterine epithelium isolation was performed as described
previously [9]. Briefly, dissected neonatal uterine horns were cut
into 3-4 mm long segments and incubated on a rotating platform
in calcium-free, magnesium-free Hank’s balanced salt solution
containing 1% trypsin for 1 hour at 4°C. Enzymatic digestion was
stopped by adding an equal volume of 5 mg/ml bovine serum
albumin after the incubation, and epithelial tissues were extruded
from the uterine horns by applying gentle pressure along each
segment. Epithelial tissues from individual animals of the same
genotype/treatment were transferred to fresh tubes and pooled
together. Low speed centrifugation was applied to collect tissue
pellets [22]. Total RNA was isolated from the cell/tissue pellets
with RNA Stat-60 (Tel-Test, Inc., Friendswood, TX) following
manufacture’s instruction. Primer design, reverse transcription
and qRT-PCR were performed as previously described [23,24].
Primer sequences used were as follows:
Aqp3: 5’CCTTGGCATCTTGGTGGCT3’, 5’AGGAAGCACATTGCGAAGGT3’;
Rasa4: 5’CAGGATCCTTGTCCCAGTC3’, 5’GAGCAGTTGGTTCTCCCAAG3’;
Wnt7a: 5’GAACTTACACAATAACGAGGCG3’, 5’GTGGTCCAGCACGTCTTAGT3’;
H2afy: 5’CGGTGGTGAAGTAGGAAACAC3’, 5’GCTGCCAATGGATGGGAAG3’;
Krt17: 5’ACCATCCGCCAGTTTACCTC3’, 5’CTACCCAGGCCACTAGCTGA3’;
Prkg1: 5’CCCCTCAACAAAACAGGATG3’, 5’GAAGGAGGAGGGCTAGCAAC3’;
Avil: 5’GAGTGCTCACGGCAACTTCTA3’, 5’GGGAGGAGTCCTTCCCGAT3’;
Prap1: 5’CCCTAACCACTCTTCCACTCC3’, 5’TTCTCCCACCAATTTTCAGG3’;
Sftpd: 5’GGACAATATTTGGCCAGGAG3’; 5’AGCTATACACCTTTTATTAGGATGTTG3’;
Fbp2: 5’CGCTTCCCTTTGTCTTTGTC3’, 5’TTCTGACCGTGACCTGTGTC3’;
Pdzrn3: 5’CTGCGCTACCAGAAGAAGTTC3’, 5’TCCATCTTGATTGTCCACACAG3’;
Slc39a8: 5’GCCAAGCTCATGTACCTGTCT3’, 5’AAGATGCCCCAATCGCCAA3’;
Kcnn4: 5’CAAGCCCCACGATAAATCAC3’, 5’GTGGGAGGTCCAATTCAGTG3’;
Arntl: 5’TGACCCTCATGGAAGGTTAGAA3’, 5’GGACATTGCATTGCATGTTGG3’;
Ascl1: 5’GCAACCGGGTCAAGTTGGT3’, 5’GTCGTTGGAGTAGTTGGGGG3’;
Pparg: 5’GGAAGACCACTCGCATTCCTT3’, 5’GTAATCAGCAACCATTGGGTCA3’;
Rp17: 5’AGCCCAAAGGTTCGTAAGGT3’, 5’AGCCTCGCTTGTAGATGAGC3’.
Oil-red O Staining
For Oil red O staining, uterine tissues were embedded in O.C.T.
and snap frozen in liquid nitrogen. Slides of 10 µm cryosections
were allowed to dry briefly at room temperature, washed in water
once, twice in 100% propylene glycol (Sigma), then incubated
in 0.7% Oil red O (Sigma) in propylene glycol for 7 minutes with
agitation at 60°C. Slides were then washed in 85% propylene glycol
briefly, rinsed in water, and mounted with glycerin jelly.
Acknowledgements
This grant is supported by the National Institutes of Health
(ES014482 to LM). We thank the Genome Technology Access
Center in the Department of Genetics at Washington University
Vol. 1. Issue. 1. 270000105
School of Medicine for help with genomic analysis. The Center is
partially supported by NCI Cancer Center Support Grant #P30
CA91842 to the Siteman Cancer Center and by ICTS/CTSA Grant#
UL1RR024992 from the National Center for Research Resources
(NCRR), a component of the National Institutes of Health (NIH), and
NIH Roadmap for Medical Research. This publication is solely the
responsibility of the authors and does not necessarily represent the
official view of NCRR or NIH.
References
1. Soto AM, Sonnenschein C. Environmental causes of cancer: endocrine
disruptors as carcinogens. Nature reviews. Endocrinology. 2010; 6: 363370. doi:10.1038/nrendo.2010.87
2. Mittendorf R. Teratogen update: carcinogenesis and teratogenesis
associated with exposure to diethylstilbestrol (DES) in utero. Teratology.
1995; 51(6): 435-445
3. McLachlan JA. Prenatal exposure to diethylstilbestrol in mice:
toxicological studies. Journal of toxicology and environmental health.
1977; 2(3): 527-537. DOI:10.1080/15287397709529453
4. McLachlan JA, Newbold RR, Shah HC, Hogan MD., Dixon, R. L. Reduced
fertility in female mice exposed transplacentally to diethylstilbestrol
(DES). Fertil Steril. 1982; 38(3):364-371
5. Kurita T., Cooke PS, Cunha GR. Epithelial-stromal tissue interaction in
paramesonephric (Mullerian) epithelial differentiation. Dev Biol. 2001;
240(1):194-211
6. Laronda MM, Unno K, Ishi K, Serna VA, Butler LM, Mills AA, et al.
Diethylstilbestrol induces vaginal adenosis by disrupting SMAD/RUNX1mediated cell fate decision in the Mullerian duct epithelium. Dev Biol.
2013; 381(1): 5-16. doi: 10.1016/j.ydbio.2013.06.024
7. Lindzey J, Wetsel WC, Couse JF, Stoker T, Cooper R, and Korach KS.
Effects of castration and chronic steroid treatments on hypothalamic
gonadotropin-releasing hormone content and pituitary gonadotropins
in male wild-type and estrogen receptor-alpha knockout mice.
Endocrinology. 1998; 139(10): 4092-4101
8. Huang WW, Yin Y, Bi Q, Chiang TC, Garner N, Vuoristo J, et al.
Developmental diethylstilbestrol exposure alters genetic pathways of
uterine cytodifferentiation. Mol Endocrinol. 2005; 19(3): 669-682
9. Yin Y, Lin C, Veith GM, Chen H, Dhandha M, Ma L. Neonatal diethylstilbestrol
exposure alters the metabolic profile of uterine epithelial cells. Dis Model
Mech. 2012; 5(6):870-880. doi: 10.1242/dmm.009076.
10. Yin Y, Lin C, Ma L. MSX-2 promotes vaginal epithelial differentiation
and wolffian duct regression and dampens the vaginal response to
diethylstilbestrol. Mol Endocrinol. 2006; 20(7): 1535-1546
11. Satokata I, Ma L, Ohshima H, Bei M, Woo I, Nishizawa K, et al. Msx2
deficiency in mice causes pleiotropic defects in bone growth and
ectodermal organ formation. Nat Genet. 2000; 24(4): 391-395
12. Ma L, Liu J, Wu T, Plikus M, Jiang TX, Bi Q, et al. Cyclic alopecia’ in
Msx2 mutants: defects in hair cycling and hair shaft differentiation.
Development. 2003; 130(2): 379-389
13. Bei M, Stowell S, Maas R. Msx2 controls ameloblast terminal
differentiation. Developmental dynamics. 2004; 231(4):758-765. DOI:
10.1002/dvdy.20182
14. Cai J, Ma L. Msx2 and Foxn1 regulate nail homeostasis. Genesis. 2011;
49(6): 449-459. doi: 10.1002/dvg.20744
15. Chen Y, Zhang Y, Jiang TX, Barlow AJ, St Amand TR, Hu Y, et al. Conservation
of early odontogenic signaling pathways in Aves. Proceedings of the
National Academy of Sciences of the United States of America. 2000;
97(18): 10044-10049. doi: 10.1073/pnas.160245097
16. Moon RT, Bowerman B, Boutros M, Perrimon N. The promise and perils
of Wnt signaling through beta-catenin. Science. 2002; 296(5573): 16441646
17. Miller C, Sassoon DA. Wnt-7a maintains appropriate uterine patterning
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 6 of 7
J Stem Trans Bio
ISSN: 2469-5157
during the development of the mouse female reproductive tract.
Development. 1998; 125(16): 3201-3211.
18. Miller C, Degenhardt K, Sassoon DA. Fetal exposure to DES results in
de-regulation of Wnt7a during uterine morphogenesis. Nature genetics.
1998; 20(3): 228-230
19. Couse JF, Dixon D, Yates M, Moore AB, Ma L, et al. Estrogen receptoralpha knockout mice exhibit resistance to the developmental effects of
neonatal diethylstilbestrol exposure on the female reproductive tract.
Dev Biol. 2001; 238(2): 224-238
20. Newberry EP, Boudreaux JM, Towler DA. Stimulus-selective inhibition
of rat osteocalcin promoter induction and protein-DNA interactions by
the homeodomain repressor Msx2. J Biol Chem. 1997 ; 272(47): 2960729613
Vol. 1. Issue. 1. 270000105
21. Cheng SL, Shao JS, Charlton-Kachigian N, Loewy AP, Towler DA. MSX-2
promotes osteogenesis and suppresses adipogenic differentiation of
multipotent mesenchymal progenitors. J Biol Chem. 2003; 278(46):
45969-45977
22. Bigsby RM, Cooke PS, Cunha GR. A simple efficient method for separating
murine uterine epithelial and mesenchymal cells. Am J Physiol. 1986;
251, E630-636
23. Yin Y, Huang WW, Lin C, Chen H, MacKenzie A, Ma L. Estrogen suppresses
uterine epithelial apoptosis by inducing birc1 expression. Mol
Endocrinol. 2008; 22(1): 113-125
24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods. 2001; 25(4): 402-408
*Corresponding Author: Liang Ma, Department of Medicine, Box 8123, Washington University 660 S. uclid Ave. St. Louis, MO 63110, USA, Fax: 314454-5626; Email: lima@dom.wustl.edu
Received Date: Received Date: October 30, 2014, Accepted Date: May 04, 2015, Published Date: May 12, 2015.
Copyright: © 2015 Liang Ma, et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original work is properly cited.
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates Uterine Progenitor Cell Response
to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Citation: Yin Y, Lin C, Zhang I, Fisher AV, Dhandha M, et al. (2015) Homeodomain Transcription Factor Msx-2 Regulates
Uterine Progenitor Cell Response to Diethylstilbestrol. J Stem Trans Bio 1(1): http://dx.doi.org/10.19104/jstb.2015.105.
Page 7 of 7