have been identified particularly in rice and Ara- bidopsis [13 – 19]. The primary sequences of the
coded protein share about 40 – 50 homology and contain several highly conserved regions 60 – 90
including two conserved histidine residues pre- dicted to play a role in acidbase catalysis and to
serve as the fifth ligand of the heme prosthetic group [20].
The expression of the peroxidase genes, as well as pathogenesis-related protein genes [21], have
been shown to be activated by a variety of envi- ronmental stimuli such as wounding [22], ethylene
[23] and pathogen infection [12,24,25]. Few studies have been conducted to identify the regulatory
cis-elements present in the peroxidase promoters. Mohan et al. [22] constructed chimeric uidA fu-
sions driven by the 5 flanking regions of the tomato anionic tap
1
and tap
2
peroxidase genes and showed that wound-induced GUS expression
in transgenic plants. Recently, Klotz et al. [26] also prepared a chimeric gene composed of the pro-
moter for the principal peroxidase gene found in tobacco and the uidA gene, analyzed histochemical
GUS activity in transgenic tobacco plants, and suggested that the peroxidase is important in plant
growth
and development
rather than
in lignification.
Some cell wall-associated peroxidases catalyze the cross-linking and polymerization of phenolic
polymers; it is one of key enzymes involved in lignin synthesis via phenylpropanoid pathway [27].
We believe characterization of the gene structure and the mode of gene expression of wound-in-
ducible peroxidase isozymes is important not only to understand their biological functions involved
in plant defence responses but to elucidate a part of signal transduction between wounding and gene
expression.
In order to understand the function of peroxi- dases in plant growth and development, we iso-
lated and characterized two peroxidase cDNA clones prxRPA and prxRPN [1]. A genomic clone
for prxRPN, poxN, was isolated and analyzed at the structural level [2]. Here, we report the isola-
tion and characterization of a second rice peroxi- dase gene, poxA, which corresponds to the
prxRPA cDNA. We show that expression of the poxA and poxN promoter-uidA fusion genes are
active in transgenic rice in a spatial and temporal pattern identical to that observed for their respec-
tive mRNAs. In contrast, only the poxA promoter is active in transgenic tobacco, indicating that one
or more transcriptional regulatory elements of the poxN promoter are not conserved between dicot
and monocot species.
2. Materials and methods
2
.
1
. Plant materials Rice Oryza sati6a L. cv. Nipponbare was
grown as described previously [1]. Rice suspen- sion-cultured cells were raised from seeds and
maintained in AA medium [28]. Tobacco Nico- tiana tabacum cv. Samsun NN was grown at 25°C
in a temperature-controlled greenhouse with a photoperiod of 16 h of light and 8 h darkness.
2
.
2
. Isolation of a genomic clone Genomic DNA was isolated from rice shoots,
21 days after germination, by the method of Mur- ray and Thompson [29]. The DNA was partially
digested with Sau3A and fragments 10 – 20 kb in size were recovered and inserted into the BamHI
site of lambda EMBL3 Stratagene Cloning Sys- tems, La Jolla, CA, USA. The recombinant
DNAs were packaged into bacteriophage particles GIGA pack Gold-II; Stratagene and grown on
Escherichia coli LE392 P2. The genomic library was screened with a
32
P-labeled prxRPA cDNA using a BcaBEST labeling kit Takara Shuzo, Ky-
oto, Japan and [a-
32
P]dCTP Amersham Interna- tional, Buckinghamshire, UK.
2
.
3
. Nucleotide sequencing DNA was sequenced by the dideoxy chain-ter-
mination method [30] using 7-deaza-dGTP instead of dGTP. The experimental details have been de-
scribed previously [1]. The nucleotide sequences of the poxA and poxN gene fragments appear in the
DDBJ, EMBL and GenBank Nucleotide Sequence Databases under the accession numbers D84400
and D49551, respectively.
2
.
4
. Primer extension A 32-mer synthetic oligonucleotide, 5-GTAT-
TAAGGCACAGTACAAGAACAGAGCATAC- 3, for the poxA gene, and a 30-mer synthetic
oligonucleotide, 5-GAACGACGATATTGCA-
GAGGAAACTCAGGC-3, for the poxN gene were end-labeled with [g-
32
P]ATP Amersham In- ternational and a Megalabel kit Takara Shuzo.
The labeled primers were allowed to anneal overnight at 30°C to 50 mg of total RNA iso-
lated from wounded shoots or healthy roots of 21-day-old
rice seedlings.
The shoots
were wounded by rubbing with sea sand and har-
vested 2 days later. The extension reaction using reverse transcriptase RAV-2 Takara Shuzo was
carried out at 42°C for 1.5 h. The products were analyzed on a 6 polyacrylamide sequencing gel
containing 8 M urea. The same primer was used to produce a sequencing ladder of complemen-
tary DNA.
2
.
5
. Construction of promoter-uidA fusion genes Six DNA fragments of the poxA promoter
were prepared by restriction enzyme digestions, as follows: i Aa fragment, a 2204-bp KpnI –
ScaI fragment position − 2197 to + 7; position +
1 is the A base of the translation start codon; ii Ab fragment, a 1629-bp NotI – ScaI fragment
− 1622 to + 7; iii Ac fragment, a 1138-bp EcoRI – ScaI fragment − 1131 to + 7; iv Ad
fragment, a 628-bp HindIII – ScaI fragment − 621 to + 7; v Ae fragment, a 355-bp P6uII –
ScaI fragment − 348 to + 7; and vi Af fragment, a 151-bp SphI – ScaI fragment − 144
to + 7. Likewise, five DNA fragments of the poxN promoter were prepared: i Nb fragment,
a 1640-bp XbaI – NheI fragment − 1425 to + 36; ii Nc fragment, a 1094-bp FspI – NheI frag-
ment − 1059 to + 36; iii Nd fragment, a 801-bp NheI fragment − 766 to + 36; iv Ne
fragment, a 410-bp HindIII – NheI fragment − 375 to + 36; and v Nf fragment, a 196-bp
EcoRV – NheI fragment − 161 to + 36. The termini of each DNA fragment were filled-in if
necessary and inserted into the filled-in HindIII and XbaI sites of the pBI101 vector Clontech
Laboratories, Palo Alto, CA, USA [31]. The re- sulting plasmids, designated pAaGUS, pAb
GUS,
pAcGUS, pAdGUS,
pAeGUS, pAfGUS,
pNbGUS, pNcGUS,
pNdGUS, pNeGUS,
and pNfGUS,
respectively, were
grown in E. coli HB101 cells.
2
.
6
. Transformation of tobacco plants Plasmid DNA was introduced to Agrobacterium
tumefaciens LBA 4404 by electroporation [32]. Tobacco plants were co-cultivated with Agro-
bacterium by the leaf disc-infection method [33,34] and transformants were selected on Murashige
and Skoog’s medium [35] supplemented with 100 mgml kanamycin and 250 mgml carbenicillin.
Regenerated
plants were
analyzed for
the integration of the promoter-uidA fusion genes into
the plant genome by the polymerase chain reaction PCR. A sense primer sequence from the GUS
coding region 5-CTGCAGCGCTCACACCGA- TACC-3 and an antisense primer sequence from
the
gene for
nopaline synthase
terminator 5 - ACAGGATTCAATCTTAAGAAACTTT - 3
were used for PCR. Primary transgenic plants and progeny
were referred
to as
T1 and
T2 transformants, respectively.
2
.
7
. Transformation of rice Rice protoplasts were prepared from suspen-
sion-cultured cells according to the method of Otsuki [36]. Protoplast cells 1 × 10
6
mL were electroporated in a continuous flow electro-trans-
fector CET-100; JASCO, Tokyo, Japan with 2 mg of plasmid containing the poxA or poxN pro-
moter-uidA gene and 0.4 mg of pUC19HPT plas- mid kindly provided by Dr A. Kato that
included
the CaMV35S
promoter and
hy- gromycin phosphotransferase gene as described
[37]. Formation of hygromycin-resistant calli from transformed protoplasts and regenerated
plants from the calli were carried out as de- scribed [36]. Transformants were initially selected
by checking roots for GUS activity. Regenerated plants were analyzed for the integration of the
introduced construct into the genome by PCR. In addition, the integration of genes was also
confirmed by Southern blot hybridization. Five microgrammes of total DNA from transgenic
rice plants containing the introduced the AA GUS or NBGUS fusion gene was digested with
EcoRI or XbaI and SacI, respectively, fractiona- tioned by electrophoresis on a 0.7 agarose gel,
and blotted onto nylon membrane Amersham International plc. A 0.5-kb HincII fragment
from the uidA gene from the pBI101 plasmid was labeled with [a-
32
P]dCTP using a BcaBEST
labeling kit Takara Shuzo, and used for the hybridization.
2
.
8
. Exposure of transgenic plants to 6arious stresses
Leaf discs ca. 7 mm in diameter containing a small vein from various transgenic tobacco plants
were incubated in either sterile water control treat- ment, 1 mM 2-chloroethylphosphonic acid ethep-
hon treatment, or 0.4 mM abscisic acid ABA treatment for 48 h. Leaf discs were also exposed to
UV-C light for 30 min 15 min per side at a distance of 30 cm from an UV lamp sterilization lamp
GL-15; Toshiba, Tokyo, Japan; before incubating in water for 48 h UV irradiation treatment. Leaf
discs from healthy untransformed tobacco plants were also treated as mentioned above and were used
as controls. The 48 h incubation period consisted of two diurnal cycles of 16 h light 45 mEsm
2
8 h dark cycle at 25°C.
Detached leaf blades from several transgenic rice plants were cut to small pieces about 3 cm in length
and incubated in sterile water, in ethephon, or in ABA, or treated with an UV-lamp, as described for
the transgenic tobacco plants. Leaf blades were also wounded by rubbing the leaf with carborundum
c 600; Nacalai Tesque, Kyoto, Japan before incubating in water for 48 h. In analysis of trans-
genic rice plants, the 48 h incubation was performed at 25°C in dark.
2
.
9
. Measurement of GUS acti6ity GUS activity was assayed by the method of
Kosugi et al. [38]. Leaf discs from transgenic tobacco plants were homogenized in lysis buffer 50
mM sodium phosphate pH 6.8, 10 mM EDTA, 10 mM 2-mercaptoethanol, 0.1 Triton X-100, and
0.1 sarcosyl in a Eppendorf tube with a glass rod and carborundum c 600. Leaf blades from trans-
genic rice plants were homogenized in lysis buffer with carborundum by a mortar and pestle. The
homogenate was centrifuged at 10 000 × g for 15 min and the supernatant was assayed for GUS
enzyme in the presence of 5 methanol. Fluores- cence levels were determined using a Shimazu
RF-540
spectrofluorometer Shimazu,
Kyoto, Japan. A unit of GUS activity is defined as 1 pmol
of 4-methyl-umbelliferone 4-MU produced per minute per milligram of protein. Protein concentra-
tions were determined by the Bradford method [39] using a commercial kit BioRad Laboratories, Rich-
mond, CA, USA and bovine serum albumin as the standard.
2
.
10
. Histochemical analysis Tissue sections from transgenic rice plants were
made to 80 – 100 mm with a microslicer model DTK-1000, Dosaka, Kyoto, Japan. Histochemical
staining for GUS activity was carried out in 50 mM sodium phosphate buffer pH 7.0 containing 1 mM
5-bromo-4-chloro-3-indolyl glucuronide X-Gluc and 5 methanol as described [34,38]. For peroxi-
dase activity staining, tissue sections were incubated in McIlvaine’s buffer pH 5.0 containing 0.03
4-chloro-1-naphtol and 0.001 H
2
O
2
for 30 min at room temperature. The reaction was stopped by the
addition of 0.2 N sodium carbonate. Lignification was detected by staining with 8.3 mgmL phloroglu-
cin in 50 ethanol and 0.3 N HCl.
3. Results
