in response to infection by various strains of fun- gal pathogens [12]. These results indicate a possi-
ble role in the protection against pathogens, a role which has been confirmed by the finding that
nsLTPs isolated from seeds of radish and onion [13,14], and leaves of barley, maize [15], Arabidop-
sis, spinach [16] and sugar beet [17] displayed antipathogenic activity in vitro.
A major focus of the laboratory is to investigate the interaction between sugar beet Beta 6ulgaris
L. and the pathogen Cercospora beticola Sacc., the cause of leaf spot disease in sugar beet. Previ-
ously, a number of chitinases, glucanases and plant defensin-like proteins have been isolated and
their biological role examined [18 – 24].
Recently, the isolation of two nearly identical proteins from sugar beet showing antifungal activ-
ity in vitro against the pathogen C. beticola has been described [17]. The proteins were isolated
from the intercellular washing fluid IWF of sugar beet leaves and showed sequence homology to
plant nsLTPs. During infection, C. beticola re- mains in the extracellular environment [25] and
secreted proteins with antifungal activity could be advantageously applied against this specific patho-
gen. The isolation and characterization of a new protein, designated IWF5, from sugar beet leaves
is reported here. The protein consists of 92 amino acids and shows homology to nsLTPs including
the presence of eight conserved cysteine residues and displays strong antifungal activity in vitro
against spore cultures of C. beticola.
2. Materials and methods
2
.
1
. Biological materials and induction of resistance
Plants of sugar beet B. 6ulgaris L., cv. Monova, Danisco Seed were grown in growth chambers at
26°C from 07:30 h and 18°C from 18:30 h with a 54 relative air humidity. After 6 weeks, they
were sprayed four times with 25 ppm 2,6- dichloroisonicotinic
acid INA;
CGA 41369,
kindly supplied by Dr Theo Staub, Plant Protec- tion Division, Novartis, Basel, Switzerland at a
2-day interval. The INA, suspended in 0.05 Tween-20, was applied by spraying the adaxial leaf
surface INA acts as a chemical inducer of resis- tance against C. beticola [17] Two days after final
treatment, intercellular washing fluid was isolated as described below.
2
.
2
. Isolation and purification of IWF The IWF from 5 to 700 g sugar beet leaves was
isolated as described previously [17]. Briefly, 5 – 700 g sugar beet leaves were submerged in 20 mM
acetic acid, pH 4.5, incubated in vacuo in an exicator 5 min, 4 torr and infiltrated by release of
the vacuum. After air-drying of the leaves, the IWF was isolated by centrifugation at 1500 × g for
15 min. The IWF was subsequently purified by cation exchange chromatography on a CM-Sep-
harose column Pharmacia LKB, Sweden pre- equilibrated with starting buffer, 20 mM acetic
acid, pH 4.5. Bound proteins were eluted by step- wise increasing the salt concentration in the start-
ing buffer: 0.1 M, 0.3 M and 0.5 M NaCl. The 0.3 M NaCl eluate displaying antifungal activity was
further purified by cation exchange fast protein liquid chromatography FPLC on a Mono S HR
55 column Pharmacia LKB, Sweden equili- brated in 20 mM acetic acid, pH 4.5, containing
5 betaine A-buffer. Proteins were eluted with a linear salt gradient from 0 to 0.3 M NaCl in 30 ml
A-buffer with a flow rate of 1 ml min
− 1
.
2
.
3
. Protein analysis methods The individual protein peaks from the Mono S
column were further purified by reversed-phase high performance liquid chromatography HPLC
on a Vydac C
4
silica column The Separations Group, CA using 0.1 trifluoroacetic acid TFA
in water for A-buffer and 0.1 TFA in acetoni- trile for B-buffer as described [17]. Discrete
protein peaks were collected manually and freeze- dried. Protein concentrations were determined as
described [24]. Peptides were separated on a Nu- cleosil C
18
-column The Separations Group, CA using 0.1 TFA as A-buffer and 0.1 TFA in
90 acetonitrile as B-buffer. Peptides were eluted by applying a linear gradient from 5 to 60
B-buffer in 30 min, followed by 4 min of washing with 80 B-buffer using a flow rate of 1 ml
min
− 1
. Prior to N-terminal sequencing, protein was re-
duced and carboxymethylated. Automated Edman degradation was conducted using an ABI 476A
gas phase sequencer Applied Biosystems, Foster
City, CA. The peptide samples were dissolved in 0.1 TFA or 70 formic acid and spotted onto
polybrene coated PVDF membranes Immobilon, Millipore.
Proteins were separated by SDS-PAGE on the Phast system Pharmacia LKB, using precast
high-density gels or using 16 Tricine Novex, CA gels on the ‘Small’ system Hoefer, CA.
Protein bands were fixed and stained with silver according
to Manufacturer’s
instructions Pharmacia.
Digestion of the protein was performed after modification of the Cys-residues. The freeze-dried
protein was dissolved in 200 ml 0.5 M Tris – HCl, pH 8.5, 6 M guanidine – HCl, 5 mM EDTA and 5
ml of 1.4 mM DTT added. Reaction took place at 37°C for 10 min, after which 1 ml of 4-
vinylpyridine was added. After 10 min, the reac- tion was stopped by the addition of 5 ml of 1.4
mM DTT. The protein was subsequently desalted on a Vydac C
4
-column and freeze-dried. Digestion with endoproteinase Lys-C was con-
ducted by dissolving the reduced and alkylated protein in 5 ml 8 M urea. After 30 min at 37°C 45
ml of 50 mM NH
4
HCO
3
, pH 7.8 and 0.5 mg Lys-C from
Lysobacter enzymogenes,
Boehringer Mannheim was added. The digestion took place
at 37°C for 8 h. Digestion with endoproteinase Asp-N from
Pseudomonas fragi
mutant, Boehringer
Mannheim was performed using the same buffer and reaction conditions.
The sequence of IWF5 was analyzed for similar- ity using the BLAST program version 2.0.5, May
1998 and aligned with similar sequences using the Multialign program version 5.3.3 [26].
2
.
4
. Mass spectrometry The purity of each individual fraction was ver-
ified by matrix-assisted laser desorption ionization mass spectrometry [28] before further analysis.
Mass spectrometry was performed using either a Voyager DE instrument PerSeptive Biosystems,
Framingham, MA in the linear mode using de- layed extraction [29], or a Bruker reflex TOF
Bruker-Franzen, Bremen, Germany. All samples were analyzed in the positive mode using an accel-
eration voltage of 20 kV and external calibration, providing a mass accuracy of 0.1 or better. The
matrix used was a-cyano 4-hydroxy cinnamic acid Sigma, St. Louis, MO at a concentration of 15
mg ml
− 1
in 70 CH
3
CN, 0.1 TFA [30]. Spectra were accumulated for an average of at least 100
laser shots.
2
.
5
. Antifungal assay Protein fractions were tested for their in vitro
inhibitory effects on the growth of C. beticola spore cultures using the microtiter plate bioassay
described previously [20]. Briefly, the growth of the submerged spore cultures was followed by
measuring the increase in absorbance at 620 nm and by microscopical analysis.
2
.
6
. cDNA cloning The cDNA sequence of IWF5 was obtained by
3 and 5 RACE essentially as described previously [17] using the following primers.
3 RACE Primers. Q
T
: 5-CCAGTGAGCAGAGTGACGAGGACTCGA
GCTCAAGCT
17
-3 Q
: 5-CCAGTGAGCAGAGTGACG-3 Q
1
: GAGGACTCGAGCTCAAGC-3 5 RACE primers.
5-Anchor: 5-GGCCACGCGTCGACTAGTACGGGGGGG
GGG-3 5-UNI: 5-GGCCACGCGTCGACTAGTACG
2
.
7
.
3
RACE The amino acid sequence of the IWF5 protein
was used to construct two degenerated oligonucle- otide primers for the isolation of a partial cDNA
clone by 3 RACE. Total RNA was purified from leaves of sugar beet cv. Monova 6 days after
inoculation with C. beticola according to Ref. [27]. Reverse transcription followed by PCR were done
with the RT-PCR kit from Perkin Elmer Applied Biosystems, CA and according to their protocol.
Briefly, 1 mg of total RNA and 2.5 pmol Q
T
- primer was incubated at 42°C for 45 min with
reverse transcriptase followed by incubations at 99°C for 5 min and 5°C for 5 min. In the first
PCR 40 pmol of the primer Q was used as
downstream primer and the upstream primer was 150 pmol of the degenerated primer P1 5-
GCACGTTGCTACGACGTTGCTATG- AA: position 315 – 331 in the IWF5 cDNA se-
quence. In the second nested PCR 50 pmol of the primer Q
1
was used as downstream primer and the upstream primer was 50 pmol of the degenerated
primer P2
5-GGACGTATACTAACT- CACTAAGATA: position 354 – 370 in the
IWF5 cDNA sequence. The PCR conditions were: 1 min at 94°C, 2 min at 42°C, 1 min at 50°C
and 5 min at 72°C for 1 cycle followed by 1 min at 94°C and 2 min at 42°C and 3 min at 72°C for 35
cycles followed by 10 min at 72°C. After the second PCR a single DNA product of 390 bp was
obtained. The DNA product was cloned into the pT7Blue vector Novagen, Madison, WI and se-
quenced using a termo sequenase fluorescent cycle sequencing kit Amersham Pharmacia Biotech,
Uppsala, Sweden and an ALF DNA sequencer Amersham Pharmacia Biotech, Uppsala, Swe-
den.
2
.
8
.
5
RACE The sequence of the 5 end of IWF5 cDNA was
obtained by 5 RACE using the 5 RACE system from Gibco BRL MD, USA with 3 gene specific
primers constructed from the partial cDNA se- quence obtained by 3 RACE. Briefly, 1 mg of the
same total RNA as used for 3 RACE and 2.5 pmol of a gene specific primer GSP5-1 5-TG-
GAATTGGAGATTATGTAAG: position 619 – 643 in the IWF5 cDNA sequence was incubated
at 70°C for 10 min followed by the addition of reverse transcriptase and incubating at 42°C for 30
min, 70°C for 15 min and the addition of RNaseH and incubating further 10 min at 55°C. The cDNA
was dC-tailed according to the protocol of Gibco BRL. The tailed cDNA was subjected to two
rounds of PCR. In the first PCR 20 pmol of the 5-Anchor primer was used as upstream primer
and the downstream primer was 20 pmol of the gene specific primer GSP5-2 5-TCACTTTA-
GATGTAAGAAGCACACATG: position 596 – 622 in the IWF5 cDNA sequence. In the second
PCR 50 pmol of the 5-UNI primer was used as upstream primer and the downstream primer was
50 pmol of the gene specific primer GSP5-3 5- TAAGCAGAAAGTTCCAGAAAGCATG: posi-
tion 548 – 572 in the IWF5 cDNA sequence. The condition for the first PCR was: 1 min at 94°C and
1 min at 51°C and 2 min at 72°C for 35 cycles followed by 10 min at 72°C. The condition for the
second PCR was: 1 min at 94°C and 1 min at 55°C and 2 min at 72°C for 35 cycles followed by 10
min at 72°C. The single 600 bp DNA product was cloned into the pT7Blue vector Novagen and
sequenced using a Termo Sequenase fluorescent cycle sequencing kit Amersham and an ALF
DNA sequencer Pharmacia.
2
.
9
. Southern hybridization Genomic DNA was isolated from sugar beet
leaves according to Ref. [31], digested with appro- priate restriction enzymes and separated on a 0.8
agarose gel. A DNA probe of IWF5 cDNA was
32
P-labeled by random priming using the Ready- To-Go Labeling Kit from Pharmacia. Southern
transfer and hybridization was performed accord- ing to [32] using Hybond N + membranes Amer-
sham following the recommendations of the Manufacturer.
3. Results
