Volume 6, Number 12, December 2012 (Serial Number 56)
5. Conclusion
supplements. Flagella are necessary for colonization of the gastric
The main contribution of this work was to mucosa and play an important role in biofilm
demostrate the effect of a cyanobacterial extract on H. formation suppressing repulsive forces of hydrophobic
pylori biofilm formation. CE markadely increased the surfaces [3, 13]. The expression of flaA gen was strain
survival, gene expression and maintenance of H. and supplement dependent. The flaA gene of the
pylori cells bacillary forms in the biofilm. The effect HP796 strain, with higher ability to form biofilm, was
was superior to that obtained using FCS. The effect of
1.5 fold up regulated in comparison to planktonic cells the cyanobacterial extract favouring biofilm formation while the reference strain was 0.7 fold down regulated
of H. pylori with retained pathogenicity can be at the early stage of biofilm formation using the
considered a fact of possible occurence in water MHB-CE medium. The lpxD gene with MHB-CE was
bodies where cyanobacteria are present that might up regulated with both strains and surfaces in biofilms
constitute a novel source of transmission. of 196 h evolution.
Acknowledgments
The most remarkable increase in gene expression was observed with the omp18 gene with the CE
The authors thank Patricia Gomez, Patricia Vallejos supplement producing the most effective induction,
and Ruben Majul for providing the gastric biopsy indicating the important participation of outer specimens. The authors have no conflict of interest to
declare. This work was supported by funds of Science membrane proteins in cell aggegation and biofilm
and Technology Project 9303 and Project 0310 from establishment. Both strains up regulated the
the National University of San Luis. expression of omp18 gene, however the strain HP796,
ClaR and MtzR, and genotype virulent cagA+, vacA+
References
and iceA1, showed similar, and even greater [1] H.L. Mobley, G.L. Mendz, S. Hazel, Helicobacter pylori:
expression than the reference strain. Physiology and Genetics, American Society for The soluble metabolites present in the CE increased
Microbiology Press, Washington, DC, 2001, Chapter 2, biofilm formation, viability and gene expression of H. pp. 7-18. [2] M.A. Carron, V.R. Tran, C. Sugawa, J.M. Coticchia,
pylori. The CE was produced as a dry powder using Identification of Helicobacter pylori biofilms in human
concentrated biomass of the filamentous gastric mucosa, Journal of Gastrointestinal Surgery 10 cyanobacterium Nostoc sp., heat treated with
(2006) 712-717.
subsequent lyophilization of the soluble material [3] R. Reeser, R.T. Medler, S.J. Billington, J.B. Helen, L.A. Joens, Characterization of Campylobacter jejuni biofilms
released. The high protein content of CE [24] could under defined growth condition, Applied Environmental stimulate the initial attachment of H. pylori cells to
Microbiology 73 (2007) 1908-1913.
Helicobacter pylori Biofilm Formation and Gene Expression on
Abiotic Surfaces Using a Cyanobacterial Extract
[4] A.K. Ojha, A.D. Baughn, D. Sambandan, T. Hsu, X. biofilm consortium cultivated in a constant-depth film Trivelli, Y. Guerardel, et al., Growth of Mycobacterium
fermenter, Infection and Immunity 71 (7) (2003) tuberculosis biofilms containing free mycolic acids and
188-7192.
harbouring drug-tolerant bacteria, Molecular [18] M. Mazari-Hiriart, Y. López-Vidal, G. Castillo-Rojas, S. Microbiology 69 (1) (2008) 164-174.
Ponce de León, A. Cravioto, Helicobacter pylori and [5] M.E. Roberts, P.S. Stewart, Modelling protection from
other enteric bacteria in freshwater environments in antimicrobial agents in biofilms through the formation of
México City, Archives of Medical Research 32 (2001) persistent cells, Microbiology 151 (2005) 75-80.
458-467.
[6] L. Yuan, J.D. Hillman, A. Progulske-Fox, Microarray [19] S. Fujimura, S. Kato, T. Kawamura, Helicobacter pylori analysis of quorum-sensing regulated genes in
in Japanese river water and it prevalence in Japanese Porphyromonas gingivalis, Infection and Immunity 73
children, Letters in Applied Microbiology 38 (2004) (2005) 4146-4154.
517-521.
[7] M.R. Parsek, E.P. Greenberg, Sociomicrobiology: The [20] N. Queralt, R. Bartolomé, R. Araujo, Detection of connections between quorum sensing and biofilms,
Helicobacter pylori DNA in human faeces and water with Trends in Microbiology 13 (2005) 27-33.
different levels of fecal pollution in the north-east of [8] K.P. Fong, W. Chung, R.J. Lamont, D.R. Demuth, Intra-
Spain, Journal of Applied Microbiology 98 (2005) and interspecies regulation of gene expression by
889-895.
Actinobacillus actinomycetemcomitans luxS, Infection [21] S.G. Simis, M. Tijdens, H.L. Hoogveld, H.J. Gons, and Immunity 69 (2001) 7625-7634.
Optical changes associated with cyanobacterial bloom [9]
E.A. Joyce, B.L. Bassler, A. Wright, Evidence for a termination by viral lysis, Journal of Plankton Research signaling system in Helicobacter pylori: Detection of a
27 (2005) 937-949.
luxS encoded autoinducer, Journal of Bacteriology 13 [22] J. Rapala, High diversity of cultivable heterotrophic (2000) 3638-3643.
bacteria in association with cyanobacterial water blooms, [10] M.H. Forsyth, T.L. Cover, Intercellular communication in
International Society for Microbial Ecology Journal 3 Helicobacter pylori: luxS is essential for the production
(2009) 314-325.
of an extracellular signaling molecule, Infection and [23] K.A. Berg, C. Lyra, R.M. Niemi, B. Heens, K. Hoppu, K. Immunity 6 (2000) 3193-3199.
Erkomaa, et al., Virulence genes of Aeromonas isolates, [11] L. Cellini, R. Grande, T. Traini, E. Di Campli, S. Di
bacterial endotoxins and cyanobacterial toxins from Bartolomeo, D. Di Iorio, et al., Biofilm formation and
recreational water samples associated with human modulation of luxS and rpoD expression by Helicobacter
health symptoms, Journal of Water Health 9 (2011) pylori, Biofilm 2 (2005) 1-9.
670-679.
[12] E. Bester, G. Wolfaardt, L. Joubert, K. Garny, S. Saftic, [24] P.G. Silva, D.M. González, E. Aguilar, H.J. Silva, Planktonic-cell yield of a Pseudomonad biofilm, Nutritional evaluation of Cyanobacterium (Nostoc sp.) Applied and Environmental Microbiology 71 (2005)
extract in Rhizobium cultures, World Journal of 7792-7798.
Microbiology and Biotechnology 14 (1998) 223-228. [13] K. Lemon, D.E. Higgins, R. Kolter, Flagellar motility is
A.E. Vega, T.I. Cortiñas, C.M. Mattana, H.J. Silva, O.P. critical for Listeria monocytogenes biofilm formation,
de Centorbi, Growth of Helicobacter pylori using Journal of Bacteriology 189 (2007) 4418-4424.
cyanobacterial extract, Journal of Clinical Microbiology [14] J.T. Loh, M.H. Forsyth, T.L. Cover, Growth phase
41 (2003) 5384-5388.
A.E. Vega, T.I. Cortiñas, P.W. Stege, H.J. Silva, Efecto luxS dependent, Infection and Immunity 72 (2004)
regulation of flaA expression in Helicobacter pylori is
de un extracto de cianobacteria en el cultivo y 5506-5510.
conservación de Helicobacter pylori, Sociedad [15] P. Voland, N. Hafsi, M. Zeitner, S. Laforsch, H. Wagner,
Iberoamericana de Información Científica (SIIC) [online], C. Prinz, Antigenic properties of HpaA and Omp18, two
http://www.siicsalud.com/dato/dat043/05606011.htm, outer membrane proteins of Helicobacter pylori,
2005. (in Spanish)
Infection and Immunity 71 (2003) 3837-3843. [27] J.C. Williams, K.A. McInnis, T.L. Testerman, Adherence [16] N. Kim, E.A. Marcus, Y. Wen, D.L. Weeks, D.R. Scott,
of Helicobacter pylori to abiotic surfaces is influenced by H.C. Jung, et al., Genes of Helicobacter pylori regulated
serum, Applied and Environmental Microbiology 74 by attachment to AGS cell, Infection and Immunity 72
(2008) 1255-1258.
(2004) 2358-2368. [28] M.E. Davey, G.A. O’Toole, Microbial biofilms: from [17] M. Shu, M. Browngardt, Y. Ywan, M. Chen, R. Burne,
ecology to molecular genetics, Microbiology and Role of urease enzymes in stability of a 10-species oral
Molecular Biology Review 64 (2000) 847-867.
Helicobacter pylori Biofilm Formation and Gene Expression on
1327
Abiotic Surfaces Using a Cyanobacterial Extract
[29] S.R. Park, W.G. Mackay, D.C. Reid, Helicobacter sp. Adhesion of water stressed Helicobacter pylori to abiotic recovered from drinking water biofilm sampled from a
surfaces, Journal of Applied Microbiology 101 (2006) water distribution system, Water Research 35 (2001)
718-724.
1624-1626. [35] S.P. Cole, D. Cirillo, M.F. Kagnoff, D.G. Guiney, L. [30]
H. Yonezawa, T. Osaki, S. Kurata, M. Fukuda, H. Eckmann, Coccoid and spiral Helicobacter pylori differ Kawakami, K. Ochiai, et al., Outer membrane vesicles of
in their abilities to adhere to gastric epithelial cells and Helicobacter pylori TK1402 are involved in biofilm
induce interleukin-8 secretion, Infection and Immunity 65 formation, BioMedCentral Microbiology 9 (2009)
(1997) 843-846.
D.G. Davies, M.R. Pársec, J.P. Pearson, B.H. Iglewski, [31] L. Cellini, I. Robuffo, E. Di Campli, S. Di Bartolomeo, T.
197-210.
[36]
J.W. Costerton, E.P. Greenberg, The involvement of Taraborelli, B. Dainelli, Recovery of Helicobacter pylori
cell-to-cell signals in the development of a bacterial ATCC43504 from a viable but not culturable state:
biofilm, Science 280 (1998) 295-298.
regrowth or resuscitation? Acta Pathologica [37] S.C. Belval, L. Gal, S. Margiewes, D. Garmyn, P. Microbiologica et Immunologica Scandinavica 106 (1998)
Piveteau, J. Guzzo, Assessment of the roles of LuxS, 571-579.
S-ribosyl homocysteine, and autoinductor 2 in cell [32] B.L. Adams, T.C. Bates, J.D. Oliver, Survival of
attachment during biofilm formation by Listeria Helicobacter pylori in a natural freshwater environment,
monocytogenes, Applied and Environmental Applied and Environmental Microbiology 69 (2003)
Microbiology 72 (2006) 2644-2650. 7462-7466.
[38] R.M. Donlan, Biofilms: microbial life on surfaces, [33] S.P. Cole, J. Harwood, R. Lee, R. She, D.G. Guiney,
Emerging Infectious Diseases 8 (2002) 881-890. Characterization of monospecies biofilm formation by
[39] K.T. Elvers, S.F. Park, Quorum sensing in Helicobacter pylori, Journal of Bacteriology 186 (2004)
Campylobacter jejuni: Detection of a luxS 3124-3132.
encoded signalling molecule, Microbiology 148 (2002) [34] N.F. Azevedo, A.P. Pacheco, C.W. Keevil, M.J. Vieira,
175-181.
Journal of Life Sciences 6 (2012) 1328-1333
RAPD-PCR Based Marker Approach for the Genetic Differentiation of Two Species of Cockroach (Order-Dictyoptera)
Bharat Neekhra, Divya Pandey and Subodh Kumar Jain Molecular Biology Laboratory, Department of Biotechnology, Dr. Hari Singh Gour University, Sagar 470003, India
Received: February 04, 2012 / Accepted: April 07, 2012 / Published: December 30, 2012.
Abstract: Random amplified polymorphic DNA (RAPD) analysis was conducted for the differentiation of two most commonly occurring insect species Periplaneta americana and Blatella germanicana. This technique is proved to be a quick and effective to establish genetic markers to differentiate morphologically similar populations. During the study cockroach species Periplanata americana and Blatella germanicana were considered. Ten random primers were used for polymerase chain reaction (PCR). Many of such bands obtained, which differentiate between the two species. On the basis of interpretability, simplicity and reproducibility, six primers P1 (GATGACCGCC), P3 (GGCACGTAAC), P6 (GGTGCGCCTT), P7 (GTCAGAGTCG), P8 (GTCGCCGTCT) and P10 (GTGCCCGATG) were considered positive for genetic differentiation and analysis. A series of bands ranging from ~300 bp to ~1,000 bp obtained indicates that these two species are related, however they exhibit some variations. It has also been observed that the same primers also amplified some DNA fragments of the same size in both the species, which indicates the presence of conserved regions, sharing ancestral relationship. Some of the fragments were unique in both the species which may be used for diagnostic purposes. The study concludes that the RAPD-PCR technique is useful for the study of molecular taxonomy in insects.
Key words: RAPD, PCR, cockroach, random primers, genetic differentiation.
1. Introduction available cockroaches have been considered.
The RAPD-PCR technique has been used The distribution of insect is universal. Some of the successfully to detect genetic polymorphism in plants species are easy to identify and categorize but for [2, 3] for identification of barley genome segment some other species it is a thorny task, due to their introgressed into wheat [4] and animals [5]. RAPD small size. The authors do identify insect species by markers have been used to identify subspecies and their morphology, but there can be some small populations of Aedes aegypti [6], to differentiate invisible changes in their morphological closely related species and conspecific population of characteristics and distribution due to environmental genus Aedes [7] and to distinguish cryptic mosquito effects. To solve these obstructions, the molecular species [8, 9], identification of sand-fly species [10], techniques such as polymerase chain reaction (PCR), differentiate strains of Mediterranean fruitfly Ceratitis restriction fragment length polymorphism (RFLP), capitata [11] and to determine the origin of Israeli random amplified polymorphic DNA (RAPD) and population of Matsucoccus josephi [12]. arbitrary fragment length polymorphism (AFLP) are Little information is available on genetic variation applied [1]. During the present investigation locally within and between populations of cockroaches [13].
They are a cosmopolitan pest species that is obligatory Corresponding author: Subodh Kumar Jain, Ph.D.,
associate professor, research field: cell and molecular biology. commensal with human habitations. Among the E-mail: subjain@gmail.com.
RAPD-PCR Based Marker Approach for the Genetic Differentiation
of Two Species of Cockroach (Order-Dictyoptera)
best-known pest species are the American cockroach tubes for 20-25 times. Spin it down for 10 min at Periplaneta americana and the German cockroach
8,000 rpm. Transfer the supernatant phase in another Blatella germanicana belonging to the same order
fresh tube. To supernatant add equal amount of Dictyoptera share many common features like chloroform + IAA (1:1), i.e., 250 μL each. Mix it morphology, inheritance of similar habitat and gently for 10 min; transfer the supernatant phase in nocturnal habit. Moreover they exhibit similar another fresh tube. Add 1/10 3M Sodium acetate (50 emergent behavior towards food and feed. Thus
μL) and 0.8th volume of isopropanol, i.e., 400 μL. looking at above to overcome the difficulty to identify
Mix gently to allow DNA to clump. Spin it down for these two species on the basis of morphology,
10 min at 10,000 rpm at 4 °C. Discard supernatant, occurrence and behavior and feed biology, the
add 500 μL of 70% ethanol, keep it for 10 min and molecular approach is an appropriate option.
spin down at 12,000 rpm for 10 min at 4 °C. Discard Keeping in view the utility and significance of
supernatant and allow the pellet to dry at room RAPD-PCR technique in differentiating cell lines [14]
temperature at 37 °C under laminar hood. Resuspend as well as the advantage of studies done for
the pellet in 50 μL of TE. Dissolve the pellet in water identification of species on the basis of RAPD-PCR,
bath at 55 °C for overnight and store at 4 °C. The the present work emphasize on the RAPD-PCR
genomic DNA was checked on 0.8% agarose gel and marker approach for genetic differentiation of two
stored at -20 °C. The concentration of DNA was species of cockroach Blatella germanicana and
determined using UV spectrophotometer (Cole Parmer Periplanata americana.
Ins. Company, USA).
2.2 Random Amplified Polymorphic DNA Specimens of cockroach species were
2. Materials and Methods
The amplification reaction was carried out in a 50 morphologically identified and collected from leaking
µL reaction volume containing sterile water 39.0 µL, pipes under the sinks, toilets, shower stalls and dishes
10 × Taq Buffer A 5.0 µL, 10 mM dNTP mix 2.0 µL, from the dark areas of the university hostels, food
RAPD Primer 2.0 µL, DNA Template (10 ng/µL) 1.0 store-room and restaurant. Most of the collections
µL and Taq DNA Polymerase (3 U/µL) 1.0 µL. The were done at night usually between 7-8 p.m.
random sequence 10-mer primers were purchased from Genei, Bangalore (India). For each primer
2.1 Isolation of Genomic DNA examined, negative control was maintained which
Total cockroach DNA was isolated by contained all the components except the genomic phenol:chloroform:isoamylalcohol method. Adult DNA. The DNA was amplified in a PCR machine individuals were crushed using pestle mortal in 500
thermocycler (Techne, UK) using the programme for μL of lysis buffer. After adding 30 μL proteinase K,
initial denaturation: 94 °C for 5 min, followed by first incubated at 37 °C over night (see that the tissues get
loop of 10 cycles denaturation at 94 °C for 45 seconds, dissolved properly). Add equal amount of phenol:
annealing of primer at 35 °C for 1 min, and extending chloroform: isoamylalcohol (IAA)—25:24:1 and mix
primer at 72 °C for 1.5 min and in second loop, 40 it gently by inverting the tubes for 20-25 times. Spin it
cycles denaturation at 94 °C for 45 seconds, annealing down for 10 min at 8,000 rpm. Remove the
of primer at 37 °C for 45 seconds, and extending supernatant in another fresh tube. Add equal amount
primer at 72 °C for 1 min and final extension at 72 °C (500 μL) of phenol: chloroform: isoamylalcohol in
for 10 min. The amplified products were separated supernatant phase and mix gently by inverting the
according to molecular size on 2% agarose gels in TE
RAPD-PCR Based Marker Approach for the Genetic Differentiation
of Two Species of Cockroach (Order-Dictyoptera)
buffer and detected by staining with ethidium bromide. suggesting that the amplified fragments repeated in Gels were photographed on Gel Documentation
the genome in varying degrees (Figs. 1-3). For the system (MultiDoc-lt, Labmate). Six oligonucleotide
analysis and com parison of these patterns, a set of primers were selected for study P1 (GATGACCGCC),
distinct and well separated bands were selected while P3 (GGCACGTAAC), P6 (GGTGCGCCTT), P7
neglecting the weak and unresolved bands were not (GTCAGAGTCG), P8 (GTCGCCGTCT) and P10
considered. As a result of initial RAPD analysis of (GTGCCCGATG).
pooled DNA, six primers were chosen for further analysis, on the basis of the criteria of band pattern
3. Results and Discussion
quality, reproducibility and the presence of the The genomic DNA of two species of cockroach
diagnostic bands. These primers were then applied to Periplanata americana and Blatella germanicana
study the suborder of the two species of the (order-Dictyoptera) have been subjected to cockroaches. RAPD-PCR analysis with six decamer
It is noted that white arrows represent base pair oligonucleotide primers (P1, P3, P6, P7, P8 and P10).
length of species specific bands. The bands grouped RAPD patterns were visually analyzed and scored
under “c” are an example of a complex pattern for from photographs. All the primers produced a large
which homologous bands can not be reliably be number of discrete bands with different intensity
assigned in the two species (primer P1).
b 1000 c
Fig. 1 RAPD banding pattern amplified by primer P1 and P3. Lane L: 100 bp DNA ladder. Lane 2 and 3: Periplanata americana ♂ and ♀. Lane 5 and 6: Blatella germanicana ♂ and ♀.
Fig. 2 RAPD banding pattern amplified by primer P6 and P7. Lane L: 100 bp DNA ladder. Lane 1 and 2: Periplanata americana ♂ and ♀. Lane 3 and 4: Blatella germanicana ♂ and ♀. White arrows represent base pair lengths of species specific bands.
RAPD-PCR Based Marker Approach for the Genetic Differentiation
of Two Species of Cockroach (Order-Dictyoptera)
Fig. 3 RAPD banding pattern amplified by primer P8 and P10. Lane L:100 bp DNA ladder. Lane 1 and 2: Periplanata americana ♂and ♀. Lane 4 and 5: Blatella germanicana ♂and ♀. White arrows represent base pair lengths of species specific bands.
Table 1 RAPD analysis with six arbitrary primers to differentiate Periplanata americana and Blatella germanicana.
Total number of bands
Number of selected species-specific RAPD fragments
Primer Nucleotide sequence Size range of (5’ to 3’)
amplified bands (~) P.a
♂ ♀ P1 GATGACCGCC 430-> 1000 5 5 5 5 1 1 1 1 P3 GGCACGTAAC 500-> 1000 3 3 3 3 2 2 2 2 P6 GGTGCGCCTT 300-900
43443311 P7 GTCAGAGTCG 350-900
33331122 P8 GTCGCCGTCT 550-1000
3333- - 22 P10 GTGCCCGATG 550-800
11111111 P.a: Periplanata Americana; B.g: Blatella germanicana.
RAPD analysis has to become a valuable tool for sufficient amount of relatedness and variations in the analysis of genetic variation, estimating genetic
these two species. Primer P1 amplified some common distance among populations and generating molecular
bands of the same molecular weight in the species, markers for economic traits. The varietal-specific
indicating their ancestral relationship. Many bands amplification of distinct bands, permit their use in
amplified primers were unique to the individuals of genetic fingerprinting. RAPD therefore, appears to be
both the species which could be used to generate their useful in differentiating species, subspecies and strains
genetic marker profiles. Primer P10 produced single of different insects [1, 15].
bands but of different sizes in the individuals of both RAPD-PCR technique is cost effective, take less
the species suggesting the presence of intraspecific time, the results can be directly inferred from the gel
genetic variation. Primer P8 did not amplify the and it reveals large amount of genetic variations,
genomic DNA of the individuals of P. americana but therefore it finds various entomological applications
reveal good banding pattern with B. germanicana thus [16-18].
primer P8 can be treated as clear genetic marker for B. Six decanucleotide primers were used to amplify
germanicana species. Primer P6 produced an the genomic DNA from the adult individuals of both
additional band d (500 bp) in case of P. americana but the species. A series of bands ranging from 300 bp
not in P. americana female as well as other species. to > 1,000 bp were produced by these primers (Table
Therefore this specific band may be considered as sex 1). The results obtained with these primers revealed
specific for P. americana. Primer P3 and P7 produced
RAPD-PCR Based Marker Approach for the Genetic Differentiation
of Two Species of Cockroach (Order-Dictyoptera)
a number of distinct ban pattern which may be Theobroma cacao, L.J. Am. Soc. Hort. Sci. 120 (1995) 681-686.
considered as species-specific precise diagnostic [3] R.J. Schnell, C.M. Ronning, R.J. Knight, Identification of marker for Periplanata americana and Blatella
cultivators and validation of genetic relationships in germanicana.
Mangifera indica using RAPD markers, Theor. Appl. The number and size of amplified products varied
Genet. 90 (1995) 269-274. [4] J.D. Shermon, L.Y. Smith, T.K. Black, L.E. Talbert,
depending upon the sequence of random primers and Identification of barley genome segments introgressed
genotypes used; a total of 75 discrete amplified into wheat using PCR markers, Genome 44 (2001) 38-44. products were obtained out which 34 products
E.A. Rose, Applications of the polymerase chain reaction exhibited diagnostic as well as species-specific pattern.
to genome analysis, FASEBJ 5 (1991) 46-54. [6] M.E. Ballinger-Crabtree, W.C. Black, B.R. Miller, Use
On an average 12.5 bands per primer were scored. of genetic polymorphism detected by the random
RAPD-PCR technique is extremely useful for rapid amplified polymorphic DNA polymerase chain reaction identification of genetic polymorphisms in
(RAPD-PCR) for differentiation and identification of Dictyoptera because of the reproducibility of the Aedes aegypti subspecies and populations, Am. J. Trop.
Med. Hyg. 47 (1992) 893-901.
results for each of the species. Four primers out of six [7] S. Kambhampati, W.C. Black, K.S. Rai, Randomly primers generated clear genetic markers for the
amplified polymorphic dna of mosquito species and genomic DNA of both species.
populations (Diptera: Culicidae): Techniques, statistical analysis and application, J. Med. Entomol. 29 (6)
RAPD differences have been found between
(1992) 939-945.
geographically isolated populations of other insects [8] R.C. Wilkerson, T.J. Parsons, D.G. Albright, T.A. Klein, including Parasitoid wasps [19] and Argentine stem
K.J. Braun, Random amplified polymorphic DNA weevil [20]. (RAPD) markers readily distinguish Cryptic mosquito species (Diptera:Culicidae:Anopheles), Insect. Mol. Biol.
RAPD can find wide use in their identification and
1 (4) (1993) 205-211.
differentiation of closely related species and [9] R.C. Wilkerson, T.J. Parsons, T.A. Klein, T.V. Gaffigan, populations within species [21, 22]. Genetic
E. Bergo, J. Consolim, Diagnosis by random amplified polymorphism revealed is of great importance in polymorphic DNA polymerase chain reaction of four cryptic species related to Anopheles allitarsis (Diptera:
species diagnostics [23-27] as the pattern of bands Culicidae) from Paraguay, Argentina and Brazil, J. Med. revealed by RAPD-PCR are often species specific.
Entomol. 32 (1995) 697-704. [10] R.E. Adamson, R.D. Ward, M.D. Feliciangeli, R.
4. Conclusion
Malignon, The application of random amplified polymorphic DNA for Sandfly species identification,
The diverse nature of bands indicates the genetic Med. Vet. Entomology 7 (1993) 203-207. distance while the presence of common bands
[11] D.S. Haymer, D.O. Mc Innis, Resolution of population of indicates evolutionary relationship between both the the Mediterranean fruit fly at the DNA level using random primers for the polymerase chain reaction,
species. It is also concluded that some of the
Genome 37 (2) (1994) 244-248.
fragments are unique in both the species which might [12] Z. Mendel, D. Nestel, R. Gafny, Examination of the
be used for diagnostic purposes according the origin of the Israeli population of Matsucoccus josephi (Homoptera: Matsucoccidae) using random amplified
RAPD-PCR analysis. polymorphic DNA-polymerase chain reaction method,
References Ann. Entomol. Soc. Am. 87 (1994) 165-169.
[13] W. Booth, S.M. Bogdanowicz, P.A. Prodohl, R.G. [1] S.K. Jain, B. Neekhra, D. Pandey, K. Jain, RAPD marker
Harrison, C. Schal, E.L. Vargo, Identification and system in insect study: A review, Indian Journal of
characterization of 10 polymorphic microsatellite loci in Biotechnology 9 (2010) 7-12.
the German cockroach, Blatella germanicana, Mole. Eco. [2] C.M. Ronning, R.J. Schnell, D.N. Kuhn, Inheritance of
Not. 7 (2007) 648-650.
random amplified polymorphic DNA markers in
X. Lery, B. La Rue, J. Cossette, G. Charpentier,
RAPD-PCR Based Marker Approach for the Genetic Differentiation
1333
of Two Species of Cockroach (Order-Dictyoptera)
Characterization and authentication of insect cell lines Random amplified polymorphic DNA (RAPD) analysis using RAPD markers, Insect Biochem. Mol. 33 (10)
of Drosophila simulans in the mainland of China, Yi (2003) 1035-1041.
Chuan Xue Bao 30 (7) (2003) 673-680. [15] G.M. Nagaraja, J. Nagaraju, Genomic fingerprinting in
X. Zhou, O. Faktor, S.W. Applebaum, M. Coll, silkworm, Bombyx mori using random arbitrary primers,
[22]
Population structure of the pestiferous moth Helicoverpa Electrophoresis 16 (1995) 1633-1638.
armigera in the Eastern Mediterranean using RAPD [16] G.J. Hunt, R.E.JR. Page, Patterns of inheritance with
analysis, Heredity 85 (2000) 251-256. RAPD molecular markers reveal novel types of
[23] C.S. Babcock, J.M. Heraty, Molecular markers polymorphism in the honey bee, Theo. Appl. Genetics 85
distinguishing Encarsia formosa and Encarsia luteola (1992) 15-20.
(Hymenoptera: Aphelinidae), Ann. Entomol. Soc. Am. 93 [17]
D.G. Heckel, L.J. Gahan, B.E. Tabashnik, M.W. Johnson,
(2000) 738-744.
Randomly amplified polymorphic DNA differences [24] V.N. Pozdnyakov, V.T. Kapakov, A.B. Abramova, A.V. between strains of Diamondback Moth (Lepidoptera:
Borodachev, N.I. Krivtsov, Random amplified Plutellidae) susceptible or resistant to Bacillus
polymorphic DNA (RAPD) markers of three breeds of thuringiensis, Ann. Entomol. Soc. Am. 88 (4) (1995)
honey bee Apis mellifera, Dokl. Biol. Sci. 372 (1-6) 531-537.
(2000) 309-311.
[18] A.K. Dowdy, W.H. McCaughey, Using random amplified [25] V.L. Sharma, M. Kumari, T.K. Gill, S. Sharma, H.A. polymorphic DNA to differentiate strains of the Indian
Badran, R.C. Sobti, RAPD-PCR in two species of meal moth (Lepidoptera: Pyralidae), Enviro. Entomo. 25
Catopsilia (Pieridae: Lepidoptera), Caryologia 56 (2) (1996) 396-400.
(2003) 219-222.
[19] O.R. Edwards, M.A. Hoy, Polymorphism in two [26] V.L. Sharma, R.C. Sobti, T.K. Gill, S. Kumari, A.L. parasitoids detected using random amplified polymorphic
Badran, M. Kumari, Molecular studies of five species of DNA polymerase chain reaction, Biological Control. 3 (4)
butterflies (Lepidoptera: Insecta) through RAPD-PCR (1993) 243-257.
technique, Caryologia 59 (3) (2006) 226-234. [20] C.L. Williams, S.L. Goldson, D.B. Baird, D.W. Bullock,
H. Tiple, S.V. Padwad, V.P. Deshmukh, Molecular Geographical origin of an introduced insect pest,
[27]
characterization of morphologically similar four pieridae Listronotus bonariensis (Kuschel), determined by RAPD
butterflies (Lepidoptera: Insecta) by RAPD-PCR analysis, Heredity 72 (1994) 412-419.
technique, International Journal of Pharma and Bio [21] S.H. Xu, Q.T. Zeng, Y.H. Qian, S.T. Li, Y. Yang,
Sciences 1 (2) (2010) 1-7.
Journal of Life Sciences 6 (2012) 1334-1342
The Determination of Geographical Origin of Foodstuffs
by Using Innovative Biological Bar-Code
Aly El Sheikha 3 and Didier Montet 1. Department of Food Science and Technology, Minufiya University, Shibin El Kom 32511, Egypt
2. Halal Products Research Institute (HPRI), Putra University of Malaysia (UPM), Serdang 43400, Selangor Darul Ehsan, Malaysia 3. UMR Qualisud, Center of International Cooperation in Agronomic Research for Development (CIRAD), Montpellier Cedex 5
34398, France
Received: April 06, 2010 / Accepted: May 30, 2012 / Published: December 30, 2012.
Abstract: One of the great concerns of the customers is the traceability of the products. The authors proposed to link microbial ecology to geographical origin of foodstuffs by a molecular technique joined to an image analysis. Molecular techniques employing 16S and 28S rDNA profiles generated by PCR-DGGE were used to detect the variation in microbial community (bacteria, fungi) of Pangasius fish from Viet Nam harvested in different aquaculture farms and during different seasons and Shea tree fruits from five different districts in Mali. The bacterial DNA profiles from Pangasius fish and the fungal DNA profile from Shea tree fruits were specific to each place of production and could be used as a biological bar code certifying the origin of fish and fruit. To follow the product during processing, the authors proposed to identify and validate some pertinent biological markers which come from the environment of the food to assure their traceability during international trade. It is new analytical method which permits to determine the origin of food or to follow them during international trade.
Key words: Geographical origin, foodstuff, PCR-DGGE, microbial community, DNA profile, biological bar-code.
1. Introduction methods allow us to ensure the determination of origin (bar codes, spectrophotometers, stable isotope of
Regulations across Europe continue to be tightened
strontium, etc.) [2].
in order to provide a greater degree of insurance in In case of fish, the predominant bacterial flora quality and safety. Meanwhile, the traceability and would permit the determination of the capture area, labeling of imported products in European countries production process or hygienic conditions during post remains a compulsory issue (UE regulation 178/2002). harvest operations [3-7]. Aquatic microorganisms are The need for vigilance and strict monitoring is known to be closely associated with the physiological necessary. One of the great concerns of the customers status of fish [4-10]. The water composition, is the traceability of the products. Traceability is the temperature and weather conditions can influence the capacity to find the history, use or origin of a food by bacterial communities [11, 12]. Commonly known as registered methods [1]. Currently, there are no the Shea tree (le karate in French), Vitellaria existing analytical methods which permit to determine paradoxa , is one of the most economically and the origin of food or to follow them during socially important tree species in the international trade. The most popular analytical Saudano-Sahelian region [13, 14]. In Mali, Shea tree
Corresponding author: Aly El Sheikha, Ph.D., lecturer, cover more than 20 million hectare [15]. According to research fields: biotechnology, microbiology, molecular
the Malian Ministry of Agriculture, Mali has the biology, food safety, traceability and food science & technology. E-mail: elsheikha_aly@yahoo.com.
highest number of Shea trees in Africa of more than
1335 408 million. The potrnial of production of fresh fruit
The Determination of Geographical Origin of Foodstuffs by Using Innovative Biological Bar-Code
maintained on ice and transported to the laboratory. is 1.53 million tons, yealiding 300,000 tons of dru
Then the skin, gills and intestines were aseptically almonds. Science 2000, the annual average export has
removed from each fish specimen and put in separate been estimated at 8,000 tons of nuts and less than 500
sealed plastic bags, then kept frozen at -20 °C until tons of Shea butter [16].
analysis.
Several batches of fruits of various species or
2.2 Fruits Sampling
various cultures could be mixed. It is thus very difficult to check their exact geographical origin. In
Mature fruits of Shea tree (V. paradoxa) were case of doubt or fraud, it is necessary to find a precise
collected in five different districts from Mali. These and fast analytical technique in order to determine
districts were Nafégué, Mperesso, Daelan, Tori and their geographical origin [2]. Our tool will permit to
Sassamburu. The fruits were gathered to preserve their give reliable results with very short times in adequacy
initial flora. They were collected directly on the tree with the speed of trade concerning these products. The
using gloves and put in sterile bags in July 2008. idea was to create a “biological bar code” [3] based on
These bags were kept into a refrigerator then the analysis of DNA of microorganisms present on the
transferred by plane to CIRAD Montpellier (France) products. This method is based on the assumption that
where the fungal DNA was extracted immediately the microbial communities of the fruits are specific
from the fresh fruits. The origin of the samples was from a geographical area [17-21].
defined by country, site and date of harvest. The purpose of our study is to apply the
PCR-DGGE method to analyze the microorganisms in
2.3 DNA Extraction from Bacteria
food in order to create an analytical technique to link DNA extraction from bacteria was based on the microbial communities to the geographical origin and
methods of Ampe et al. [22] and Leesing [4] but avoid the individual analysis of each microbial strain.
modified and optimized. Around 2 g each of gills, skin The acquired band patterns for the microbial species
and intestine were homogenized by vortex for 3 min of different fish (bacteria) or fruits (mould) were
after addition of 6 mL sterile peptone water (pH 7.0, compared and analyzed statistically to determine their
Dickinson, France). Four 1.5 mL tubes containing geographical origin.
each samples were then centrifuged at 10,000× g for
2. Materials and Methods
10 min. 100 µL of lysis buffer TE (10 mM Tris; 1 mM EDTA; pH 8.0, Promega, France) and 100 µL of
2.1 Fish Sampling lysozyme solution (25 µg/L, Eurobio, France) and 50
The Pangasius fish samples Pangasius µL of proteinase K solution (10 µg/L, Eurobio) were hypophthalmus were collected in a unique pond in
added to each pellet. Samples were vortexed for 5 min five aquaculture farms of five different districts from
and incubated at 42 °C for 20 min. Then 50 µL of the south Viet Nam namely Chau Phu, An Phu, Phu
20% SDS (Sigma) were added to each tube and were Tan, Chau Doc, and Tan Chau of An Giang province.
incubated at 42 °C for 10 min. 300 µL of MATAB This province supplies about 2/3 (about 80,000 MT in
(Sigma) were added and the tubes were incubated at 2005) of Pangasius fish for export. The samples were
65 °C for 10 min. The lysates were then purified by collected in two seasons in Viet Nam: the rainy season
repeated extraction with 700 µL of (October 2005) and the dry season (February 2006).
phenol/chloroform/isoamyl alcohol (25/24/1, Carlo The samples were taken from the same pond and
Erba), and the residual phenol was removed by aseptically transferred to storage bags, then extraction with an equal volume of
The Determination of Geographical Origin of Foodstuffs by Using Innovative Biological Bar-Code
chloroform/isoamyl alcohol (24/1). The DNA was at 12,000× g for 15 min. The ethanol was then precipitated with isopropanol, washed with 70%
discarded and the pellets were air dried at room ethanol and then air dried at room temperature for 2 h.
temperature for 45-60 min. Finally, the DNA was Finally, the DNA was resuspended in 50 µL of ultra
resuspended in 50 µL of ultra pure water and stored at pure water and stored at -20 °C until analysis.
-20 °C until analysis.
2.4 DNA Extraction from Mould
2.5 PCR-Denaturing Gradient Gel Electrophoresis (DGGE) Analysis
For mould DNA extraction, the authors applied the new protocols which were suggested by El Sheikha et
For bacteria: The V3 variable region of bacterial al. [20]. Briefly, two fruits of Shea tree were put in
16S rDNA from fish was amplified using primers sterile Stomacher bag containing 6 mL peptone water
gc-338f (5’-CGC CCG CCG CGC GCG GCG GGC then crushed by hands. The two Eppendorff 2 mL
GGG GCG GGG GCA CGG GGG GAC TCC TAC vials containing the resulting suspension were GGG AGG CAG CAG-3’, Sigma) and 518r (5’-ATT centrifuged at 12,000× g for 15 min and the
ACC GCG GCT GCT GG-3’, Sigma) [4, 22, 23]. A supernatant discarded. The cell pellet was resuspended
40-bp GC-clamp (Sigma) was added to the forward in 300 µL of breaking buffer [2% Triton X-100
primer in order to insure that the fragment of DNA (Prolabo, France)/1% SDS (Sigma)/100 mM NaCl/10
will remain partially double stranded and that the mM Tris pH 8.0/1 mM EDTA pH 8.0]. 100 µL TE (10
region screened is in the lowest melting domain [24]. mM Tris-HCl; 1 mM EDTA; pH 8.0) and 100 µL of
Each mixture (final volume 50 µL) contained about lysozyme solution (25 mg/mL) and 100 µL of
100 ng of template DNA, all the primers at 0.2 µM, all proteinase K solution (20 mg/mL) were added and the
the deoxyribonucleotide triphosphate (dNTPs) at mixture was incubated at 42 °C for 20 min. Then 50
200 µM, 1.5 mM MgCl 2 , 5µL 10× of reaction Taq µL of 20% SDS were added to each tube, then
buffer MgCl 2 free and 5 U of Taq polymerase incubated at 42 °C for 10 min. 400 µL of MATAB
(Promega). In order to increase the specificity of were added to each tube, then incubated at 65 °C for
amplification and to reduce the formation of spurious
10 min. The tubes were vortexed vigorously for 5 min. by-products, a “touchdown” PCR was performed The lysates were then purified twice by repeated
according to the protocol of Díez et al. [25]. An initial extraction with 700 µL of phenol/chloroform/isoamyl
denaturation at 94 °C for 1 min and 10 touchdown alcohol (25/24/1) and the tubes were vortexed for 5
cycles of denaturation at 94 °C for 1 min, then min and then centrifuged 15 min at 12,000× g. The
annealing at 65 °C (with the temperature aqueous layer was transferred to an Eppendorff vial
decreasing 1 °C per cycle) for 1 min, and extension at and the residual phenol was removed by extraction
72 °C for 3 min, followed by 20 cycles of 94 °C for 1 with 600 µL of chloroform/isoamyl alcohol (24/1) and
min, 55 °C for 1 min and 72 °C for 3 min. During the centrifuged 15 min at 12,000× g. The aqueous phase
last cycle, the extension step was increased to 10 min. was collected and the DNA was stabilized with 30 µL
For mould: A fragment of region of the 28S rDNA of sodium acetate (3 M, pH 5), followed by
gene was amplified using eukaryotic universal primers precipitation by adding equal volume of ice-cold
U1 (5’- CGC CCG CCG CGC GCG GCG GGC GGG isopropanol and stored at -20 °C for 12 h (overnight).
GCG GGG GTG AAA TTG TTG AAA GGG AA-3’, After centrifugation at 12,000× g for 15 min, the
Sigma) and the reverse primer U2 (5’-GAC TCC TTG supernatant was eliminated, DNA pellets were washed
GTC CGT GTT-3’, Sigma) amplifying an with 500 µL 70% ethanol, and tubes were centrifuged
approximately 260 bp fragment [20, 26, 27]. A 30-bp
1337 GC-clamp (Sigma) was added to the forward primer
The Determination of Geographical Origin of Foodstuffs by Using Innovative Biological Bar-Code
(Amesham Biosciences, USA). Banding patterns were (the GC-clamp is underlined). PCR was performed in
standardized with two reference fragments of DNA
a final volume of 50 µL containing 2.5 µL DMSO, included in all gels, which are the patterns of
0.4 µM each primers, all the deoxyribonucleotide Escherichia coli DNA and Lactobacillus plantarum
triphosphate (dNTPs) at 200 µM, 3 mM MgCl 2 , 5 µL
DNA for bacteria and Mucor racemosus DNA and
of 10× of reaction Taq buffer MgCl 2 free (Promega),
Trichoderma harzianum DNA for mould. This
1.25 U of Taq DNA polymerase (Promega), and 2 µL software permitted to identify the bands relative of the extracted DNA. The amplification was carried
positions compared with the standard patterns. out as follows: An initial denaturation at 94 °C for
In DGGE analysis, the generated banding pattern is
3 min, 30 cycles of 94 °C for 45 s, 50 °C for 50 s and considered as an image of all of the major bacteria or
72 °C for 90 s, and a final extension at 72 °C for 5 min mould in the populations. An individual discrete band [20]. Aliquots (5 µL) of PCR products were analyzed
refers to a unique ‘‘sequence type’’ or phylotype [28, first by conventional electrophoresis in 2% (w/v)
29]. This was confirmed by Kowalchuk et al. [30] who agarose gel with TAE 1× buffer (40 mM Tris-HCl pH
showed that co-migrating bands generally corresponded
to identical sequence. The DGGE fingerprints were stained with ethidium bromide 50 µg/mL in TAE 1×
7.4, 20 mM sodium acetate, 1.0 mM Na 2 -EDTA),
manually scored by the presence and absence of and quantified by using a standard (DNA mass ladder
co-migrating bands, independent of intensity. Pair wise 100 bp, Promega).
community similarities were quantified using the Dice The PCR products were analyzed by DGGE using a
similarity coefficient (S D ) [31]:
Bio-Rad DcodeTM universal mutation detection S D =2N c /N a + N b (1) system (Bio-Rad Laboratories, USA) using the where N a represented the number of bands detected
procedure first described by El Sheikha et al. [20]. in the sample A, N b represented the number of bands Samples containing approximately equal amounts of
in the sample B, and N c represented the numbers of PCR amplicons were loaded into 8% (w/v) bands common to both sample. Similarity index were polyacrylamide gels (acrylamide/N,N’-methylene
expressed within a range of 0 (completely dissimilar) bisacrylamide, 37.5/1, Promega) in TAE 1× buffer (40
to 100 (perfect similarity). Dendograms were mM Tris-HCl pH 7.4, 20 mM sodium acetate, 1.0 mM
constructed using the Statistica version 6 software Na 2 -EDTA).
(StatSoft, France). Similarities in community All electrophoresis experiments were performed at
structure were determined using the cluster analysis
60 °C using a denaturing gradient ranging from 40% by the single linkage method with the Euclidean to 70% (100% corresponded to 7 M urea and
distance measure. Significant differences of bacterial 40% [v/v] formamide, Promega). The gels were
communities of fish between seasons were electrophoresed at 20 V for 10 min and then at 80 V
determined by factorial correspondence analysis for 12 h. After electrophoresis, the gels were stained using the first 2 variances which described most of for 30 min with ethidium bromide and rinsed for
the variation in the data set.
20 min in distilled water and then photographed on a UV transilluminator with the Gel Smart 7.3 system
3. Results
(Clara Vision, Les Ulis, France).
3.1 DGGE Pattern of Bacterial DNA from Fish within
2.6 Image and Statistical Analysis
the Same Sampling Period
Individual lanes of the gel images were straightened The PCR-DGGE patterns of five replicates for each and aligned using Image Quant TL software v.2003
location revealed the presence of 8-12 bands of
The Determination of Geographical Origin of Foodstuffs by Using Innovative Biological Bar-Code
bacteria in the fish (Fig. 1). Some of the bands are patterns for the five replicates of fish samples from common to all the different regions. The bacterial
two different districts of An Giang province harvested communities for five replicates of the same pond of
in the rainy and dry seasons at six months difference one farm in each district were totally similar among
showed 84.4% for the first two variances in between the same season. High similarities were also observed
the bacterial communities (Fig. 2). Two different on bacteria patterns for the samples from the same
groups were clearly noted for the two different districts. The statistical analysis of the DGGE gel
locations and the two seasons of harvest.
li
li li li
lantarum . co
E L .p AP1-R AP2-R AP3-R
AP4-R AP5-R AP1-D AP2-D AP3-D AP4-D AP5-D E L .p
. co
E L CP1-R CP2-R CP3-R CP4-R CP5-R CP1-D CP2-D CP3-D CP4-D CP5-D
(a) (b)
Fig. 1 PCR-DGGE 16S rDNA banding profiles of fish bacteria from two different districts of An Giang province (five fish from the same pond in the same farm in each district), of Viet Nam in rainy season (R) and dry season (D). (a) CP: Chau Phu district; (b) AP:
An Phu district; 1 -5: replicate of fish.
Fig. 2 Factorial variance analysis of 16S rDNA banding profiles for fish bacterial communities from two different districts of An Giang province of Viet Nam in rainy season (R) and dry season (D). CP: Chau Phu district; AP: An Phu district.
The Determination of Geographical Origin of Foodstuffs by Using Innovative Biological Bar-Code
3.2 DGGE Pattern of Fungal DNA from Shea Tree and revealed the presence of four to 13 bands for each Fruit from Five Different Districts from Mali
Shea tree fruit (Fig. 3).
Clusters analysis by Statistica software of the On DGGE gel, the observed bands had sufficient
intensities to analyze samples of fungal DNA DGGE gel patterns for the duplicate Shea tree fruit extracted from Shea tree fruits from three various
samples from five different districts showed a geographical areas (Fig. 1), so the total quantity of
community similarity among the geographical DNA deposited in the wells of DGGE gel was
locations where the fruit samples were collected (Fig. sufficient to consider that fungal DNA could be used
4). At 52% similarity level, two main clusters were as potential markers. The reference DNA of Mucor
observed: the first cluster included the samples from
Sassamburu, Tori and Nafégué and the second cluster DGGE was perfectly done. Each vertical line comprised the samples from Mperesso and Daelan. represents a fruit and each spot represents a species of
racemosus and Trichoderma harzianum indicates that
Doubling one sample never involved changes in the fungi. Some spots appeared double or smear because
constitution of the two established classes (100% of the presence of single-strand DNA (ssDNA) [32].
stability). This organization in two classes thus The duplicate of PCR-DGGE patterns of Shea tree
represents a strong structuring of the data. The fruits for each location were similar for each country
cluster analysis also showed different similarities levels
Sassamburu num mosus
Mperesso
Daelan
Nafégué
Tori
ia
a rz race
Fig. 3 PCR-DGGE 28S rDNA band profiles of Shea tree fruit from five different districts from Mali. MP: Mperesso; DA: Daelan; PV: Nafégué; T: Tori; S: Sassamburu. (a, b) Two different locations.
The Determination of Geographical Origin of Foodstuffs by Using Innovative Biological Bar-Code
Fig. 4 Cluster analysis of 28S rDNA band profiles of Shea tree fruit from five different districts from Mali. MP: Mperesso; DA: Daelan; PV: Nafégué; T: Tori; S: Sassamburu. (a, b) Two different locations.
between the different districts. For example, there was the pollution from urban life. Furthermore, the 72% similarity between Sassamburu and Tori.
antibiotics needed to cure diseases and stress factors could also affect the microbial communities of the fish
4. Discussion
[34]. However, some common bands obtained by Analysis of bacterial communities in fish samples
DGGE have been found in all the profiles within the has been often investigated using culture dependent
same sampling periods and origin. The authors could methods and culture-independent methods by random
conclude that there were enough differences in the amplified polymorphic DNA (RAPD) [4]. There are
water quality and the environment of the fish to obtain only a few published works that analyzed the bacterial
a major effect on the bacterial ecology. communities in fish samples by PCR-DGGE [4, 33].
For Shea tree fruits, the DGGE gel showed some Just the publications published by our team
significant differences in the migration patterns. described the linkage between the mould communities
However, the duplicates for each sampling location and the geographical origin of fruits by El Sheikha
gave statistically similar DGGE patterns throughout and Montet [19] and El Sheikha et al. [20, 21].
the study. The authors demonstrated that there was a The authors found that the band pattern of the
link between the mould populations and the bacterial and fungal communities isolated from fish
geographical area.
and Shea tree fruits obtained by PCR-DGGE were
5. Conclusion
strongly linked to the microbial environment of the fish and fruits.
In conclusion, the PCR-DGGE analysis of bacterial The fish skin is in direct contact with the water as
and mould communities suggests that this technique well as the gills that filter the air from water and the
could be applied to differentiate geographical location. intestine. The analysis of fish samples from different
The authors showed that the biological markers for the locations within the same period (rainy season)
specific locations were sufficient statistically to showed some significant differences in the migration
discriminate regions. This method can thus be patterns on DGGE. The five replicates for each
proposed as a rapid analytical traceability tool for fish sampling location had statistically similar DGGE
and fruits.
patterns throughout the study. The differences in the
References
band profiles can be attributed to the differences of the feeding methods in between farms and the type of [1] ISO, International Organization for Standardization,
Quality management systems, Traceability in the feed and aquaculture system applied. The variations may be
food chain—general principles and basic requirements for also due to the water supply which can be affected by
system design and implementation [online],
1341 http://webstore.ansi.org/RecordDetail.aspx?sku=ISO%20
The Determination of Geographical Origin of Foodstuffs by Using Innovative Biological Bar-Code
Monograph, School of Agricultural and Forest Sciences 22005:2007.
Publication Number: 8, University of Wales, Bangor, 1996, [2] B. Peres, N. Barlet, G. Loiseau, D. Montet, Review of the
p. 105.
current methods of analytical traceability allowing [14] J.M. Boffa, G. Yameogo, P. Nikiema, J.B. Taonda, Shea determination of the origin of foodstuffs, Food Control 18
Nut (Vitellaria paradoxa) Production and Collection in (3) (2007) 228-235.
Agroforestry Parklands of Burkina Faso, Department of [3] D. Montet, R. Leesing, F. Gemrot, G. Loiseau,
Forestry and Natural Resources, Purdue University, West Development of an efficient method for bacterial diversity
Lafayette, IN 47907-1200, 2000, p. 13. analysis: Denaturing gradient gel electrophoresis (DGGE),
[15] Y. Nouvellet, A. Kassambara, F. Besse, Le parc à karités in: Seminar on Food Safety and International Trade,
au Mali: inventaire, volume, houppier et production Bangkok, Thailand, 2004.
fruitière, Bois et Forêts des Tropiques 287 (1) (2006) 5-20. [4] R. Leesing, Identification and validation of specific
(in French)
markers for traceability of aquaculture fish for [16] E.G. Bonkoungou, D.Y. Alexandre, E.T. Ayuk, D. import/export, Ph.D. Thesis, University of Montpellier Ⅱ,
Depommier, P. Morant, J.M. Ouadba, Agroforestry 2005.
parklands of the West African semi-arid lands, in: [5] D.D. Le Nguyen, H.H. Ngoc, D. Dijoux, G. Loiseau, D.
Conclusions and Recommendations of an International Montet, Determination of fish origin by using 16S rDNA
Symposium, ICRAF/SALWA, Ouagadougou, 1994, p. 18. fingerprinting of bacterial communities by PCR-DGGE:
[17] D. Montet, A.F. El Sheikha, D.D. Le Nguyen, A. Condur, I. An application on Pangasius fish from Vietnam, Food
Métayer, G. Loiseau, Déterminer l’origine des aliments Control 19 (5) 454-460.
grâce à la biologie moléculaire, L’exemple de la [6] D. Montet, D.D. Le Nguyen, A.F. El Sheikha, A. Condur, I.
PCR-DGGE, Biofutur 307 (2010) 36-38. (in French) Métayer, G. Loiseau, Application of PCR-DGGE in
[18] A.F. El Sheikha, Détermination de l’Origine determining food origin: Cases studies of fish and fruits,
Géographique des Fruits: Exemples du Karité et du Aspects of Applied Biology 87 (2008) 11-22.
Physalis par l’Utilisation d’Empreintes Génétiques sur la [7] D. Montet, D.D. Le Nguyen, C. Kouakou, Determination
Communauté Microbienne par PCR/DGGE, Sarrebruck: of fish origin by using 16S rDNA fingerprinting of
Éditions Universitaire Européennes, GmbH and Co. KG, microbial communities by PCR-DGGE: An application on
2011, p. 248. (in French)
fish from different tropical origins, in: Z.A. Muchlisin [19] A.F. El Sheikha, D. Montet, Determination of fruit origin (Ed.), Aquaculture, InTech, Rijeka, Croatia, 2012, Chapter
by using 28S rDNA fingerprinting of fungi communities 6, pp. 93-108.
by PCR-DGGE: An application to Physalis fruits from [8] L. Grisez, J. Reyniers, L. Verdonck, J. Swings, F. Ollevier,
Egypt, Uganda and Colombia, Fruits 66 (2) (2011) 79-89. Dominant intestinal microbiota of sea breeam and sea bass
[20] A.F. El Sheikha, I. Métayer, D. Montet, A biological larvae, from two hatcheries, during larval development,
bar-code for determining the geographical origin of fruit Aquaculture 155 (1-4) (1997) 387-399.
by using 28S rDNA fingerprinting of fungi communities [9] B. Spanggaard, I. Huber, T.J. Nielsen, T. Nielsen, K.
by PCR-DGGE: An application to physalis fruits from Appel, L. Gram, The microbiota of rainbow trout intestine:
Egypt, Food Biotechnology 25 (2) (2011) 115-129. A comparison of traditional and molecular identification,
[21] A.F. El Sheikha, J.M. Bouvet, D. Montet, Biological Aquaculture 182 (1-2) (2001) 1-15.
bar-code for the determination of geographical origin of [10] A.H. Al-Harbi, N. Uddin, Quantitative and qualitative
fruits by using 28S rDNA fingerprinting of fungal studies on bacterial flora of hybrid tilapia (Oreochromis
communities by PCR-DGGE: An application to Shea tree niloticus × O. aureus) cultured in earthen ponds in Saudi
fruits, Quality Assurance and Safety of Crops and Foods 3 Arabia, Aquaculture Research 34 (1) (2003) 43-48.
(1) (2011) 40-47.
[11] H.C. Wong, M.C. Chen, S.H. Liu, D.P. Liu, Incidence of [22] F. Ampe, N.B. Omar, C. Moizan, C. Wacher, J.P. Guyot, highly genetically diversified Vibrio parachaemolyticus in
Polyphasic study of the spatial distribution of seafood imported from Asian countries, International
microorganisms in Mexican pozol, fermented maize Journal of Food Microbiology 52 (3) (1999) 181-188.
dough, demonstrates the need for cultivation-independent [12] J.A. De Sousa, A.T. Silva-Sousa, Bacterial community
methods to investigate traditional fermentations, Applied associated with fish and water from Congohas River,
and Environmental Microbiology 65 (12) (1999) Sertaneja, Parana, Brasil, Brazilian Archives of Biology
5464-5473.
and Technology 44 (4) (2001) 373-381. [23] L. Øvreas, L. Forney, F.L. Dae, V. Torsvik, Distribution of [13] J.B. Hall, D.P. Aebischer, H.F. Tomlinson, E.
Bacterioplankton in Meromictic Lake Sælenvannet, as Osei-amaning, J.R. Hindle, Vitellaria Paradoxa: A
determined by denaturing gradient gel electrophoresis of
The Determination of Geographical Origin of Foodstuffs by Using Innovative Biological Bar-Code
PCR-amplified gene fragment coding for 16S rRNA, Gons, J. Ebert, H.J. Laanbroek, Changes in bacterial and Applied and Environmental Microbiology 63 (9) (1997)
eukaryotic community structure after mass lysis of 3367-3373.
filamentous cyanobacteria associated with viruses, [24] V.C. Sheffield, J.S. Beck, E.M. Stone, R.M. Myers,
Applied and Environmental Microbiology 65 (2) (1999) Attachment of a 40 bp G + C rich sequence (GC-clamp) to
795-801.
genomic DNA fragments by polymerase chain reaction [30] G.A. Kowalchuk, J.R. Stephen, W. De Boer, J.I. Prosser, results in improved detection of single-base changes,
T.M. Embley, J.W. Woldendorp, Analysis of Proceeding of the National Academy of Sciences of the
ammonia-oxidizing bacteria of the beta subdivision of the United States of American 86 (1989) 232-236.
class Proteobacteria in coastal sand dunes by denaturing [25] B. Díez, C. Pedrós-Alió, T.L. Marsh, R. Massana,
gradient gel electrophoresis and sequencing of PCR Application of denaturing gradient gel electrophoresis
amplified 16S ribosomal DNA fragments, Applied (DGGE) to study the diversity of marine picoeukaryotic
and Environmental Microbiology 63 (4) (1997) assemblage and comparison of DGGE with other
1489-1497.
molecular techniques, Applied and Environmental [31] M. Heyndrickx, L. Vauterin, P. Vandamme, K. Kersters, P. Microbiology 67 (7) (2001) 2942-2951.
De Vos, Applicability of combined amplified ribosomal [26] Z. Wu, X.R. Wang, G. Blomquist, Evaluation of PCR
DNA restriction analysis (ARDRA) patterns in bacterial primers and PCR conditions for specific detection of
phylogeny and taxonomy, Journal of Microbiological common airborne fungi, Journal of Environmental
Methods 26 (3) (1996) 247-259.
Monitoring 4 (3) (2002) 377-382. [32] A.M. Osborn, C.J. Smith, DNA fingerprinting of [27] X.Y. Li, H.W. Zhang, M.N. Wu, Y. Zhang, C.G. Zhang,
microbial communities, in: E. Owen (Ed.), Molecular Effect of methamidophos on soil fungi community in
Microbial Ecology, Cromwell Press, Trowbridge, Wilts, microcosms by plate count, DGGE and clone library
2005, pp. 72-74.
analysis, Journal of Environmental Sciences 20 (5) (2008) [33] I. Huber, B. Spanggaard, K.F. Appel, L. Rossen, T. 619-625.
Nielsen, L. Gram, Phylogenetic analysis and in situ [28] G. Muyzer, A. Teske, C.O. Wirsen, H.W. Jannasch,
identification of the intestinal microbial community of Phylogenetic relationships of Thiomicrospira species and
rainbow trout (Oncorhynchus mykiss, Walbaum), Journal their identification in deep-sea hydrothermal vent sample
of Applied Microbiology 96 (1) (2004) 117-132. by denaturing gradient gel electrophoresis of 16S rDNA
[34] S. Sarter, K. Nguyen Hoang Nam, H. Le Thanh, J. Lazard, fragment, Archives of Microbiology 164 (3) (1995)
D. Montet, Antibiotic resistance in gram-negative bacteria 165-172.
isolated from farmed catfish, Food Control 18 (11) (2007) [29] E.Z. van Hannen, G. Zwart, M.P. van Agterveld, H.J.
1391-1396.
Journal of Life Sciences 6 (2012) 1343-1350
Molecular Characterization of Olive Cultivars in Iraq Using SSR Markers and Compare with Phenotypic Characterization
1 2 Iqbal Harbi 3 , Salwa Jaber Al-Awadi and Ali Imad Mohammad Moner 1. State Board of Date Palm Ministry of Agriculture, Baghdad 10069, Iraq
2. Al Nahrain Forensic DNA Training Center, University of Al Nahrien, Baghdad 10072, Iraq 3. Genetic Engineering and Biotechnology Institute for Postgraduate Studies, Baghdad University, Baghdad 10071, Iraq
Received: June 05, 2012 / Accepted: August 14, 2012 / Published: December 30, 2012.
Abstract: Simple sequence repeat (SSR) analysis was used to study the genotype relation among ten different olives varieties from Al-Zafrania and Al-Mosel station ministry of agriculture/Iraq Shami, Sorani , Manzenllo, Qaysi, Arbqween, Jlot (Labeeb), Baashiqi, Dahkan, Nepali, Khodeiri, Fifteen SSR loci were studied and produced 239 amplified fragment. Two hundred and thirty seven of these loci (99.16%) were polymorphic over all the genotypes tested. Dendrogram and matrix of similarity were obtained by the Unweighted Pair-Group Method analysis (UPGMA). Study showed two groups: group A: Nepali, Arbqween, and group B: divided in two sub groups (sub group B1: Jlot, Dahkan, sub group B2: other cultivar), while the genotype relation according to phenotype was confused. SSR has a better molecular marker than other molecular technique for detecting genetic relationship among cultivars, and help in known the pedigree of relatives and ancestors.
Key word: Olive, PCR, SSR, molecular markers.
1. Introduction phenology [3]. But DNA-based markers are not influenced by environmental conditions, and they
Olive (Olea europaea L.) is one of the most ancient allow direct scanning of the plant genome [4, 5]. cultivated fruit tree species in the Mediterranean basin. Knowledge of the genetic relationships between wild Olive cultivars are quite diverse both in external and olives and their cultivated relatives is necessary to internal fruit characteristics such as size, shape, color, improve genetic resources and understanding of their texture, oil ratio, oil composition, etc. Plant evolutionary background [6, 7]. Presently study show characteristics are also very diverse, ranging from DNA-based markers very useful tools for plants’ shrubs to large trees, extending to upright, and having scientists in establishing phylogenies and determining small to large leaves [1]. It is a predominantly similarities among cultivars [8]. Give us a chance to allogamous species showing a high degree of out make a direct comparison between the organisms in crossing which leads to considerable levels of molecular levels, as the use of DNA-based molecular heterozygosity and DNA polymorphism among markers has become popular in plant breeding as well individuals [2], most morphological traits are as olives along with the other agriculturally important influenced by environmental factors, plant age and plants [9]. Genetic polymorphism of the plants can be
detected by many different DNA-based marker Corresponding author: Salwa Jaber Al-Awadi, Ph.D.,
methods, such as RAPD, RFLP, AFLPs [10-12], associate professor, research field: genetic engineering. E-mail:
fsalwaj@yahoo.com. Nowadays simple sequence repeat (SSR) have been
Molecular Characterization of Olive Cultivars in Iraq Using SSR
Markers and Compare with Phenotypic Characterization
proven to be very suitable markers for cultivar regions throughout genomes [14]. identification and identity typing in olive as they are
The aim of this study is to determine genetic transferable, highly polymorphic and co-dominant
relationships between olive cultivars natively grown markers [13]. SSR or microsatellite is one of the most
in Iraq and use the highly polymorphism ratio in important categories of molecular markers. It breeding studies in the future. comprises the core marker system of the PCR based
2 Materials and Methods molecular markers and is widely used for DNA fingerprinting, genetic mapping, and studies of genetic
2.1 Plant Material
diversity and population genetics. Microsatellite markers are abundant, highly polymorphic, and
Healthy leafs of olive tree were collected from ten co-dominant and distinguish multiple alleles in a plant
local cultivars, these cultivars were be in Al-Zafrania species due to variation in the number of repeat units
and Al-Mosel station ministry of agriculture/Iraq as in (motif), which are composed of 1 to 6-bp short DNA
Table 1.
sequences, such as dinucleotide repeats [(AT) n and
2.2 DNA Extraction
(CT) n ] and trinucleotide repeats (ATT), and disperse mainly in the regions between genes and un-coding
Genomic DNA was extracted from young leaves by
Table 1 Olive varieties, origin, distribution, pest resistance, morphological characterization that used in this study.
Pest resistance
Purpose Origin Name Code Insects Mite node
Cultivar Bacterial
Salt
Cold
Pollina- Tree
ducti- % Oil Seed Shape Fruit
Leaf
Verticillium Tolerance
Wilt Susceptible Un-
known Susceptible Unknown Untolerant Susceptible Pol. Moderate High 26-28 Sharp End With Spine Oval Spear Dual Purpose Syrian Khodeiri 1
Self
Susceptible Un-
Dual known
Tolerant Unknown Tolerant Resistance Self Pol.
Fast
High 18-21 Spine
Oval With
Spherical Spear
Purpose Syrian Qaysi 2
Spear
Susceptible Un- known Susceptible Susceptible Tolerant
Susceptible Mix Pol.
Moderate High 16-20 Oval
Oval To
To
Dual
Spherical Tapered Purpose Spain Manzenllo 3
Smooth
Ends
Susceptible Suscep-
tible Unknown Resistance Tolerant Resistance Self Pol.
Fast
High 19-21 Elongated
Oval With
Spear
Dual
Purpose Iraq Baashiqi 4
With Spine End
Unknown Suscep- Susceptible Resistance Tolerant
Resistance Self
Moderate High 17-22 Spherical
Spherical Spear Oil Spain Arbqween 5
Smooth
Susceptible Suscep-
tible Unknown Resistance Tolerant Resistance Self Dual
Moderate Mid 17-28 Sharp Ends Oval Spear Purpose nian Napali 6
Oval To
Jorda-
Pol.
Susceptible Suscep-
tible Unknown Susceptible Tolerant Resistance known
Un-
Fast
High 10-12. Elongated
Elongated
Fruit
With Spine Oval
Spear
Table Syrian Jlot 7
Spear
Susceptible
Dual wn
Unknown Resistance Tolerant Resistance Pol.
Fast
High 19-22 With Spin
Oval Tapered Purpose Elongated Iraq Dahkan 8
To
Ends
Resistance Un-kno wn
Susceptible Susceptible Tolerant
Resistance Self Pol.
Fast
High 26-28 Elongated Oval
Oval
Dual Purpose Syrian Sorani 9
Susceptible Un-kno wn Susceptible Unknown Tolerant
Resistance Un-
known Moderate High 17-20 Spine
Oval With
Spherical Spear
Dual
Purpose Syrian Shami 10
G.S. Steven, 2005, (GCSAR) 2007, F. T. Mehdi, 2007.
Molecular Characterization of Olive Cultivars in Iraq Using SSR
Markers and Compare with Phenotypic Characterization
CTAB according to Ref. [15]. The determination of tailed labeled with IRD700 fluorophore (Integrated DNA quality and concentration in samples was
DNA technology, USA), 0.5 µM of reverse primer performed by both spectrophotometric analysis and
(Integrated DNA technology, USA), The forward running on 0.8% agarose gels. Optical density ratios
primer was “tailed” by the inclusion of 19 extra from spectrophotometric analysis were evaluated and
nucleotides at the 5’ end, which facilitated the labeling only good-quality DNA samples were used in PCR
of the products, The reactions were carried out in a [15].
thermo cycler Perkin-Elmer 9700 (Applied Biosystems) with the following profile: 95 °C for 5
2.3 Molecular Marker min, 6 cycles at 95 °C for 20 s, annealing temperature
Fifteen microsatellites (Table 2) were used to (Table 2 ) for 30 s, decreasing 1 °C/cycle, extension genotyping ten local olive varieties cultivating in Iraq,
temperature 72 °C for 30 s; followed by 29 cycles at PCRs were performed in a 10 µL volume consisting of
95 °C for 20 s, annealing temperature 50 °C for 30 s,
72 °C for 30 s with a final extension at 72 °C for 6 Polymerase (Invitrogen, Brazil), 1× PCR buffer
20 ng of DNA, 0.5 unit of FastStart Taq DNA
min. SSR markers were profiled using a LI-COR
Bioscience 4300 DNA Analyzer, 1 µL of the product dNTP (Invitrogen, Brazil), 0.1 µM of tailed forward
(Invitrogen, Brazil), 2.5 mM MgCl 2 , 200 µM of each
was loaded onto a 6% polyacrylamide gel, and primer (Integrated DNA technology, USA), 0.5 µM
electrophoreses at 1500 V. Molecular Marker standards
Table 2 The SSR primer sequence for fifteen loci used in the amplification of olive genomic DNA.
An. Temp (°C) Primer Name Motif
Forward 5’ 3’ with labeled tail
Reverse 5’ 3’
Reference Loop1 Loop2
ssrOeUA-DC A1 (GA)22
50 50 21 ssrOeUA-DC (GA)19
CACGACGTTGTAAAACGACCCTC ATGAACAGAAAGAA TGAAAATCTACACTCACATCC
GTGAACAATGC
50 50 21 ssrOeUA-DC (GA)16
CACGACGTTGTAAAACGACCCCA TGCTTTTGTCGTGTTT A3 AGCGGAGGTGTATATTGTTAC
GAGATGTTG
CACGACGTTGTAAAACGACCTTA AGTGACAAAAGCAA
A4 ACTTTGTGCTTCTCCATATCC
AAGACTAAAGC
ssrOeUA-DC
CACGACGTTGTAAAACGACAAC CGTGTTGCTGTGAAG
50 50 21 ssrOeUA-DC (AG)19
A5 (GA)15
CACGACGTTGTAAAACGACGGA AGGGTAGTCCAACTG A7 CATAAAACATAGAGTGCTGGGG CTAATAGACG
55 50 21 ssrOeUA-DC
A8 (GA)18
CACGACGTTGTAAAACGACACAA TTCAACCTCACCCCCATACCC
TCACGTCAACTGTGC
CACTGAACTG
55 50 21 ssrOeUA-DC (TA)14(GA)17
A9 (GA)23
CACGACGTTGTAAAACGACCGTG CTGTCCAGAGCTAAA
CACGACGTTGTAAAACGACGATC TTGTCTCAGTGAACC
A11 (GA)26(GGGA)4
50 50 21 ssrOeUA-DC (CA)18A6(TAA)7
CACGACGTTGTAAAACGACAATT TTGAGGTCTCTATATC
A18 (CA)4CT(CA)3(GA)19 CACGACGTTGTAAAACGACAAG GTTTTCGTCTCTACAT AAAGAAAAAGGCAGAATTAAGC AAGTGAC
50 50 21 ssrOeUA-DC
A16 (GT)13(GA)29
50 50 21 ssrOeUA-DC (GT)9(AT)7
CACGACGTTGTAAAACGACTTAG TTTTAGGTGAGTTCAT GTGGGATTCTGTAGATGGTTG
AGAATTAGC
50 50 21 A17
CACGACGTTGTAAAACGACGATC TAATTTTTGGCACGTA
AGATA(GA)38
AAATTCTACCAAAAATATA
GTATTGG
CACGACGTTGTAAAACGACCATG GGCACTTGTTGTGCA
GAPU101 (CT)9
50 50 13 GAPU59 (GA)8(G)3(AG)3 CACGACGTTGTAAAACGACCCCT CAAAGGTGCACTTTC GCTTTGGTCTTGCTAA TCTCG
AAAGGAGGGGGACATA
GATTG
Molecular Characterization of Olive Cultivars in Iraq Using SSR
Markers and Compare with Phenotypic Characterization
was loaded on the gels to assign the size to each allele,
3. Results and Discussion
and Alleles were scored manually [16]. SSR analysis of ten cultivated olive accessions
2.4 Phenotypic Marker using fifteen SSR loci provided a total of 239 bands as The phenotypic characterizing of ten local olive
show in Table 3. Two hundred thirty seven of these variety (Table 1) were converted to numeric and
loci (99.16%) were polymorphic over all the analysis according to Ref. [17].
genotypes tested. The average number of detected alleles per locus was 3.93 while the average number of
2.5 Data Analysis detected bands per loci was 15.93. Loci DCA3, DCA9, Polymorphic Information Content (PIC) measured
DCA11, DCA14, DCA16 and GAPU101 were to know the in formativeness of each loci, that
suitable for mapping the genome, while the other depended on allele frequency, if the PIC > 0.7
studied loci were informative markers to olive and that represent highly differentiation marker and suitable
agreed with the result detected in study of Tunisian for mapping, if PIC > 0.5 it will be classified as
olive varieties [21]. The highest number of informative marker [18, 19], genetic distance and
polymorphic bands over all varieties detected by loci phylogenic tree to the fifteenth SSR loci were
difference between loci calculate according to Ref. [20].
GAPU101
this
bands productivity because of the differed of the primer
Table 3 Monomorphic and polymorphic percentage for olives varieties using 15 SSR.
Marker PIC Marker
morphic % DCA1 0.59375 Informative marker
Poly efficiency
No. of bands No. of Alleles Molecular weight
product
Alleles (bp)
morphic %
Mono
0 0.00 16 100.00 DCA3 0.72314 Suitable for mapping
22 5 251,253,256,265,269 0 0.00 22 100.00 DCA4 0.444444 Informative marker
0 0.00 12 100.00 DCA5 0.677686 Informative
22 4 215,220,223,224 1 4.55 21 95.45 marker
DCA7 0.592593 Informative marker
0 0.00 9 100.00 DCA8 0.408163 Informative marker
0 0.00 7 100.00 DCA9 0.75737 Suitable for
21 5 173,186,192,203,213 0 0.00 21 100.00 mapping
0 0.00 12 100.00 DCA11 0.8 Suitable for mapping
DCA10 0.652778 Informative marker
15 6 163,167,175,179,182,188 0 0.00 15 100.00 Suitable for
DCA14 0.745562 mapping 13 5 176,194,198,207,210 0 0.00 13 100.00 DCA18 0.698225 Informative marker
13 5 178,182,184,190,192 0 0.00 13 100.00 DCA16 0.734694 Suitable for mapping
74 162,170,174,191 0 0.00 7 100.00 Informative
DCA17 0.459184 marker
0 0.00 14 100.00 GAPU101 0.800584 Suitable for
37 6 148,205,208,213,230,279 1 2.71 36 97.29 mapping
GAPU59 0.698061 Informative marker 19 4 218,223,228,232 0 0.00 19 100.00 Total avarge
Molecular Characterization of Olive Cultivars in Iraq Using SSR
Markers and Compare with Phenotypic Characterization
Table 4 Genetic distance of ten olive cultivars using fifteen SSR loci.
Shami Sorani Dahkan
Labeeb
Nepali
Arbqween Baashiqi
Manzenllo Qaysi
Khodeiri OTU 0.000
Khodeiri
0.000 0.369 Qaysi 0.000 0.472 0.222 Manzenllo 0.000 0.400 0.133 0.444 Baashiqi 0.000 0.522 0.522 0.552 0.560 Arbqween 0.000 0.470 0.510 0.585 0.500 0.474 Nepali 0.000 0.530 0.682 0.447 0.575 0.480 0.491 Labeeb 0.000 0.460 0.715 0.772 0.460 0.568 0.450 0.561 Dahkan 0.000 0.568 0.620 0.532 0.500 0.429 0.191 0.378 0.174 Sorani 0.000 0.318 0.556 0.571 0.511 0.572 0.423 0.423 0.417 0.429 Shami
Table 5 Genetic distance of ten olive cultivars using phenotypic characters.
Shami Sorani Dahkan
Labeeb
Nepali
Arbqween Baashiqi
Manzenllo Qaysi
Khodeiri OTU 0.000
Khodeiri
0.000 0.538 Qaysi 0.000 0.385 0.308 Manzenllo 0.000 0.465 0.250 0.500 Baashiqi 0.000 0.334 0.538 0.417 0.583 Arbqween 0.000 0.334 0.230 0.384 0.333 0.500 Nepali 0.000 0.500 0.545 0.250 0.500 0.545 0.636
Labeeb 0.000 0.334 0.308 0.417 0.077 0.384 0.167 0.417 Dahkan 0.000 0.308 0.417 0.615 0.615 0.384 0.500 0.462 0.462 Sorani 0.000 0.500 0.273 0.545 0.273 0.273 0.364 0.167 0.167 0.417 Shami
combinations in their ability to matching with Sorani, Jolt, C: Qaysi, Baashiqi, Dahkan, D: Nepali, E: compatible sequence in all over genome and detection
Shami, Manzenllo, F: Arbqween, the result depend on of the polymorphism of the populations as the result
SSR marker were consent with [23] when they use [22]. These results demonstrated a high degree of
AFLP technique, while the result depend on polymorphism in the olive germplasm with an average
phenotypic characterization were very confused and of 99.16% as in Table 3, while (59.8%) were
superimposed, Therefore it is difficult to determine polymorphic in the same cultivar when used AFLP
varieties based on the phenotype because of the technique [23].
association of environmental conditions [24, 25]. The The highest Genetic distances and lowest were
cultivar in group A was also found in difference area different in both SSR & phenotypic as in Tables 4 and
like (Spain and Jordan) they also had some deferent
5. The dendrogram derived from an UPGMA cluster phenotypic characters consent with Z. Wiesman et al. analysis of the SSR markers are explained in Fig. 1
[26] who noted that the similarity and differences that shown two main distinct groups were observed in
between varieties of olives are not related with their the dendrogram. Group A consisted of cultivar Nepali,
geographical origin. While cultivar in sub group B1: Arbqween Group B: other cultivar and divided in two
Jolt, Dahkan and cultivar in sub group B2 were found sub group B1: Jolt, Dahkan sub group B2: Manzenllo,
in closed area (Syria and Iraq) and had high similarity Khodeiri, Sorani, Shami and the cultivar Qaysi,
in phenotypic characters: shape (leaf, fruit, seed), Baashiqi were in the same level. In the other hand
productivity, tree growth, pollination type, cold dendrogram derived from an UPGMA cluster analysis
tolerance salt tolerance, pest resistance [27-29], and of the phenotypic characters six group A: Khodeiri , B:
this is due to the belonging to same origin while the
Molecular Characterization of Olive Cultivars in Iraq Using SSR
Markers and Compare with Phenotypic Characterization
Fig. 1 Genetic distance dendrogram to ten olive cultivar produced by A: SSR technique using fifteen loci, B: depending on phenotypic characters, (1: Khodeiri, 2: Qaysi, 3: Manzenllo, 4: Baashiqi, 5: Arbqween, 6: Nepali, 7: Jlot, 8: Dahkan, 9: Sorani, 10: Shami).
potential possibility of the variation are the polymorphism ratio in breeding studies in the future. hybridization (programmed or natural) and the
4. Conclusion
environmental effect [30]. SSR has a better molecular marker than other molecular technique for separate
Some of SSR markers were suitable for mapping and detecting genetic relationship among cultivars and
the genome, while the other were informative markers agreed with [31-33]. Therefore, SSR technique was
to olive genome, a high degree of polymorphism in more specificity than AFLP-PCR in explaining the
the olive germplasm with in average 99.16%. The genotype of olive variety that cultivated in Iraq, in
dendrogram derived from an UPGMA depend on SSR addition DNA based markers are not affected by
markers shown two main distinct groups while other environmental conditions and it allows to directly
six were depend on the phenotypic characters. The determining the plant genotype [34]. It is very
result depend on phenotypic characterization were important to define variety-specific genetic structure;
very confused and superimposed. Therefore it is to determine genetic distances and similarities difficult to determine varieties based on the phenotype between it and preserve genetic structures of local
because of the association of environmental conditions, types peculiar to regions and use the highly the similarity and differences between varieties of
Molecular Characterization of Olive Cultivars in Iraq Using SSR
Markers and Compare with Phenotypic Characterization
olives are not related with their geographical origin.
p. 411.
SSR has a better molecular marker than other [13] F. Carriero, G. Fontanazza, F. Cellini, G. Giorio,
Identification of simple sequence repeats (SSRs) in olive molecular technique for separate and detecting genetic
(Olea europaea L.), Theoretical Applied Genetic 104 relationship among cultivars.
(2002) 301-307. [14] K. Meksem, G. Kahl, The Handbook of Plant Genome
Reference
Mapping Genetic and Physical Mapping, WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim, 2005, p. 403.
[1] S. Ercisli, E. Barut, A. Ipek, Molecular characterization [15] S.B. Wu, G. Collins, M. Sedgley, A molecular linkage of olive cultivars using amplified fragment length map of olive (Olea europaea L.) based on RAPD, polymorphism markers, Genetic Molecular Research 8 (2) microsatellite, and SCAR markers, Genome 47 (2004) (2009) 414-419.
26-35.
[2] P. Rallo, G. Dorado, A. Martin, Development of simple [16] S. Doveri, D.M. O’Sullivan, D. Lee, Non-concordance sequence repeats (SSRs) in olive tree (Olea europaea L.), between genetic profiles of olive oil and fruit: A Theoretical Applied Genetic 101 (2000) 984-989. cautionary note to the use of DNA markers for [3] S. Ercisli, E. Orhan, A. Esitken, N. Yildirim, provenance testing, Journal of Agriculture and Food Relationships among some cornelian cherry genotypes Chemistry 54 (2006) 9221-9226. (Cornus mas L.) based on RAPD analysis, Genetic [17] M. Nei, Genetic distance between populations, American Resource Crop Evolution 55 (2008) 613-618.
Naturalist 106 (1972) 283-292.
[4] P. Martins-Lopes, J. Lima-Brito, S. Gomes, J. Meirinhos, [18] K. Liu, S.V. Muse, Power marker: Integrated analysis RAPD and ISSR molecular markers in Olea europaea L.: environment for genetic marker data, Bioinformatics 21 Genetic variability and molecular cultivar identification,
(2005) 2128-2129.
Genetic Research Crop Evolution 54 (2007) 117-128. [19] W. Taamalli, F. Geuna, D. Bassi, D. Daoud, M. Zarrouk, [5] S. Doveri, S. GilF, A. Díaz, S. Reale, Standardization of a
set of microsatellite markers for use in cultivar SSR marker based dna fingerprinting of tunisian olive identification studies in olive (Olea europaea L.), Science
(Olea europaea L.) varieties, Journal of Agronomy 7 Horticulture 116 (2008) 367-373.
(2008) 176-181.
[6] F. Kockar, R. Ilikci, Investigations of genetic variation [20] F.J. Rohlf, NTSYS-pc Numerical Taxonomy and between olive (Olea europaea L.) cultivars using
Multivariate Analysis System, Version 2.02, Exeter arbitrarily primed polymerase chain reaction (AP-PCR),
Publications Setauket, New York, 1998. Naturforschung 58 (2003) 837-842.
[21] K.M. Sefc, M.S. Lopes, D. Mendoncüa, D. Rodrigues, M. [7] L. Baldoni, N. Tosti, C. Ricciolini, A. Belaj, Genetic
Santos, D.C.M. Laimer, Identification of microsatellite structure of wild and cultivated olives in the loci in olive (Olea europaea) and their characterization in
central Mediterranean basin, Annual Botany 98 (2006) Italian and Iberian olive trees, Molecular Ecology 9 (2000) 935-942.
1171-1173.
[8] C.D. Li, C.A. Fatokun, B. Ubi, B.B. Singh, Determining [22] N. Grati-Kamoun, F. Mahmoud, A. Rebaï, A. Gargouri, genetic similarities and relationships among cowpea
Genetic diversity of Tunisian olive tree (Olea europaea breeding lines and cultivars by microsatellite markers,
L.) cultivars assessed by AFLP markers, Genetic Crop Science 41 (2001) 189-197.
Resources and Crop Evolution 53 (2006) 265-275. [9] G.M. Claros, R. Crespillo, M.I. Agilar, F.M. Canovas,
[23] I.H. Mohammed, A.I. Moner, S.J. Al-Awadi, H. DNA fingerprinting and classification of geographically
Khierallah, Molecular characterization of olive cultivars related genotypes of olive-tree (Olea europaea L.),
in Iraq using AFLP markers, Iraqi Journal of Science 53 Euphytica 116 (2000) 131-142.
(1) (2012) 73-80.
[10] F. Sanz-Cortés, D.E. Parfitt, C. Romero, D. Struss, [24] M. Sesli, E. Dil, RAPD-PCR analysis of cultured type Intraspecific olive diversity assessed with AFLP, Plant
olives in Turkey, African Journal Biotechnology 8 (2009) Breed 122 (2003) 173-177.
3418-3423.
[11] C.A. Owen, E.C. Bita, G. Banilas, S.E. Hajjar, AFLP [25] H. Zaher, B. Boulouha, M. Baaziz, L. Sikaoui, F. Gaboun, reveals structural details of genetic diversity within
S.M. Udupa, Morphological and genetic diversity in olive cultivated olive germplasm from the Eastern
(Olea europaea subsp. europaea L.) clones and varieties, Mediterranean, Theoretical Applied Genetic 110 (2005)
Plant Omics Journal 4 (2011) 370-376. 1169-1176.
[26] Z. Wiesman, N. Avidan, S. Lavee, B. Quebedeaux, [12] P.S. Srivastava, Plant Biotechnology and Molecular
Molecular characterization of common olive varieties in Markers, Anamaya Publishers, New Delhi, India, 2005,
Israel and the West Bank using randomly amplified
1350
Molecular Characterization of Olive Cultivars in Iraq Using SSR
Markers and Compare with Phenotypic Characterization
polymorphic DNA (RAPD) markers, Journal American Blanco, SSR-based identification key of cultivars of Olea Society Horticulture Science 123 (1998) 837-841.
europaea L. diffused in Southern-Italy [online], [27] F.T. Mehdi, The Development Of Olive Cultivation, The
Scientia Horticulturae, 2009, http://www.olviva.it/files/ General Company for Horticulture and Forestry Ministry
P17a.pdf.
of Agriculture Republic of Iraq, Baghdad, Iraq, 2007, pp. [32] K. Roubos, M. Moustakas, F.A. Aravanopoulos, 1-44.
Molecular identification of Greek olive (Olea europaea) [28] Characterization Of The Main Olive Cultivars, Syrian
cultivars based on microsatellite loci, Genetic Molecular General Commission For Scientific Agriculture Research
Research 9 (2010) 1865-1876.
(GCSAR), Syria, 2007. [33] F.J. Delgado-Martinez, I. Amaya, J.F. Sánchez-Sevilla, [29] G.S. Steven, F. Louise, Olive Production Manual,
M.C. Gomez-Jimenez, Microsatellite marker-based University of California, Agriculture and Nature
identification and genetic relationships of olive cultivars Resources, USA, 2005.
from the Extremadura region of Spain, Genetic. [30] E.R. Sensi, M. Vignani, E. Scali, M. Cresti, DNA
Molecular Research 11 (2012) 918-932. fingerprinting and genetic relatedness among cultivated
[34] J. Khadari, A. Charafi, M. Moukhli, Substantial genetic varieties of Olea europaea L. estimated by
diversity in cultivated Moroccan olive despite a single AFLP analysis, Scientia Horticulturae 97 (2003) 379-
major cultivar: A paradoxical situation evidenced by the 388.
use of SSR loci, Tree Genetics & Genomes 4 (2007) [31] V. Alba, C. Montemurro, W. Sabetta, A. Pasqualone, A.
213-221.
Journal of Life Sciences 6 (2012) 1351-1355
Arg-X Protease-Sensitive in Supramolecular Structures of Interphase Cell Nucleus during Growth Morphogenesis Mature Germs of Wheat
Ivanov Ruslan, Vafina Gulnara and Ivanova Evilina Institute of Biology Ufa Science Centre, Russian Academy of Science, Ufa 450054, Bashkortostan, Russia
Received: July 15, 2012 / Accepted: September 19, 2012 / Published: December 30, 2012.
Abstract: In the present study was investigated Arg-X protease-sensitive in supramolecular-genome compartments (nucleoplasm, chromatin, nuclear matrix), during the period of the transcriptional activation of chromatin when the growth processes was initiated in the mature germs of winter and transformed from it spring wheat. The germs have been separated from endosperm from 0 h (air-dry seed) up to 21 h in each 3 h after the start of seeds soaking. Cell nucleus have been allocated from germs and cleared, and then from them supramolecular-genome compartments were extracted by increasing ionic strength of solution. The Arg-X (tryptase) activity was assessed by cleavage of Arg-X bonds in the arginine-enriched protein protamine in all nuclear fractions. In the present study have shown what Arg-X protease-sensitives zones can be located on the supramolecular structures of chromatin matrix in processes of realization of ontogenetic programs of development in mature germs of the winter and transformed from it spring wheat. Arg-X protease-sensitive can translocate and coordinated in heteropolymer structures on the same genetic matrix. Questions of epigenetic mechanisms are discussed.
Key words: Arg-X protease-sensitive, G 1 phase of cell cycle, supramolecular structures, cell nuclei, spring and winter wheat.
1. Introduction chromatin reorganization at the level of supramolecular structures of cell nucleus.
As it is known, proteolysis is the form of the Plants have all basic epigenetic mechanisms biological control giving the fast physiological inherent to eukaryotes, and frequently these response to changing conditions of an environment. In mechanisms even are more perfect, than by the
a number of laboratories of the world the presence of representatives of other empires of the live world. specific intranuclear proteinases during the process of Robin’s definition of epigenesis as “a change of gene biogenesis of cell nucleus has been proved [1, 2]. In expression in organisms with differentiated cells this work was submitted the experimental analysis of which are inherited mitotically” [3] is the most the dynamics of intranuclear proteome the mature suitable to the authors’ object of research. One of the germs of the winter wheat and transformed from it modern definitions of epigenetics in molecular spring wheat. This aspect of experiment is considered (mechanistic) aspect is “the sum of changes in from two positions: (1) molecular morphogenesis at chromatin matrix which in the set established and
induction of cell elongation growth during the G 1
reproduced various patterns of gene expression phase of the cell cycle and; (2) the possibility of (transcription) and silencing on the basis of same involving epigenetic mechanisms in spatial-temporal genome” [4]. It was interested to research the
Corresponding author: Ivanova Evilina, Ph.D., chief processing of the proteins of chromatin matrix the research officer, research field: biochemistry. E-mail: evilina@anrb.ru.
same genome of the winter form and transformed
Arg-X Protease-Sensitive in Supramolecular Structures of Interphase
Cell Nucleus during Growth Morphogenesis Mature Germs of Wheat
from it spring form plant. The authors were clearly
is rich of Arg.
understood that this mechanism of adaptation is not in The object of the present study was highest-quality form of binary effect “switched off/on”. It is complex
seeds of the Triticum aestivum L. Mironovsky 808 mix patterns of modifications at the level of chromatin
(winter) and transformed from it Mironovsky Spring. matrix as a way of carrying out of a signal. The
The seeds were kindly provided from the collection of epigenetic mechanisms were carried out through the
the “All-Russian Research Institute of Plant Industry”. processing of proteins and their modifications, which
According to the “Remeslo Research Institute of were realized on chromatin matrix. Chromatin matrix
Wheat Breeding and Seed Production, Mironovo”, is physiologically significance substrate on which the
Mironovsky spring wheat has been transformed from mechanism of chromatin remodeling is carried out. It
winter Mironovsky 808 wheat by group selection from is done through changes at different levels compaction
material received “by a method of shaking of a of chromatin. In process of transformation winter wheat
heredity at cold influence of factors of an into spring wheat the signals from internal factors and
environment” [6]. The wheat embryos were environment can cause epigenetic modifications in
germinated in the dark at 22 ± 10 °C. The embryos plant and change its physiological response.
were separated from endosperm at the time intervals: In the present study was investigated Arg-X
0 h (air-dry seed) and 3, 6, 9, 12, 15, 18, and 21 h after protease-sensitive in the supramolecular-genome the start of seeds soaking. Cell nuclei were isolated by compartments (nucleoplasm, chromatin, nuclear the method described in ref. [7]. Supramolecular matrix), during the period of the transcriptional
structures were isolated from purified cell nuclei by activation of chromatin when the growth processes
increasing ionic strength of solution. The fraction of was initiated in the mature germs of winter and
nucleoplasm was isolated by 0.14 M NaCl [8, 9]. The transformed from it spring wheat.
fraction of chromatin loosely bound with nuclear matrix (Chr I) was received by the extraction of
2. Materials and Methods
0.35 M NaCl. The fraction of chromatin tightly bound Convenient model for research mechanisms of
with nuclear matrix (Chr II) was isolated by 2 М NaCl. epigenetic regulation is winter and spring forms of
Nuclear matrix (NM) was obtained by extraction 6 М wheat. Earlier in the paper [5] was declared the
guanidine hydrochloride (Gu·HCI) and 0.004% assumption, that winter and spring forms are β-mercaptoethanol [8, 9]. The protein amount in nuclei genetically determined [5]. Ukrainian scientists and nuclear fractions was determined by the method [8]. researched the properties of unique and repeating
The Arg-X (tryptase) activity was assessed by cleavage sequences of DNA of wheat cv.: Artemovka (spring),
of Arg-X bonds in the arginine-enriched protein transformed from it Mironovsky 808 (winter) and
protamine Salmine-A-I (“Merk”) in all nuclear Mironovsky spring, transformed from Mironovsky
fractions [8]. A molecule of this protein is composed of 808 (winter). According to Ref. [5] has shown full
33 amino acids: 22 Arg, 4 Ser, 3 Pro, 2 Glu and 2 Val. homology nuclear acids. In this work [5] the
Activity Arg-X proteolysis was calculated in nanomoles of arginine per second per milligram of protein.
distinctions between winter and spring forms are at the level of regulation of genome expression [5]. This
3. Results and Discussion
date promoted our assumption that Arg-X proteolysis
3.1 Physiology-Biochemical State of a Cell and Its can function at a level of spatial-temporal
Nucleus
reorganization of interphase chromatin in the cell nucleus. It is known that the proteome of cell nucleus
The investigated period of functioning cell nucleus
Arg-X Protease-Sensitive in Supramolecular Structures of Interphase
Cell Nucleus during Growth Morphogenesis Mature Germs of Wheat
is associated to the processes of swelling seeds, They are controlled by the participation of the whole hydrating cells, changing of a structure of cell
hierarchy of the mechanisms, which are nucleus [10]. According to Ref. [11], the active
programmed in the structural organization of growth processes were carried out due to extension of
chromatin and indissoluble bound chromatin with the cells during the G 1 phase of the cell cycle. Process
nuclear matrix.
of water absorption by a seed occurs in three steps.
3.2 Supramolecular Structures of a Cell Nucleus The first step is swelling due to matrix forces of cell
walls and a substrate of a seed. It is shown that free Nucleoplasm (Np) is high-structured system. Its water is capable to approach to structural proteins of a
basic functions are the nuclear-cytoplasmic, germ only through 15 min to 2 h. The next step is the
intercellular interactions and also the metabolism of lag—period continuing approximately 12 h to 24 h.
nucleus. In nucleoplasm there is nucleoplazmine This period is characterized by active hydrolysis of
which participate in nucleosome assembly, by spare carbohydrates and proteins. The third period is
formation of complexes with histones. characterized of root emergence [12].
Chromatin loosely bound with nuclear matrix (Chr I) According to Refs. [13, 14], the first wave of
are HMG and LMG proteins, and in part of histone HI. chromatin activation covers the period from 3 h
This fraction is enriched euchromatin [8, 9]. germination of seeds up to 12 h. This wave is
Chromatin tightly bound with nuclear matrix (Chr associated to deblocking of genome at the transfer
II) contains the major mass of chromatin. This fraction cells of these tissues from the state of biological rest.
is known in the literature as the basic heterochromatin It was considered that simultaneously the number of
[8, 9]. Fractions (Chr I and Chr II) differ by the ratio genes is switched on for realization of the first stage
active and inactive genes; localization in a nucleus; of chromatin activation. Obviously activation of
sensitivity to action of dissociates substances, genes at this stage is carried out at participation
nucleases; ability to undergo conformation transitions loosely bound non-histones. It is quite possible that
the gene network is switched on in this period. The Nuclear matrix (NM) is an active dynamic structure. network is functional group of genes coordinately
Fermentative complexes of replication and expressed. The second stage of chromatin activation
transcriptions are assembled and functioned on the is coming soon after the first approximately in 1-3 h.
surface of nuclear matrix. Both protease-resistance It is characterized by dramatic decrease of exposure
zones, and protease-sensitive zones were found in DNA, reduction of RNA synthesis, and also associates of proteins with DNA of nuclear matrix switching off the majority genes. It can be [15]. associated to degradation or leaving from nucleus
3.3 Arg-X Protease-Sensitive in Supramolecular non-histone proteins, which were presented at the Structures of Interphase Cell Nucleus first stage. Chromatin ultrastructure is also changed.
The third wave of chromatin activation is defined by Supramolecular descriptions of morphogenetic passage of period G 1 mitotic cycle. During this wave
processes are valuable, because the numerous there is a consecutive switching on genes. Products
macromolecular interactions are integrated into them. of these genes are necessary for the end of
These structures are consisting of proteins, DNA, pre-replication period, and for the introductions into
RNA, hexoses and lipids. They reorganized chromatin
a phase of synthesis DNA and mitosis. The sequence matrix during the phase cell cycle [9]. These of biochemical reactions is functionally associated.
supramolecular structures are characterized by the
Arg-X Protease-Sensitive in Supramolecular Structures of Interphase
Cell Nucleus during Growth Morphogenesis Mature Germs of Wheat
different levels of chromatin organization. The structures Chr II during permeation water into nucleoplasm fraction (Np) represents unfolded structures of chromatin matrixes (3 h) and transition interphase 11-nanometer configuration of matrix,
to DNA synthesis (21 h). It was shown that Arg-X where is, probably, remodeling of reconstruction
protease-sensitive carry out by two-step at the level chromatin. It was not found out Arg-X
nuclear matrix of winter germs. It was corresponds a protease-sensitives zones to exogenous substrate
physiological condition of imbibition of the germ (6 protamine in nucleoplasm fraction (Fig. 1). Fraction
h) and readiness for DNA synthesis (18 h). The chromatin loosely bound with nuclear matrix (Chr I)
Arg-X protease-sensitive, associated with readiness is 30-nanometer structuration of chromatin matrixes
for DNA synthesis (18 h), was found in Chr I with separate depressed structures by linker histone
fraction of the spring germs. At the level of nuclear Н1. It was found two sites of Arg-X protease-
matrix of spring germs Arg-X protease-sensitives sensitives at the level of the organization of
was found only during preparation for synthesis chromatin matrixes of the germs of the spring wheat.
DNA (12 h).
This period was corresponds to the preparation (12 h)
4. Conclusion
and the beginning (18 h) of replication DNA. In the winter wheat it was not revealed such sites. The next
Thus, in this work was present the integrated extracted supramolecular structure is loosely bound
networks of biochemical processes at participation of with nuclear matrix (Chr II). It was 300 nm-700 nm
Arg-X protease-sensitives at the level of chromatin organization of chromatin, anchored on nuclear
matrix. The chromatin matrix is in the continuous matrix. This fraction is enriched of heterochromatin
dynamic to the changing conditions of internal and [9]. It was detected two sites of Arg-X protease-
external factors. It was shown what Arg-X sensitive to exogenous substrate (3 h, 21 h) only in
protease-sensitives zones can be located on the the germs of spring wheat. It is possible that this is
supramolecular structures of chromatin matrix in associated with the relaxation of heteropolymer
processes of realization of ontogenetic programs of
nmol Arg/s · mg protein
Fig. 1 Activity of Arg-X protease-sensitive to exogenous substrate protamin in suprastructures of G 1 phase interphase nucleus mature germs of winter (1) and transformed from it spring (2) wheat: (Np-nucleoplasm; Chr I-chromatin loosely bound to NM; Chr II-chromatin tightly bound to NM; NM-nuclear matrix).
Arg-X Protease-Sensitive in Supramolecular Structures of Interphase
Cell Nucleus during Growth Morphogenesis Mature Germs of Wheat
development in mature germs of the winter and USSR Academy of Sciences 275 (1984) 218-221. [6] V.N. Remeslo, A.V. Kolomatskij, The Dynasty of
transformed from it spring wheat. It was shown that Mironovsky Wheat: The Science and Mankind, Znanie,
Arg-X protease-sensitive can be translocated and Moscow, 1980, pp. 112, 115-116.
coordinated in heteropolymer structures on the same
E.A. Ivanova, G.H. Vafina, Method of isolation of plant genetic matrix. In the authors’ opinion, epigenetic
cell nucleus, RF Patent, 1701747 B48 (1991).
E.A. Ivanova, G.H. Vafina, Method of obtaining of mechanisms associated with winter and spring form of nuclear fractions possessing proteinase and inhibition
plants involves numerous factors of remodeling activity, RF Patent, 1733471 B18 (1992). chromatin matrix. Research of Arg-X
E.A. Ivanova, G.H. Vafina, Physiology-biochemical protease-sensitive zones is probably one of the
analysis of interphase chromosomes during germination possible sides of the “epigenetic” code which of seeds of wheat, Physiology and Biochemistry of Cultivated Plants 24 (1992) 577-584.
essentially expands information about genetic code. [10] L.V. Avetisova, J.D. Shaposhnikov, V.A. Kadikov, Changes in ultrastructure of the cell nucleus of apex spear
References
of wheat during germination, Russian Journal of [1]
D. Watson, E. Moudrianakis, Histone—dependent Developmental Biology 19 (1988) 181-190. reconstitution and nucleosomal localization of a
G.H. Vafina, Analysis of Proteolytic Activity in Nuclear nonhistone chromosomal proteins the H2A-specific
Fractions during the Germination of Seeds of Wheat: protease, Biochemistry 21 (1982) 248-256.
Author-Review of Dissertation of Candidate of [2] M. Muramatu, Y. Kozaki, A tripsin-like proteinase
Biological Science, Saint Petersburg, Russia, 1998, p. 22. appearing at 17-th and 17 min in the cell cycle time of
[12] N.A. Askochinskaya, Water a Mode of Seeds: Physiology Hela cells correlates with the onset of DNA of Seeds, Nauka Publishers, Moscow, 1982. synthesis, Biochimica et Biophysica Acta 1087 (1990)
[13] V.M. Troyan, F.L. Kalinin, Changes in chromatin 87-90.
properties at early stages of seed germination, Physiology [3]
H. Robin, Epigenetics: An overview, Developmental and Biochemistry of Cultivated Plants 17 (1985) 219- Genetics 15 (1994) 453-457.
[4] C.D. Allis, T. Jenuwein, D. Reinberg, Epigenetics, Cold
A.V. Zelenin, A.A. Kush, Activation of chromatin and Spring Harbor Laboratory Press, Cold Spring Harbor, NY,
some problems of regulation genetic activity in 2007.
eukaryotic cell, Molecular Biology 19 (1985) 285-294. [5] V.P. Lobov, A.P. Daskaliuk, Comparative study of DNA
I.B. Zbarskiy, S.N. Kuzmina, Skeletal Structure of the of winter and spring wheat varieties, Proceedings of the
Cell Nucleus, Nauka Publishers, Moscow, 1990.
Journal of Life Sciences 6 (2012) 1356-1362
What Do Cattle Prefer in a Tropical Climate: Water Immersion or Artificial Shade?
1 2 Ana Carina Alves Pereira de Mira Geraldo 1 , Alfredo Manuel Franco Pereira , Cristiane Gonçalves Titto and
Evaldo Antonio Lencioni Titto 1
1. Animal Science and Food Engineering Faculty, University of São Paulo, Pirassununga 13635-900, Brazil 2. Institute of Mediterranean Agricultural and Environmental Sciences, University of Évora, Évora 7000, Portugal
Received: April 17, 2012 / Accepted: July 12, 2012 / Published: December 30, 2012.
Abstract: Animal performance is affected by high air temperature and it is known that shade reduces the absorption of radiant temperature, and water for immersion facilitates heat loss. This study intends to find preferences of resources that contribute for the well-being of cattle and how they alterdaily behaviour. During summer, six Caracu and six Red Angus bulls were submitted to two different treatments: availability of artificial shade and water for immersion and availability of water for immersion. The categories observed were: positions (in the sun, under the shade, in the water), posture (standing, lying down) and activities (grazing, ruminating, leisure). The behavioural patterns were recorded using the focal sampling method every 15 minutes (from 6:00 a.m. to 6:00 p.m.). When shade and water for immersion coexists, cattle in this study prefer shade to avoid solar radiation. Both breeds had remained more time grazing, followed by ruminating in the Caracu breed, and by resting in the Red Angus breed. The Caracu breed had presented clear preference for the shade resource, but that fact was not always observed in the Red Angus breed. In hot climates, resources for defence against heat load, as shade and water for immersion improve the well-being of cattle.
Key words: Animal welfare, behaviour, grazing, Caracu, Red Angus.
1. Introduction initially through the nervous system and later through the arch hypothalamus, pituitary, and adrenal cortex.
In Brazil, one of the main factors that affect This specific response is generically called stress. In animals’ performance is high temperature, which is the tropics, heat stress due to heat causes drastic felt through the year. High temperature often causes changes in the biological functions of animals and it is heat stress and therefore one of the most important
a major factor limiting the production of cattle [3]. adaptative aspects for cattle is heat tolerance [1]. Only The response to climatic stress situations can vary recently, focus on interaction of cattle with the from animal to animal, since heat stress is dependent environment has received attention, for example, on temperature gradients that exist between the issues related to finding shade and other ways of cattle animals and the environment, and is resistance to heat to reduce environmental thermal discomfort. flow types [4]. In heat stress situations, one of the first Müller [2] states that negative interference on the responses recorded in most domestic animals is a metabolism and production by climate causes an decrease in food consumption [5-8]. imbalance in the elements that influence an animal’s Since the animal is nothing more than an open health. The animal then responds physiologically, thermodynamic system, it is constantly exchanging
energy and matter with the environment. With Corresponding author: Ana Carina Alves Pereira de Mira
Geraldo, M.Sc., Ph.D. candidate, research fields: increasing temperature, the ability to dissipate bioclimatology, reproduction, animal welfare. E-mail: sensitive heat decreases as the thermal gradient ana.de.mira.geraldo@gmail.com.
What Do Cattle Prefer in a Tropical Climate: Water Immersion or Artificial Shade?
between the animals’ body and their surroundings decreases. These heat losses are independent of the thermal gradient and are mainly dependent on gradients of vapour pressure. To manage the heat, the animal promotes the process of fluid evaporation, which consists of heat exchange that occurs when a fluid turns from liquid to gas by taking advantage of the latent heat of vaporization that is involved in the process. In animals, this occurs through the respiratory tract and skin surface.
Activities of animals seeking a better adjustment to their environment are called adaptive behaviours [9]. Thermoregulatory behaviour such as lower food consumption and changes in attitudes and activities are carried out to promote heat loss and prevent heat accumulation [5]. When animals lay down in a hot environment, they increase the contact with the floor facilitating a greater heat exchange. One of the most important adaptive behaviour in a hot environment is to seek shade: a continuous exposure of cattle to summer heat in the absence of shade results in significant hyperthermia and impairs growth and general health [10]. Several studies have shown the benefits of shade, which reduces the radiant temperature that animals are exposed to, allowing a greater comfort, which is then reflected in the production of these animals [8, 11-14].
Under high temperatures, animals act according to the influence of the exchange of heat between their bodies and the environment toward reducing the acquisition of heat. An example of such an act is
shade seeking. According to Tapki et al. [15], in summer, the incident solar radiation at the hottest hours of the day may become a strong source of stress that reduces the production of cows. In the absence of trees, animals utilize the minimal shade available such as the shadow of fences, walls, plants or any other object, preferably trying to protect their heads.
Another situation for heat reduction is water immersion, which facilitates heat loss by conduction and convection. According to Ford [16] shade and
water bath (immersion) provide similar conditions for thermoregulation. In water, cattle tend to remain standing, with feet and lower members in the water for long periods, and all animals often adopt the same strategy of thermoregulation [17]. The water not only increases heat dissipation from the skin of the animal by conduction and convection but also provides endogenous heat dissipation through the effect of evaporation on the wet skin.
Therefore, by providing better conditions for animals, breeders and technicians can guarantee or improve their production. The purpose of this study was to analyze the behaviour of two breeds of Bos taurus with different thermoregulatory characteristics subjected to different environmental situations: with and without the availability of shade but always with the availability of water for immersion.
2. Materials and Methods
The experiment took place at the Biometeorology and Ethology Laboratory of the Faculty of Animal Science and Food Engineering at the University of São Paulo (FZEA-USP), located at 21º80 ′00″ S and 47º25 ′42″ W and 634 m above the sea level. The experiment was conducted with six bulls, each of the Caracu and Red Angus breeds, between 20-30 months of age and an average live weight of 527 kg. Behaviour observations were made on experimental pasture paddocks, each measuring 0.33 ha and predominantly covered with Brachiaria decumbens and with a water trough (Fig. 1). Each paddock was designed to study the effects of one of the following treatments: (1) artificial shade and water for immersion (SW) and (2) water for immersion (W). Artificial shade was made with a sheet of polyethylene mesh with 80% filtration of solar radiation, measuring 6 m × 10 m (60 m2) and providing shade for all animals at the same time (10 m2 for each animal). Water was advantageously diverted from a stream near the parks to two pools in these paddocks for water immersion. Each pool was 5 m wide, 10 m long and 1 m deep.
What Do Cattle Prefer in a Tropical Climate: Water Immersion or Artificial Shade?
Fig. 1 Detail of experimental site (not to scale).
The behaviour of the animals was recorded over comparison test was performed at P ≤ 0.05.
12 h (from 6:00 a.m. to 6:00 p.m.) every 15 min,
3. Results and Discussion
through instant and continuous collection of data using the focal sampling method [18], by one trained
3.1 Weather and Environmental Measures/Climatic observer positioned on an elevated platform (10 m)
Conditions
2 m from the beginning of the paddocks. Continuous The Biometeorology and Ethology Laboratory of
behaviours were subdivided into: (1) position (sun, FZEA-USP is situated in a region where the climate is
shade and water), (2) posture (standing or lying) and characterized as humid subtropical, with the rainy
(3) activity (grazing, ruminating and idling). These season from October to March. The annual average records specified the animals involved and the time of
temperature is 23 ºC and the average annual rainfall is occurrence. During eight sunny days, each treatment
1,303 mm.
group was observed for 4 d for 12 h per day. The maximum temperature was 37 ºC during the During the experiment, weather variables such as
study period of March and April. relative humidity, black globe temperatures (in the sun
3.2 Behaviour Preferences
and shady areas) and air temperature were recorded on an hourly basis from 6:00 a.m. to 6:00 p.m.
The exposure to the sun, shade and water taken by Data were analyzed using the repeated measures
the animals in both the treatments were different, ANOVA procedures of GML (SAS Institute, Inc.,
which made them to exhibit different behaviours. Cary, NC) with positions and activities as the
Squires (1981) and Daly (1984) cited by Blackshaw et dependent variables and treatments as the independent
al. [19] stated that when cattle have access to shade variable modelled as a fixed effect. When significant
they remain there during the hottest hours of the day, differences were revealed by the ANOVA procedure
leaving it only when looking for water or at the end of through least square means, a Tukey-Kramer multiple
the day. This was observed in the case of the Caracu
What Do Cattle Prefer in a Tropical Climate: Water Immersion or Artificial Shade?
breed, which preferred shade (19.39%) instead of actually moments where grazing was almost or totally water (0.51%). The Angus animals also preferred
lacking. Ruminating and leisure activities had an equal shade instead of water; however, they spent a
distribution between the treatments, though considerable time in the water (13.83%). This option
ruminating was higher in the W treatment (22.45%) to remain in the water had an influence on the
because of the decreased percentages of grazing. activities of the animals. An animal standing in the
A decrease in the percentage of animals that were sun or in the shade, has the ability to graze, which is
grazing was observed for the Angus breed since the unlikely to occur in water.
morning until the hottest hours of the day, followed by Grazing was the most frequent activity for both
a later increase. In the W treatment, the decrease was races in both the treatments (Table 2). In the SW
more marked but more irregular until 1:00 p.m. when treatment, Angus spent as much time idling (41.27%)
there was no animal grazing. However, after this as that of grazing (41.72%), which can be understood
interruption a larger number of animals returned to as an immediate response to heat stress, thereby
grazing.
reducing the consumption of food [5, 19, 20]. The Probably in the SW treatment, Caracu and Angus difference in grazing periods between the two
had periods of grazing followed by periods of treatments for the Angus animals was evident. This
rumination since they had access to shade. This fact was expected as the reduction in food intake is
hypothesis is also valid for Caracu in the W treatment. directly related to the reduction of heat gain by
However, in the same treatment for the Angus animals, digestion and muscular activity as an immediate
the rumination periods were not so many (7.65%) and response to heat stress [19].
frequent, probably due to the lack of shade. In these Comparing the two treatments for the Caracu
cases, the animals chose to graze and/or rest even animals in both phases, the number of grazing animals
during the hottest hours. This justification is decreases after the typical morning graze. However,
consistent with Curtis’ [21], which states that it is the decreases occurred earlier and were more regular
possible that animals will act differently in order to in the SW treatment than in the W treatment (between
influence the exchange of heat between their bodies 1:00 p.m. and 2:45 p.m. is the most representative
and the environment. In addition, Blackshaw et al. period for this). Grazing activity was the most
[19], argue that the patterns of grazing may be common behaviour in the two treatments, even though
influenced by the existence of shades.
it was more intense in the treatment where shade and For the Angus breed, the fact that shade was water coexist (61.73%). In the W treatment there were
available on the SW treatment may be one reason for
Table 1 Climatic measurements during the experiment.
W (Only water) Breed Caracu Angus Caracu Angus Temperature (ºC)
Treatment
SW (Shade and water)
Minimum 21 14.6 20 18.5 Maximum
36 35.5 37 32 Average Minimum
21.9 16.8 21.5 19.3 Average Maximum
33.7 33.8 34.3 29 Relative humidity (%) Minimum
47 57 40 53 Maximum
91 100 Average Minimum
46 52.5 45.5 66.5 Average Maximum
What Do Cattle Prefer in a Tropical Climate: Water Immersion or Artificial Shade?
Table 2 Least square means (percentage of observations), pooled standard errors (SEM), and probability values of behaviours for Caracu and Angus breeds in each treatment (SW, W).
Variable Mean SEM P-value Breed Caracu Angus
Caracu Angus Caracu Angus Sun SW
Water SW
Grazing SW
Ruminating SW
Idling SW
Sun Grazing SW
Sun Ruminating SW
Water Ruminating SW
Sun Idling SW
Water Idling SW
the differences observed in the values of grazing and 71.2% in W) were observed. In turn, the Angus (41.72% in SW and 51.36% in W) and rumination
ruminated preferably in the shade (64.27%) but also (16.33% in SW and 7.65% in W). As they seek shade
used the water for a considerable period of time more often and spend there more time, the food intake
was reduced, a fact quite common in Bos taurus [22]. Comparing the treatments according to breed, it was
A higher incidence of grazing in the early hours of observed that the behaviour of Caracu was the day and at late afternoon was observed for both
significantly different, this may be because the breeds. This fact agrees with other findings that
animals in the treatment SW had the option of shade confirm this trend in cattle regardless of their origin
and used it as a protection against the heat, especially [23-25].
during the hottest hours of the day. In the treatment W, Significant differences in time spent ruminating in
they appealed to water (5.78%) but were in the sun the sun for Caracu between treatments (35.88% in SW
where they remained ruminating most of the time
What Do Cattle Prefer in a Tropical Climate: Water Immersion or Artificial Shade?
(93.87%). In this case, it may be possible that the few acclimatization to the tropics, has led to a progressive times they used the water were sufficient to reduce the
tolerance to heat.
heat stress to which they were subjected. The fact that the animals were taken as one (of a In the case of Angus, there were no significant
breed) may have influenced the results, since each differences in sun rumination between the two
individual is an individual and there may be patterns treatments (26.41% in SW and 37.07% in W).
of behaviour quite different within a group of animals. However, there is also a preference for the use of
The reduced number of observations may have shade.
influenced the entire comparative analysis of the In relation to the use of the water, there were
ethogram, which may explain the low number of significant differences in treatments for both breeds.
significant differences that were found. When water for immersion was the only resource, the
4. Conclusion
utilization time by both breeds significantly increased. In treatment SW, Caracu rarely used the water to rest
The use of water for immersion although not (1.94%) preferring once again the shade. The Angus
regarded as a typical behaviour of animals can serve as an alternative to shadow as a means of heat
also preferred the shade, but the time that they spent in the water was much higher at 25.95%. In treatment W,
dissipation. However, this resource is passed over by the breeds in the study when the resource of shade
the situation was quite similar, verifying that the coexists. Animals of different breeds and different
Angus rested preferably in water (48.66%), while the husbandry while dealing with increase in radiant
Caracu rested only 9.66% of the time in the water. temperatures exhibit different behaviours.
Such differences can be justified by the fact that the In warm climates, resources that allow animals to
exchange of heat conduction that occurs between the defend themselves against the heat positively animal and the water is faster than the exchange by
contribute to their welfare.
convection and sweating that occurs when the animal is in the shade.
References
C. McManus, E. Prescott, G.R. Paludo, E. Bianchini, H. Angus breeds for the different treatments, it appears
After analyzing the behaviour of the Caracu and
Louvandini, A.S. Mariante, Heat tolerance in naturalized that the Caracu has preference for the shade, using
Brazilian cattle breeds, Livestock Science 120 (2009) water only for short periods and/or in situations of a 256-264. [2] P.B. Müller, Bioclimatologia Aplicada Aos Animais
more pronounced heat stress, or if that is the only Domésticos, 3o Edi. Porto Alegre, Sulina, Brasil, 1989, recourse. On the other hand, the Angus behaved
pp. 83-101, 144-146, 206-214, 228-232. (in Portuguese) differently as it resorted to water immersion when
[3] D.S. Ablas, E.A.L Titto, A.M.F. Pereira, C.G. Titto, thermal discomfort was felt, choosing to dissipate T.M.C. Leme, Comportamento de bubalinos a pasto frente a disponibilidade de sombra e água para imersão,
metabolic and acquired heat by convection and Ciência Animal Brasileira 8 (2) (2007) 167-175. (in endogenous heat loss due the effect of evaporation of
Portuguese)
water that remains on the skin [25, 26]. These
V.A. Finch, Heat as a stress factor in herbivores under differences between breeds can be explained by their tropical conditions, in: F.M.C. Gilchrist, R.I. Mackie (Eds.), Herbivore Nutrition in the Subtropics and Tropics, origin. Although the Caracu breed is a descendant of
The Science Press, South Africa, 1984, pp. 89-105. European and African breeds (Bos taurus), it behaves
[5] R.E. McDowell, Bases Biológicas de la Producción similar to the Bos indicus, indicating a superior heat
Animal en Zonas Tropicales, Editorial Acribia, Zaragoza, 1972, pp. 31-61, 73-133. (in Portuguese)
tolerance. In spite of European descent, the fact that [6] G.L. Hahn, Dynamic responses of cattle to thermal heat
they have suffered a prolonged process of loads, Journal of Animal Science 77 (1999) 10-20.
What Do Cattle Prefer in a Tropical Climate: Water Immersion or Artificial Shade?
[7] A.M.F. Pereira, F. Baccari Jr., E.A.L. Titto, J.A. Afonso behaviours of low and high production dairy cows in a Almeida, Effect of thermal stress on physiological
hot environment, Applied Animal Behaviour Science 99 parameters, feed intake and plasma thyroid hormones
(2006) 1-11.
concentration in Alentejana, Mertolenga, Frisian and
B.D. Ford, Swamp buffaloes in large scale ranching Limousine cattle breeds, International Journal of
systems, in: N.M. Tulloh, J.H.G. Holmes (Eds.), Buffalo Biometeorology 52 (2008) 199-208.
Production, Elsevier, Amsterdam, 1992, pp. 465-481. [8]
A.F. Fraser, D.M. Broom, Farm animal behaviour and tolerance and the effects of shade on the behavior of
C.G. Titto, E.A.L. Titto, R.M. Titto, G.B. Mourão, Heat
welfare, Baillière Tindall, London, 1997. Simmental bulls on pasture, Animal Science Journal 82
[18] P. Martin, P. Bateson, Measuring Behavior: An (2011) 591-600.
Introductory Guide, Cambridge University Press, [9]
F. Baccari Júnior, Manejo ambiental da vaca leiteira em
Cambridge, 1986.
climas quentes, Editora UEL Brasil, Londrina, 2001, pp. [19] J.K. Blackshaw, A.W. Blackshaw, Heat stress in cattle 11-41, 85-99. (in Portuguese)
and the effect of shade on production and behaviour: A [10]
B. Scharf, M.J. Leonard, R.L. Weaber, T.L. Mader, G.L. review, Australian Journal of Experimental Agriculture Hahn, D.E. Spiers, Determinants of bovine thermal
34 (1994) 285-295.
response to heat and solar radiation exposures in a field [20] F.M. Mitlöhner, M.L. Galyean, J.J. McGlone, Shade environment, International Journal of Biometeorology 55
effects on performance, carcass traist, physiology, and (2011) 469-480.
behavior of heat-stressed feedlot heifers, Journal of [11] P.E. Kendall, P.P. Nielsen, J.R. Webster, G.A. Verkerk,
Animal Science 80 (2002) 2043-2050. R.P. Littlejohn, L.R. Matthews, The effects of providing
[21] S.E. Curtis, Environmental Management in Animal shade to lactating dairy cows in a temperate climate,
Agriculture, Animal Environment Services, Mahomet, IL, Livestock Science 103 (2006) 148-157.
[12] C.B. Tucker, A.R. Rogers, K.E. Schütz, Effect of solar
C. Phillips, Cattle Behaviour and Welfare, Blackwell radiation on dairy cattle behaviour, use of shade and body
Publishing, Oxford, 2002, pp. 123-146. temperature in a pasture-based system, Applied Animal
[23] E.S.E. Hafez, Adaptacion de los Animales Domésticos, Behaviour Science 109 (2008) 141-154.
Labor, Barcelona, 1973. (in Spanish) [13] J.B. Gaughan, T.L. Mader, S.M. Holt, M.L. Sullivan, G.L.
[24] G.W. Arnold, M.L. Dudzinski, Ethology of Free-Ranging Hahn, Assessing the heat tolerance of 17 beef cattle
Domestics Animals, Elsevier Scientific Publishing genotypes, International Journal of Biometeorology 54
Company, Amsterdam, 1978, pp. 1-44. (2010) 617-622.
F.D. Glaser, Behavioral patterns of Angus beef cattle [14] K.E. Schütz, A.R. Rogers, N.R. Cox, C.B. Tucker, Dairy
under grazing conditions with availability of shade and cows prefer shade that offers greater protection against
water for immersion, M.Sc. Thesis, FZEA-USP Brazil, solar radiation in summer: Shade use, behavior, and body
temperature, Applied Animal Behaviour Science 116
D. McFarland, Animal Behaviour: Psychobiology, (2009) 28-34.
Ethology and Evolution, Prentice Hall, 1999, pp. [15]
I. Tapki, A. Sahin, Comparison of the thermoregulatory
289-294.
Journal of Life Sciences 6 (2012) 1363-1370
Genetic Parameters for Udder Traits in Slovak Dairy Sheep and Their Crosses with Specialized Breeds
1 1 Milan Margetín 3 , Marta Oravcová , Dušan Apolen and Michal Milerski 1. Animal Production Research Centre Nitra, Lužianky 95141, Slovak Republic
2. Slovak University of Agriculture, Nitra 94976, Slovak Republic 3. Institute of Animal Science, Prague 10400, Czech Republic
Received: June 08, 2012 / Accepted: August 13, 2012 / Published: December 30, 2012.
Abstract: Genetic parameters for udder morphology traits either subjectively assessed or exactly measured, and a combination of both sets of traits were estimated using multi-trait animal model and algorithm REML (program VCE 4.0). Purebred Tsigai and Improved Valachian breeds, and crossbreds with Lacaune and East Friesian were studied. Subjectively assessed traits included udder depth (UD), cistern depth (CD), teat placement (TP), teat size (TS), udder cleft (UC), udder attachment (UA) and udder shape (US). Exact measurements included udder length (UL), udder width (UW), udder depth (UDEx), cistern depth (CDEx), teat length (TL) and teat angle (TA). Heritabilities estimated for subjectively assessed traits were lower than those estimated for exact measurements and ranged from 0.090 (UA) to 0.294 (CD). Heritabilities estimated for exact measurements ranged from 0.102 (UW) to 0.448 (CDEx). In simultaneous evaluation of four subjectively assessed traits and corresponding exact measurements, heritabilities remained almost the same. High genetic correlations (0.855 to 0.937) between UD and UDEx, CD and CDEx, TS and TL and between TP and TA were found. These findings allow presuming that genetic evaluation based on subjectively assessed traits could become an effective tool in selection programs aimed at improvement of udder morphology in dairy ewes.
Key words: Dairy sheep, mammary gland, morphology traits, heritability, genetic correlation.
1. Introduction Udder morphology traits have also been of great interest in recent research focused on dairy sheep
Dairy breeds and their crosses represent about 80% abroad [1]. Because of the linkage to milking ability of total number of sheep in Slovakia (391 ths. heads in and udder health, these traits have been taking a more 2011). Breeding is predominantly aimed at increasing important role in breeding programs [2-4]. Attention milk yield, prolificacy and lamb growth. Breeding has been also paid to udder cisterns as cistern size values of respective traits are routinely incorporated in affects milk amount during machine milking [5-7]. selection programs. Due to fact that hand milking has Studies on factors affecting variation of udder traits in been replaced by machine milking in last few years, dairy sheep [7-9] as well as studies on genetic breeders are increasingly interested in udder analyses in various breeds [10-12] can be found in morphology of ewes. Selection for udder morphology literature. Moderate heritabilities were reported can be done through traits that can be easily taken (summarized in Ref. [7]), suggesting ewes would within existing recording schemes without significant respond well to selection pressure. Genetic evaluation additional costs, provided that experienced technicians was mostly based on linear scoring system (nine-point are available. scale); nevertheless, factors affecting exact
measurements of udder morphology and their Corresponding author: Milan Margetín, Ph.D., associate
professor, research fields: small ruminant husbandry and relationships with subjectively assessed traits as well genetics. E-mail: margetin@cvzv.sk.
1364 Genetic Parameters for Udder Traits in Slovak Dairy Sheep and Their Crosses with Specialized Breeds
as with milk, protein and nonfat solids yield were also were carried out about twelve hours after milking. studied [7, 13, 14]. In Slovak dairy sheep, no genetic
Linear scores for seven traits were assigned by one analyses of udder morphology traits have been done
experienced technician using a nine-point scale: udder until now.
depth (1-low, 9-high), cistern depth below the teat Therefore, the objective of this study was to
level (1-none, 9-high), teat placement (1-vertical, estimate genetic parameters for udder traits that were
9-horizontal), teat size (1-short teats, 9-long teats), either subjective assessments or exact measurements.
udder cleft (1-nondetectable, 9-expressive), udder Mutual relationships within and between these two
attachment (1-narrow, 9-wide) and udder shape with sets of traits were analyzed in order to propose an
respect to machine milking (1-bad, 9-ideal). Moreover, optimal system of genetic evaluation, being as simple
exact measurements of six traits (Fig. 1) were taken. as possible.
These included the following traits: udder length (measured with a tape, mm), udder width (mm), (rear)
2. Materials and Methods
udder depth (mm), cistern depth (mm), teat length The experiment was carried out in ewes belonging
(mm) and teat angle (°). Subjective assessments and to the flock of an experimental farm of the Animal
exact measurements of udder morphology traits were Production Research Centre Nitra during seven
carried out on 381 and 355 ewes, respectively. Of consecutive years from 2002 to 2008. First, second or
those 381 ewes sired by 44 sires, 86 were purebred third (and later) parity ewes were machine milked
Tsigai, 70 were purebred Improved Valachian, 76 were twice a day after weaning period, since May to August.
purebred Lacaune, 69 were crosses of Tsigai and They were either purebreds of Tsigai and Improved
specialized dairy breeds (5 with genetic portion 25%, Valachian breeds or crossbreds of one of these breeds
52 with genetic portion 50% and 12 with genetic with Lacaune and East Friesian sheep having genetic
portion 75% of specialized dairy breeds) and 80 were portion 25%, 50% and 75% of specialized dairy
crosses of Improved Valachian and specialized dairy breeds. Purebred Lacaune ewes were also included in
breeds (21 with genetic portion 25%, 30 with genetic the experiment. Ewes were recorded repeatedly within
portion 50% and 29 with genetic portion 75% of and between lactations, therefore 1,275 (linear specialized dairy breeds). Pedigree consisted of 586 assessments) and 1,185 (exact measurements) data
animals (of those, 524 were females and 62 were sets were collected in total. Subjective assessments
males). When data set of 355 ewes was considered, and exact measurements of udder morphology traits
the respective numbers were slightly smaller.
Fig. 1 Udder measurements. A: udder length; B: udder width; C: (rear) udder depth; D: cistern depth; E: teat length; α: teat angle from vertical (as given in Ref. [7]).
Genetic Parameters for Udder Traits in Slovak Dairy Sheep and Their Crosses with Specialized Breeds 1365
Descriptive statistics and model developments were where y is the vector of observations; β is the vector of done using MEANS, GLM and MIXED procedures in
unknown parameters for fixed effects; a and p are the the statistical package SAS [15]. Fixed effects were
vectors of unknown parameters for random additive included in the model on the basis of the significance
genetic and permanent environmental effect, level and the ratio of explained variance. Preliminary
respectively; e is the vector of residuals; X is the investigations [7, 16] showed a need for joint analysis
incidence matrix for the fixed effects; Z a and Z p are of all breeds and breed groups due to a smaller
the incidence matrices for random additive genetic number of data, especially in crossbreds of Tsigai with
effect and permanent environmental effect, genetic portion 25% of specialized dairy breeds.
respectively.
Genetic parameters and the remaining covariance The expected value of observations is assumed to components were estimated using multi-trait
be equal to X and the expected values for all random repeatability animal model and algorithm REML
effects are assumed to be equal to zero: (restricted maximum likelihood) as implemented in
E y X and E a E p E e 0 (3)
the program package VCE 4.0 [17]. with phenotypic variance V in matrix notation as The same model was used for three sets of udder
follows:
traits i.e. those of linear assessments, of exact
V var
' y Z
(4) measurements and a combination of both:
where G is the variance component for random
y ijklmn yp i S i G k P i a m p n e ijklmn (1)
additive genetic effect; P is the variance component where y ijklmn is the vector of individual observation of
for random permanent environmental effect of ewe; trait;
is the intercept; YQ i is the fixed effect of test and R is the variance component for residual. year and test period within year (seven years and four
The structure of individual covariance components periods a year: 27 levels in case of linear assessments
in matrix notation was as follows: due to fact that only three periods were considered in
2008 and 23 levels in case of exact measurements and (5) joint evaluation due to fact that ewes were not
measured in 2007); S j is the fixed effect of lactation where I p and I e are the identity matrices for permanent stage (four levels in dependence on days in milk i.e.
environmental effect of ewe and residual. Both effects from day 40 to 99, from day 100 to 129, from day 130
are assumed to be uncorrelated on all individual levels. to 159, from day 160 to 210); G k is the fixed effect of
The relationship among levels of additive genetic genotype (nine levels in dependence on breed or
effect is described by the relation matrix A. crossbreed group i.e. Tsigai, Improved Valachian and
(Co)variances among udder traits within each level are crosses of either Improved Valachian or Tsigai with
presented by matrices G 0 for additive genetic effect, genetic portion of specialized dairy breeds: Lacaune
P 0 for permanent environmental effect of ewe and R 0 and East Friesian 25%, 50% and 75%; also purebred
for residual. All residuals are assumed to be Lacaune ewes were included); P l is the fixed effect of
independent and normally distributed. Symbol parity (three levels i.e. 1st, 2nd and 3rd); a m is the
represents the Kronecker product. additive genetic effect with complete relationship
3. Results and Discussion
included; p n is the permanent environmental effect of ewe; and e ijklmn is the residual.
Basic statistics for two sets of investigated udder The matrix form of the model was as follows:
morphology traits in Slovak sheep is given in Table 1. y X Z a a Z p p e Out of all subjectively assessed traits, the lowest (2)
1366 Genetic Parameters for Udder Traits in Slovak Dairy Sheep and Their Crosses with Specialized Breeds
average value was found for teat size (4.49) and the Also in comparison to Churra ewes [9], the largest highest average value was found for udder attachment
difference 14% was found in teat placement (4.48 vs. (5.41). As a general pattern, mean values of all
5.20). In Lacaune ewes [19], more horizontally subjectively assessed traits were about 5. Linear
placed teats (6.74) and slightly more visible udder scores ranged from 1 to 9 for most traits (only
cleft (4.99) in comparison to Slovak dairy sheep were exception was udder attachment and udder shape,
found. Both traits were assessed by lower values in respectively). The highest variability was found for
Slovak Lacaune (not published) than in French cistern depth and teat placement (39.26% and 34.44%,
Lacaune ewes.
respectively). In the earlier study [18] dealing with the Out of all exactly measured traits, the highest same breeds, slightly higher values for udder depth
variability was found for cistern depth (61.39%), (5.10 vs. 5.04), cistern depth (5.10 vs. 4.99), teat
whereas the remaining traits were of the lower placement (5.40 vs. 5.20) and udder shape (5.30 vs.
variability (30% at maximum). Similar values of exact
5.28) were found. Slightly lower values were found measurements to those reported in the earlier study for udder cleft (4.80 vs. 4.82), teat size (4.30 vs. 4.49)
[18] dealing with the same breeds were found (udder and udder attachment (5.30 vs. 5.41). Similar to Ref.
length: 251.50 mm vs. 248.72 mm, udder width: [18], the highest values of subjective assessments (not
119.04 mm vs. 118.60 mm, udder depth: 155.00 mm published) were found in purebred Lacaune ewes
vs. 154.11 mm, teat length: 34.77 mm vs. 34.30 mm (with exception of udder cleft and udder attachment).
and teat angle: 45.10° vs. 44.45°). The highest The lowest values were found in purebred Tsigai and
difference about 14% was found in cistern depth Improved Valachian. In Manchega ewes [11], almost
(25.33 mm vs. 21.80 mm). The pattern of distribution the same values were found; with largest differences
of values across genotypes was the same as that of about 13% in teat placement (4.53 vs. 5.20) and udder
subjective assessments (not published). When shape (4.63 vs. 4.99). The lower differences were
comparisons with study on only purebred Tsigai, found in udder depth, udder attachment and teat size.
Improved Valachian and Lacaune ewes [7] were done,
Table 1 Descriptive statistics for subjective assessments and exact measures of udder traits.
Mean S.D. CV Min. Max. Subjective assessments Udder depth
31.55 1 9 Cistern depth
39.26 1 9 Teat placement
34.44 1 9 Teat size
31.78 1 9 Udder cleft
31.68 1 9 Udder attachment
23.68 2 9 Udder shape
29.34 2 9 Exact measurements Udder length (mm)
570 Udder width (mm)
18.46 15.51 70 190 Udder depth (mm)
34.64 22.48 10 310 Cistern depth (mm)
25.33 15.55 61.39 0 85 Teat length (mm)
34.77 6.05 17.40 20 70 Teat angle (˚) 44.45 13.40 30.15 0 90
S.D.: standard deviation; CV: coefficient of variation in %; N = 1275 (Number of observations—linear assessments); N = 1185 (Number of observations—exact measurements).
Genetic Parameters for Udder Traits in Slovak Dairy Sheep and Their Crosses with Specialized Breeds 1367
larger differences between exact measurements were whereas the heritability estimated for udder depth and observed (i.e. 21% in udder length: 196.1 mm vs.
udder cleft were found almost the same. In Latxa 248.72 mm). Almost the same udder length and udder
sheep [20], the higher heritabilities estimated for teat width were found in Slovak and Turkish ewes
placement, teat size (both 0.40), udder depth and (difference less than 10%), whereas two-time udder attachment (0.28 and 0.26) were found. In shallower udder depth was found in Turkish ewes [13].
Manchega sheep [11], the trend in estimates was the Teats in Turkish ewes were less horizontally placed
same as in Slovak sheep (with slightly lower (teat angle lower by 13°).
heritability estimates reported). The highest Estimates of heritability and genetic correlations of
heritability estimates were found for teat placement subjectively assessed traits of udder morphology in
(0.20) and udder depth (0.19) and the lowest Slovak sheep are given in Table 2. Heritabilities
heritability was found for udder attachment (0.06). ranged from 0.090 (udder attachment) to 0.294
The authors attributed low heritability for udder (cistern depth). The low heritability was also found for
attachment to poor scores collected by classifiers as udder shape (0.117). The heritability estimates above
this is the only trait that needs a physical measure 0.210 were found for udder depth, teat placement and
(with the hands) instead of the visual measure, used teat size. An important finding is the moderate
for the remaining traits.
heritability estimated for teat placement (0.275) as this The highest positive genetic correlation between trait is closely linked to machine milking adaptation
cistern depth and teat placement (0.980) was found [11]. A wide range of heritability estimates with
(Table 2), indicating the same genes influence both different values for the same traits can be found in
traits. Slightly lower genetic correlations between literature. In Churra sheep [10], the heritability
udder attachment and udder shape (0.756), between estimates ranged from 0.16 (udder depth) to 0.24 (teat
udder depth and cistern depth (0.580) and between placement, udder shape). For udder attachment and
udder depth and teat placement (0.550) were found. teat size, heritabilities 0.17 and 0.18 were reported.
The moderate negative genetic correlations between When estimates found in Slovak sheep were compared
teat placement and teat size (-0.381) as well as to Lacaune sheep [19], almost the same heritability
between teat placement and udder cleft (-0.404) were estimate was found for udder depth (0.19), whereas
found. The correlation between udder depth and udder slightly higher heritability estimates were found for
attachment (-0.095) was weak and negative. It was teat placement (0.33) and udder cleft (0.26). In Sarda
considerable lower than in Spanish ewes [10, 20]; sheep [1], the higher heritability estimates were found
nevertheless, it indicates that improvement in udder for teat placement (0.33) and udder attachment (0.23),
depth could lead to udder attached in inappropriate
Table 2 Heritability coefficients (on diagonal) and genetic correlations (above diagonal) for subjective assessments of udder traits.
Trait 123 4567 Udder depth 0.217 0.580 0.550 0.005 -0.064 -0.095 0.445
Cistern depth
-0.261 -0.380 0.071 0.061 Teat placement
0.242 -0.381 -0.404 0.096 0.075 Teat size 0.275 -0.391 -0.117 0.096 Udder cleft 0.205 -0.323 -0.274 Udder attachment 0.090 0.756 Udder shape 0.117
1368 Genetic Parameters for Udder Traits in Slovak Dairy Sheep and Their Crosses with Specialized Breeds
way. Differences in signs and magnitudes of genetic evaluation of exact udder measurements can be correlations (and also magnitudes of heritabilities) in
found in literature [21, 22], making comparisons this study and those found in literature are probably
among breeds limited. Of these, two-time higher due to differences in models used, different amount of
heritabilities estimated for udder depth (0.50) and available pedigree information and a different genetic
teat length (0.60 and 0.70 for left and right teat structure within the breeds for these traits (stated in
length, respectively) were found in Chios sheep [21]. Ref. [11]).
In Polish Mountain sheep [22], heritabilities Heritabilities estimated for exactly measured traits
estimated for left and right teat length were 0.31 and (Table 3) were only slightly higher than those
0.58. The differences in heritabilities estimated for estimated for subjectively assessed traits. Genetic
exactly measured traits in this study and those found correlations between exact measurements were of the
in literature can be probably explained in similar way same sign and mostly of similar value or slightly
as differences found in genetic parameters estimated higher than genetic correlations between respective
for subjectively assessed traits [11].
subjectively assessed traits. The highest heritabilities In simultaneous genetic evaluation of four were found for cistern depth (0.448 vs. 0.29) and teat
subjectively assessed traits (udder depth, cistern depth, length (0.338 vs. 0.294). The highest genetic
teat placement and teat size) and corresponding exact correlation between cistern depth and teat angle
measurements (udder length, cistern depth, teat length (0.943) was found. Also, the high genetic and teat angle), heritability estimates of respective correlations between udder length and udder depth
traits changed minimally (14% to 18% at maximum) (0.923) and between udder length and udder width
and showed similar trends for both sets of traits (Table (0.525) were found. Few studies aimed at genetic
4). The highest heritabilities were estimated for exact
Table 3 Heritability coefficients (on diagonal) and genetic correlations (above diagonal) for exact measurements of udder traits.
Trait 1234 56 Udder length (mm)
0.525 0.923 0.301 0.231 0.233 udder width (mm)
0.259 0.319 0.059 0.526 Udder depth (mm)
0.215 Cistern depth (mm) 0.448 -0.143 0.943 Teat length (mm)
-0.286 Teat angle ( ° )
Table 4 Heritability coefficients and genetic correlations between chosen traits of subjective assessments and exact measurements of udder traits.
Subjective assessments
Exact measurements
12 3 4 56 7 8 Subjective assessments
Udder depth
-0.054 0.855 0.219 0.144 0.190 Cistern depth
-0.430 0.335 0.932 -0.384 0.953 Teat placement
-0.554 0.903 Teat size
0.937 -0.486 Exact measurements
Udder depth (mm)
0.085 0.186 Cistern depth (mm)
-0.186 0.953 Teat length (mm)
0.352 -0.415 Teat angle ( ° )
Genetic Parameters for Udder Traits in Slovak Dairy Sheep and Their Crosses with Specialized Breeds 1369
measurements of cistern depth and teat length (0.386
References
and 0.352) and subjectively assessed cistern depth and [1] S. Casu, I. Pernazza, A. Carta, Feasibility of a linear teat size (0.316 and 0.335). The highest genetic
scoring method of udder morphology for the selection correlations between subjectively assessed cistern
scheme of Sardinian sheep, Journal of Dairy Science 89 depth and teat position (0.953) as well as between (2006) 2200-2209. [2] S.R. Sanna, S. Casu, A. Carta, Breeding programmes in
exactly measured cistern depth and teat position dairy sheep, in: Proceedings of the 7th World Congress (0.953) were found. There were high genetic
on Genetics Applied to Livestock Production, correlations between teat size and teat length (0.937),
Montpellier, France, 2002, pp. 54-55.
between teat position and teat angle (0.903), between C. Marie-Etancelin, S. Casu, M.R. Aurel, F. Barillet, A. Carta, S. Deiana, et al., New tools to appriase udder
cistern depth subjectively assessed and cistern depth morphology and milkability in dairy sheep, exactly measured (0.932), between teat position and
CIHEAM–Options Mediteranees A55 (2003) 71-80. exactly measured cistern depth (0.871), and between
V. Tan čin, L. Mačuhová, M. Oravcová, K. Kulinová, M. subjectively assessed udder depth and exactly Uhrin čať, S. Roychoudhury, et al., Milkability
assessment of Tsigai, Improved Valachian, Lacaune and measured udder length (0.855). These findings
F1 crossbred ewes (Tsigai × Lacaune, Improved indicate close relationships between both sets of traits
Valachian × Lacaune) throughout lactation, Small and allow presuming that genetic evaluation based on
Ruminant Research 97 (2011) 28-34. [5] J. Labussiere, Review of physiological and anatomical
subjectively assessed traits could become an effective factors influencing the milking ability of ewes and the
tool in selection programs aimed at improvement of organization of milking, Livestock Production Science 18 udder morphology in ewes.
(1988) 253-274. [6] R.M. Bruckmaier, G. Paul, H. Mayer, D. Schams,
4. Conclusion
Machine milking of Ostfriesian and Lacaune dairy sheep: Udder anatomy, milk ejection and milk characteristics,
Heritabilities estimated for udder morphology traits Journal of Dairy Research 64 (1997) 163-172. (either subjectively assessed or exactly measured)
[7] M. Milerski, M. Margetín, A. Čapistrák, D. Apolen, J. indicated that genetic variability in these traits could Špánik, M. Oravcová, Relationship between external and internal udder measurements and the linear scores for
exist and be exploited in breeding programs. High udder morphology traits in dairy sheep, Czech Journal of genetic correlations between subjectively assessed and
Animal Science 51 (2006) 383-390. exactly measured traits indicate close relationships
G. Fernandez, P. Alvarez, F. San Primitivo, L.F. de la between both sets of traits and allow presuming that Fuente, Factors affecting variation of udder traits of dairy
ewes, Journal of Dairy Science 78 (1995) 842-849. selection of ewes based on subjectively assessed traits
[9] L.F. de la Fuente, G. Fernandez, F. San Primitivo, A could become an effective tool to identify individuals
linear evaluation system for udder traits in dairy sheep, with high milk yield and good milking ability, without
Livestock Production Science 45 (1996) 171-178.
G. Fernandez, J.A. Baro, L.F. de la Fuente, F. San
a need of exact udder measurements to be taken. Primitivo, Genetic parameters for linear udder traits of
dairy ewes, Journal of Dairy Science 80 (1997) 601-605.
Acknowledgments
[11] M. Serrano, M.D. Pérez-Guzmán, V. Montoro, J.J. Jurado, Genetic analysis of udder traits in Manchega ewes,
The work was supported by the Slovak Research Livestock Production Science 77 (2002) 355-361.
and Development Agency (contract No. [12] S. Casu, S. Sechi, S.L. Salaris, A. Carta, Phenotypic and APVV-0458-10) and by the Ministry of Agriculture
genetic relationships between udder morphology and and Regional Development of the Slovak Republic udder health in dairy sheep, Small Ruminant Research 88
(2010) 77-83.
(contract No. RÚVV0910503/10/16/0000003). M. [13] S.O. Altincekic, M. Koyuncu, Relationship between
Milerski was supported by the project NAZV QH udder measurements and the linear scores for udder 91271.
morphology traits in Kivircik, Tahirova and Karacabey
1370 Genetic Parameters for Udder Traits in Slovak Dairy Sheep and Their Crosses with Specialized Breeds
Merino, Kafkas Universitesi Veteriner Fakultesi Dergisi, Porovnanie morfologických ukazovate ľov vemena The Journal of the Faculty of Veterinary, University of
rôznych genotypov oviec (Comparision of morphologic Kafkas Medicine 17 (2011) 71-76.
traits of udder in various genotypes of sheep), Acta [14] L. Iniguez, M. Hilali, D.L. Thomas, G. Jesry, Udder
Fytotechnica et Zootechnica 9 (2006) 180-182. (in measurements and milk production in two Awassi sheep
Slovak)
genotypes and their crosses, Journal of Dairy Science 92
C. Marie-Etancelin, J.M. Astruc, D. Porte, H. Larroque, C. (2009) 4613-4620.
[19]
Robert-Granié, Multiple-trait genetic parameters and [15] SAS Institute Inc. SAS/STAT ® 9.2, User’s Guide, 2nd
genetic evaluation of udder-type traits in lacaune dairy ed., SAS Institute Inc., Cary, NC, 2009.
ewes, Livestock Production Science 97 (2005) 211-218. [16] M. Margetín, M. Milerski, D. Apolen, A. Čapistrák, M.
A. Legarra, E. Ugarte, Genetic parameters of udder traits, Oravcová, Morphology of udder and milkability of ewes
[20]
somatic cell score and milk yield in Latxa sheep, Journal of Tsigai, Improved Valachian, Lacaune and their crosses,
of Dairy Science 88 (2005) 2238-2245. ICAR Technical Series 10 (2005) 255-258.
[21] A.P. Mavrogenis, C. Papachristoforou, P. Lysandrides, A. [17]
E. Groeneveld, L.A. García-Cortes, VCE 4.0, A Roushias, Environmental and genetic factors affecting (co)variance components package for frequentists and
udder characters and milk production in Chios sheep, bayesians, in: Proceedings of the 6th World Congress on
Genetics Selection Evolution 20 (1988) 477-488. Genetics Applied to Livestock Production, Armidale,
[22] K.M. Charon, Genetic parameters of the morphological Australia, 1998, pp. 455-456.
traits of sheep udder, World Review of Animal [18] A. Čapistrák, M. Margetín, D. Apolen, J. Špánik,
Production 35 (1990) 73.
Journal of Life Sciences 6 (2012) 1371-1377
Amino Acid and Fatty Acid Profile in Epidermal Mucus of Bluestreak Cleaner Wrasse (Labroides dimidiatus): Possible Role as Defense Mechanism against Pathogens
Maziidah Ab Rahman 1 , Roslan Arshad , Faizah Shaharom and Nur Asma Ariffin 1. Faculty of Fisheries Science and Aqua-Industry, Universiti Malaysia Terengganu, Kuala Terengganu 21030, Terengganu,
Malaysia
2. Faculty of Food Technology, Universiti Sultan Zainal Abidin, City Campus, Kuala Terengganu 20400, Terengganu, Malaysia 3. Institute of Tropical Aquaculture, Universiti Malaysia Terengganu, Kuala Terengganu 21030, Terengganu, Malaysia
Received: December 29, 2011 / Accepted: September 17, 2012 / Published: December 30, 2012.
Abstract: Labroides dimidiatus has been proven to remove ectoparasites and monogeneans from client fishes and studies showed that they were not infected with the parasite. Due to this, there is a possibility that a defense mechanism against pathogen and parasitic invasion exist in the epidermal mucus which serves as a mechanical as well as biochemical barrier. The study was performed to identify the amino acid and fatty acid components using GC (gas chromatography) and HPLC (high performance liquid chromatography) in epidermal mucus of L. dimidiatus. The present study revealed 16 components of amino acid and 22 types of fatty acid in epidermal mucus of L. dimidiatus. Linoleic acid (C18:2n6c) was the most prominent PUFA (polyunsaturated fatty acid) which contributed approximately 11.69% of total fatty acids. The other major fatty acids are palmitic acid (C16:0), oleic acid (C18:1n9c), linoledaidic acid (C18:2n6t), arachidic acid (C20:0), Gamma-Linoleic acid (C18:3n6) and gadoleic acid (C20:1) which contained reasonable amounts of 9.52%, 8.06%, 6.26%, 8.33%, 6.21% and 9.05% of total fatty acids, respectively. This present study also demonstrated the presence of various amino acids in skin extract. Glycine, glutamine, arginine, asparagin and alanine were found at high concentration of 8.09%, 6.95%, 5.73%, 4.74%, 4.58% respectively. The most abundance percentage of linoleic acid (C18:2n6c) was found to be the metabolic precursor of arachidonic acid (AA) which inducing platelet aggregation, facilitate the blood clotting process and adhesion in endothelial cells during wound healing and might be responsible for rapid tissue growth in L. dimidiatus. It can be concluded that the amino acid and fatty acid profile from the epidermal mucus of L. dimidiatus contains most of the essential components required to play a possible role in its defense mechanism. Understanding the biochemical properties of L. dimidiatus epidermal mucus in defense mechanism would enable to determine how this fish protect itself from parasitic infection.
Key words: Labroides dimidiatus, defense mechanism, amino acid, fatty acid, epidermal mucus.
1. Introduction communities [1]. The impact of cleaning organisms on the health and diversity of fish species, as they
Bluestreak cleaner wrasse (L. dimidiatus) is a coral removed parasites and necrotic tissues has been reef fish which broadly distributed from tropical to subject to major research particularly in marine temperate waters of the Western Pacific and Indian environment worldwide [2, 3]. L. dimidiatus are small Ocean. They are commonly part of coral reefs fish fish specialized in removing invertebrate ectoparasites,
Corresponding author: Nur Asma Ariffin, Ph.D., research mucus and damaged tissue from other fish so called fields: genetics and molecular biology. E-mail: nurasma@umt.edu.my.
client fish. They clearly get benefit from this unique
Amino Acid and Fatty Acid Profile in Epidermal Mucus of Bluestreak Cleaner Wrasse
(Labroides dimidiatus): Possible Role as Defense Mechanism against Pathogens
feeding habit and also provided some benefits to the disease resistance, respiration, ionic and osmotic client fish [4]. L. dimidiatus often site-attached and
regulation, locomotion, reproduction, communication, the sites they occupy on reefs are known as cleaning
feeding and nest building. Some studies have shown station.
that the mucus layer on the surface of fish is In the Indo-Pacific areas, L. dimidiatus was the
continuously replaced, which possibly prevents stable most ubiquitous cleaner fish by cleaning hundreds of
colonization by parasites, bacteria and fungi [13, 14]. different fish species and has impact on parasites
Amino acid is sub-components of a complex abundance [5]. These unique feeding habits might
protein and very important in the mechanical pathway suggest that L. dimidiatus has potential to control
in defense mechanism of organisms. Study by Concha parasite loads on fish in captivity. Moreover, this
et al. [12] has detected the presence of apolipoprotein species has been reported to feed wide range of
A-I (apoA-I) in the skin and epidermal mucus of carp parasites from crustacean parasites, monogeneans, and
(C. carpio) which is the principle protein constituent sea lice [5-8].
of HDL (high density lipoprotein) that has resulted in However, there was no report show L. dimidiatus
a high abundance of protein plasma acts as innate infected with parasites from its clients so far.
defense mechanism in teleost fish [15]. Therefore, there is no doubt that this cleaner fish have
Various studies have been done on amino acid and
a unique defense mechanism on the epidermal mucus fatty acid composition such as in Haruan (Channa since the mucus is the frontier protective barrier
striatus ) extract that initiate the wound healing between the fish and the environment.
process of the fish [16]. A study performed by Mat
Understanding the biochemical process and Jais et al. [17], indicate epidermal mucus of Haruan properties such as amino and fatty acid composition in
composed major essential fatty acid which L. dimidiatus is essential to understand how its
strengthening the ability of haruan possesses bioregulation of defense mechanism pathway to
traditional remedy for wound healing. In more cases maintain their structure and function.
of the protective function of epidermal mucus, Haruan It have been reported that the epithelial surfaces of
mucus which contain several essential amino and fatty fish such as the skin, gills, and the alimentary tract
acid exhibited some antinociceptive properties in mice provide frontier contact with infectious agents [9, 10].
[16, 17]. Therefore, this study was performed to Therefore, the epidermis and epidermal mucus of fish
identify the amino acid and fatty acid components that compose several biochemical properties that provide a
might be the potential role as defense mechanism in L. first line of defense against invading pathogens. The dimidiatus .
secretion of epidermal mucus originates from the
2. Materials and Methods
epidermal skin [11] consists of two layers; the
2.1 Fish for Mucus Collection
epidermis and inner dermis [12]. Both of them functions as the first barrier between external and
Twenty two samples of L. dimidiatus were obtained internal environment [12].
from local fish supplier, Kuala Terengganu with Shepherd [13] showed that the epidermal mucus is
average size of 0.5-2.8 g. The epidermal mucus produced primarily by epidermal goblet or mucus
collection was done according to Ross et al. [18] with cells and is composed mainly of water and slight modification. The samples were transferred into gel-forming macromolecules including mucins and
50 mL sterile falcon tube containing 10 mL of 100 other glycoprotein. The mucus layer on the fish
mM of NaCl. Each tube consists of three samples. The surface performs a number of functions including
tubes were roughly shaken by hand for about 15 min
Amino Acid and Fatty Acid Profile in Epidermal Mucus of Bluestreak Cleaner Wrasse
(Labroides dimidiatus): Possible Role as Defense Mechanism against Pathogens
to slough off the mucus. Then the mucus obtained
2.2.2 High Performance Liquid Chromatography were pooled and centrifuged at 1,500× g for 10 min,
Conditions
C. The supernatant obtained was stored at -80 o C. The amount of 5 µL of extract was subjected to The mucus then put in the freezer drier (± 36 h) until
High Performance Liquid Chromatography for further dried completely.
amino acid analysis. The dimensions of the AccQ-Tag Column were 3.9 mm × 150 mm [WAT052885] with
2.2 Determination of Amino Acid Composition of Fluorescence Detector: Ex—250 nm, EM—395 nm. Epidermal Mucus of L. dimidiatus Mobile phase for the chromatography process are A:
2.2.1 Determination of Amino Acids AccQ Tag Eluent A, B: 60% CAN. Column The analysis of amino acid composition of
temperature was maintained at 36 °C. Peak integration epidermal mucus of L. dimidiatus was performed with
was interpreted and calculated with the Software minor modification, according to the methods version 2.1 provided by the supplier. Amino acids described by Zakaria et al. [16]. The epidermal mucus
were identified by comparison with the amino acid of L. dimidiatus (0.1-0.2 g) was hydrolysed with 5 mL
authentic standards.
of 6 mol/L hydrochloric acid in a closed test tube,
2.3 Determination of Fatty Acid Composition of shaken for 15 min and then flushed with nitrogen for 1
Epidermal Mucus of L. dimidiatus min prior to being put in for 24 h at 110 C.
2.3.1 Determination of Fatty Acid a-aminobutyric acid (AABA) was added to each
After cooling, 10 mL of the internal standard
Lipid extraction of the epidermal mucus sample sample prior to the addition of 20 mL redrying TM was prepared using Foss Soxtec 2055 Fat
solution (methanol:water:triethylamine, 2:2:1, v/v/v) Extraction System. Two gram of homogenized fish and 20 mL derivatization reagent (methanol: mucus sample was weighed and then dried in an oven triethylamine:water:phenylisocynate, 7:1:1:1, v/v/v/v).
C) was The mixture was then poured into volumetric flasks
at 115 o
C for 2 h. Petroleum ether (B.P. 35-60 o
selected as the extraction solvent. The following and deionized water was added to a final volume of o operating conditions were used: temperature at 135 C;
100 mL. Approximately 5-15 mL of the upper layer boiling time of 20 min; rinsing time of 40 min; and was discarded; the rest of the upper layer was filtered
recovery time of 10 min. Solvent from the extracted through filter paper.
fat was evaporated under vacuum. The hydrolysed sample obtained after filtration was
The resultant fat was converted to its FAMEs (fatty kept for up to four weeks at -20 o
acid methyl esters). Corresponding FAMEs of the fish injection onto an HPLC, the hydrolysed sample was
C until use. Before
mucus samples were prepared as per the method filtered using a syringe filter. Then, 10 µL filtered
IUPAC 2.301 (IUPAC, 1987). This method was sample was put into a vial and the same volume of
specific for the preparation of FAMEs for oils and fats internal standard was added before the sample was
having an acid value of less than 2. dried under a vacuum for 30 min. The redrying
2.3.2 Gas Chromatographic Conditions solution (70 µL) was then added to the dried sample
The amount of 5 µL of lipid extract was subjected and the mixture was shaken vigorously for 15 min.
to GC-FID (gas chromatography-flame ionization The sample was dried again under vacuum for 30 min,
detector) (HP5890 Series II) for further fatty acid followed by the addition of 20 µL derivatization
analysis. The dimensions of the capillary column were reagent. The sample was kept at -20 o
100 mm × 0.25 mm. The temperature program was as by HPLC. o follows: initial temperature, 140
C until analysis
C (hold for 5 min);
Amino Acid and Fatty Acid Profile in Epidermal Mucus of Bluestreak Cleaner Wrasse
(Labroides dimidiatus): Possible Role as Defense Mechanism against Pathogens
temperature rate, 4 o C/min; final temperature, 240 C mucus of L. dimidiatus was linoleic acid (C18:2n6c) for a final holding time of 20 min. The detector and
which accounted for approximately 11.69% ± 0.07% injector port temperatures were maintained at 240 o C. of total fatty acids (Fig. 2 and Table 2).
Helium was used as the carrier gas at a flow rate of The other major fatty acids included palmitic acid
1.3 mL/min. Inlet pressure was 20 psi of 1 mL/min (C16:0), oleic acid (C18:1n9c), linoledaidic acid and overall runtime was 45 min.
(C18:2n6t) and arachidic acid (C20:0) and Peak integration was interpreted and calculated with
gamma-linoleic acid (C18:3n6) and gadoleic acid the chrom Card Software version 2.1. Fatty acids were
(C20:1) which accounted for 9.52% ± 0.07%, 8.06% ± identified by comparison with the authentic standards
0.08%, 6.26% ± 0.00%, 8.33% ± 0.00%, 6.21% ±0.00% Supelco 37 Component Fame Mix (Cat. No: 18919).
Table 1 Amino acid composition in epidermal mucus of L.
3. Results and Discussion
dimidiatus .
Amino acid
% amino acid ± S.D.
3.1 Amino Acid and Fatty Acid Composition of L.
6.955 ± 2.33 This present study demonstrated the presence of
Glutamine
8.094 ± 0.63 various amino acid and fatty acid in mucus extract. All
Glycine
1.008 ± 0.20 sixteen indispensable amino acid such as glycine,
2.137 ± 0.31 glutamine, arginine, asparagin and alanine were found
Threonine
4.579 ± 1.88 at high concentration of 8.09% ± 0.63%, 6.95% ±
1.239 ± 0.36 1.88%, respectively (Fig. 1 and Table 1).
1.749 ± 0.56 The other amino acid not stated were exist with
Methionine
3.244 ± 0.73 very low concentration. Meanwhile, there were 22
Lysine
1.628 ± 0.59 components of fatty acid present in the profiling and
Isoleucine
3.124 ± 0.96 the most abundant fatty acid present in epidermal
Fig. 1 Amino acid profiling of epidermal mucus of L. dimidiatus.
Amino Acid and Fatty Acid Profile in Epidermal Mucus of Bluestreak Cleaner Wrasse
(Labroides dimidiatus): Possible Role as Defense Mechanism against Pathogens
Palmitic acid
Oleic aci
Cis-eicosatrionic
Linoleic acid
Lauric acid
y ristic acid
decanoic 1.80%
ta
eneicosanoic acid
noceric acid
p Stearic acid
g Docosahexanoic a
H Docosadiecanoic acid
Li Nervonic acid
He
Fig. 2 Fatty acid profiling of epidermal mucus of L. dimidiatus.
Table 2 Fatty acid composition in epidermal mucus of L.
This amino acid together with other essential amino
dimidiatus .
acid such as alanine, proline, arginine, serine, Structure
isoleusine and phenylalanine form a polypeptides C12:0
Fatty acid
% in lipid ± S.D.
Lauric acid
which play a role in promoting regrowth and tissue C14:0
Myristic acid
C16:0 Palmitic acid
healing. Moreover, glycine is reported as scavengers C17:1 Cis-10-Heptadecanoic acid
to toxic substances when unite with benzoic acid to C18:0
form conjugates such as hippuric acid. The C18:1n9t
Stearic acid
requirement for glycine may also increase if infection C18:1n9c
or contamination happen because of the massive C18:2n6c
C18:2n6t Linolelaidic
synthesis of acute-phase proteins. Huang et al. [20] C18:3n6
Linoleic
have been proven and reported that a lipoamino acid C18:3n3
Gamma-Linoleic
called, arachidonoylglycine is expected to be part of C20:0
Alpha-linoleic acid
building block of various types of short peptide C20:1
Arachidic
Gadoleic acid
C20:3n6 cis-8,11,14-Eicosatrienoic
compounds and demonstrated suppressed edema and C20:3n3 cis-11,14,17-Eicosatrienoic
pain. This might reveal the capability of this fish to C21:0
tolerate infection environment or hosts since glycine C22:0
Heneicosanoic acid
was the highest concentration measured in the amino C22:2
Docosadienoic acid
acid composition which can stimulate rapid growth of C22:1n9
Cis-13,16-docosadiecanoic
Erucic Acid
cells.
Glutamine, which an excretory amino acid was C24:0
C22:6n3 Docosahexanoic acid
Lignoceric acid
found in high concentration in L. dimidiatus extract, synthesis of glutamine occurs within all tissues,
C24:1 Nervonic acid
and 9.05% ± 0.14% of total fatty acids, respectively. including adipose and brain but especially large Both amino and fatty acid are important component
amounts are produced by the muscle, lung and skin for healing processes and the deficient of those
[21]. Glutamine may also contribute to the defense components will hindered recovery pathway in an
mechanism in this fish towards parasitic infection, this organisms [16, 19]. Glycine was the most abundant
is due to the function of this amino acid which act as compound detected (8.09%) and also the most
an important role in the metabolism of cells in the important component in human skin collagen [16].
immune system, lymphocytes and macrophages.
Amino Acid and Fatty Acid Profile in Epidermal Mucus of Bluestreak Cleaner Wrasse
(Labroides dimidiatus): Possible Role as Defense Mechanism against Pathogens
There is a report showed that these immune cells use influence membrane fluidity and might give cell the carbon skeleton of glutamine as a fuel for the
structural rigidity to L. dimidiatus. This is because synthesis of RNA and DNA as well as of protein, their
membrane fluidity depends on the proportion of fatty production and proliferation of antibodies must
acids incorporated into membrane phospholipids that depend on an adequate supply of this substrate [21].
may affect many cell functions including cell The patterns of fatty acid composition from
structural rigidity [24].
seawater fish is slightly different compared to the Palmitic acid content showed 9.52% in this fatty freshwater fish, this can be due to the fact that
acid profiling. This saturated fatty acid reported to freshwater fish feed mainly on plant materials while
have antinociceptive activity in Haruan aqueous marine fish feed on zooplanktons such as crustaceans
extract [16]. Interestingly, this study also showed that and mollusks, which are rich in PUFA. Jabeen and
epidermal mucus extract of L. dimidiatus exhibits high Chaudhry [22] also shown that the freshwater fish had
content of palmitic acid which may help to clarify the lower content of PUFA than marine fishes. In
ability of this fish to survive in parasitic environment improving the health processes and curing illnesses in
due to the effect of antinociceptive activity. the body, PUFA play a vital role.
Nevertheless, further analysis needs to be done before According to Whelan [23], linoleic acid (C18:3) is
conclusive statement can be drawn on the bioactive the metabolic precursor of AA and bioactive compounds for wound healing in epidermal mucus of eicosanoids. Furthermore, arachidonic acid (C20:4) is
L. dimidiatus .
a precursor to prostaglandin and thromboxane