Penentuan Jenis Kelamin pada Kelas Aves Menggunakan Metode Polymerase Chain Reaction (PCR)

RINGKASAN
ISYANA KHAERUNNISA. D14080155. 2012. Penentuan Jenis Kelamin pada
Kelas Aves Menggunakan Metode Polymerase Chain Reaction (PCR). Skripsi.
Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan, Institut
Pertanian Bogor.
Pembimbing Utama : Dr. Jakaria, S.Pt., M.Si.
Pembimbing Anggota : Maria Ulfah, S.Pt., M.Sc.Agr.
Jenis kelamin pada Aves penting diketahui untuk berbagai tujuan terutama
dalam bidang pemuliaan, konservasi dan pengembangan keilmuan. Penentuan jenis
kelamin sulit dilakukan pada beberapa jenis Aves, terutama pada jenis-jenis burung
monomorfik seperti kakatua (Psittacidae) dan beo (Sturnidae). Hal ini menyebabkan
hampir semua breeder mengalami kesulitan dalam menentukan jenis kelamin
burung-burung tersebut. Pendekatan teknologi berbasis molekuler dapat diterapkan
untuk menentukan jenis kelamin dengan menggunakan gen penanda jenis kelamin,
yaitu gen Chromodomain Helicase DNA-binding (CHD). Gen ini digandakan
melalui proses Polymerase Chain Reaction (PCR). Polymerase Chain Reaction
(PCR) dilakukan untuk menggandakan jumlah molekul DNA secara in vitro dengan
bantuan enzim polimerase dan primer (Williams, 2005).
Penelitian ini dilakukan untuk menentukan jenis kelamin pada beberapa jenis
Aves berdasarkan gen CHD-W dan CHD-Z menggunakan primer 2550F dan 2718R.
Jenis-jenis aves yang diuji yaitu Gallus gallus domesticus (ayam Kampung),
Coturnix coturnix japonica (puyuh jepang), Anas platyrhynchos (itik), Columba livia
(merpati), Gracula religiosa robusta (beo nias), Cacatua moluccencis (kakatua
maluku), dan Cacatua sulphurea (kakatua-kecil Jambul-kuning).
Sebanyak 21 sampel Aves diperoleh dalam bentuk darah dan bulu, kemudian
diekstraksi untuk mendapatkan DNA total. DNA kemudian diamplifikasi dengan
bantuan primer 2550F dan 2718R (Fridolfsson dan Ellegren, 1999) dan
dielektroforesis menggunakan Agarose Gel dengan konsentrasi 1,5%. Visualisasi
DNA menggunakan bantuan sinar ultraviolet. Jenis kelamin pada Aves ditentukan
dengan jumlah pita hasil elektroforesis. Pita tunggal menunjukkan jenis kelamin
jantan, dan pita ganda menujukkan jenis kelamin betina.
Hasil penelitian menunjukkan bahwa seluruh sampel Aves dapat diidentifikasi
jenis kelaminnya. Seluruh sampel dari Aves jantan menunjukkan pita tunggal (ZZ),
sedangkan pada betina menunjukkan dua pita (ZW), kecuali pada itik dan merpati.
Betina pada itik dan merpati dapat dibedakan dengan jantannya, meskipun keduanya
ditunjukkan dengan pita tunggal. Pita yang muncul di sampel itik dan merpati betina
adalah pita W, sedangkan pita Z tidak terdeteksi.
Kata-kata kunci: penentuan jenis kelamin, gen CHD, PCR, Aves

ii

ABSTRACT
Avians Sex Determination Using Polymerase Chain Reaction (PCR) Method
Khaerunnisa, I., Jakaria, and M. Ulfah
Many avian species are sexually monomorphic. In this case, molecular approach is
an efficient method for sex determination. The sexes of monomorphic avians can be
determined by PCR amplification of the CHD genes. CHD genes are preserved
within avian Z and W sex chromosomes. The objective of this research was to
determine sex of chickens, quails, ducks, pigeons, hill myna, salmon-crested
cockatoos, and yellow-crested cockatoos based on CHD gene using primer 2550F
and 2718R. PCR products were screened by 1.5% agarose gel electrophoresis with
Ethidium Bromide. According to the results 10 males and 11 females were
determined from 21 specimens of avians. Individuals showed double (ZW) and
single (ZZ) bands were identified as females and males, respectively in chickens,
quails, hill myna, salmon-crested cockatoos and yellow-crested cockatoos. Males and
females in ducks and pigeons showed single band in different length of basepairs.
Keywords: sex determination, CHD genes, PCR, avian

iii

PENDAHULUAN
Latar Belakang
Jenis kelamin pada Aves penting diketahui untuk berbagai tujuan terutama
dalam bidang pemuliaan, diantaranya untuk menentukan pejantan dan induk,
pengendalian rasio jenis kelamin (Nicholas, 2004), dan pemasangan jantan dan
betina dalam satu kandang di penangkaran. Penentuan jenis kelamin pada jenis-jenis
burung monomorfik seperti kakatua (Psittacidae) dan beo (Sturnidae) sulit
dilakukan, terlebih ketika burung belum mencapai dewasa kelamin. Hal ini
menyebabkan hampir semua breeder mengalami kesulitan dalam menentukan jenis
kelamin burung-burung tersebut.
Jenis kelamin dapat diidentifikasi menggunakan beberapa pendekatan,
diantaranya: (a) pengamatan tingkah laku, (b) adanya brooding patch, (c) perbedaan
dalam pola morfometrik, (d) pemeriksaan gonad menggunakan laparoscopy, dan (e)
pemeriksaan kromosom jenis kelamin. Metode pertama dan kedua dapat diterapkan
secara umum hanya pada musim kawin, dan analisis morfometrik dapat
menimbulkan bias. Pemeriksaan gonad sulit dilakukan di luar musim kawin (ketika
gonad mengecil) dan karena ukuran tubuh Aves yang relatif kecil dibandingkan
dengan ternak lainnya (Dubiec dan Zagalska-Neubauer, 2006).
Pendekatan

teknologi

berbasis

molekuler

dapat

diterapkan

untuk

mengidentifikasi jenis kelamin dengan menggunakan gen penanda jenis kelamin,
yaitu gen Chromodomain Helicase DNA-binding (CHD). Gen CHD berada di
kromosom W dan Z, yang terdiri dari CHD-W (berada pada kromosom W) dan
CHD-Z (berada pada kromosom Z) (Dubiec dan Zagalska-Neubauer, 2006). Metode
ini memberikan hasil yang lebih akurat untuk menentukan jenis kelamin
dibandingkan dengan menggunakan metode lainnya. Selain itu, metode ini dapat
dilakukan pada saat Aves baru menetas atau belum mencapai dewasa kelamin. Gen
CHD dapat diidentifikasi dengan primer 2550F dan 2718R (Fridolfsson dan Ellegren,
1999) melalui metode Polymerase Chain Reaction (PCR). Teknik ini digunakan
untuk menggandakan jumlah molekul DNA secara in vitro dengan bantuan enzim
polimerase dan primer (Williams, 2005).
Sumber DNA genom pada Aves secara umum dapat diperoleh dari darah
(Dubiec dan Zagalska-Neubauer, 2006). DNA juga dapat diperoleh melalui isolasi

1

dari bulu burung. Koleksi sampel bulu menimbulkan rasa sakit yang lebih sedikit
daripada pengambilan darah. Selain itu, biaya yang dibutuhkan lebih murah dan
dapat mengurangi risiko kontaminasi (Cerit dan Avanus, 2007).
Penelitian serupa telah banyak dilakukan di beberapa negara, seperti
identifikasi jenis kelamin burung paruh bengkok Nymphicus hollandicus di Turki
(Cerit dan Avanus, 2007), puyuh jepang di Eropa (Morinha et al., 2011), berbagai
jenis burung di Amerika Serikat (Kahn et al., 1998), burung laut di Pasifik Utara dan
Laut Bering (Dawson et al., 2001), burung-burung di Asia Timur (Lee et al., 2008)
dan lainnya. Sedangkan di Indonesia belum tersedia informasi mengenai penelitian
penentuan jenis kelamin berbasis molekuler pada Aves, terutama untuk jenis-jenis
burung endemik Indonesia.
Tujuan
Penelitian ini dilakukan untuk menentukan jenis kelamin pada beberapa jenis
Aves berdasarkan gen CHD-W dan CHD-Z menggunakan primer 2550F dan 2718R.
Jenis-jenis Aves yang diuji yaitu Gallus gallus domesticus (ayam Kampung),
Coturnix coturnix japonica (puyuh jepang), Anas platyrhynchos (itik), Columba livia
(merpati), Gracula religiosa robusta (beo nias), Cacatua moluccencis (kakatua
maluku), dan Cacatua sulphurea (kakatua-kecil Jambul-kuning).

2

TINJAUAN PUSTAKA
Klasifikasi Aves
Aves adalah hewan yang tubuhnya tertutup bulu, tidak memiliki gigi, berjalan
dengan dua kaki, dan memiliki struktur tulang yang termodifikasi untuk terbang
(Stevens, 1996). Welty (1982) menambahkan bahwa Aves memiliki tungkai atau
lengan depan termodifikasi untuk terbang, tungkai belakang teradaptasi untuk
berjalan, berenang dan hinggap, jantung memiliki empat ruang, rangka ringan,
memiliki kantong udara, berdarah panas, tidak memiliki kandung kemih dan bertelur.
Ayam Kampung
Indonesia memiliki berbagai jenis ayam lokal, baik yang asli maupun hasil
adaptasi yang dilakukan puluhan bahkan ratusan tahun yang lalu. Ayam lokal yang
tidak memiliki karakteristik khusus disebut sebagai ayam Kampung. Masyarakat
pedesaan umumnya memelihara ayam Kampung untuk mendapatkan daging, telur
maupun sebagai tabungan yang sewaktu-waktu dapat diuangkan (Nataamijaya,
2010). Mansjoer (1985) menyatakan bahwa ayam Kampung tidak mempunyai ciriciri tertentu atau dengan kata lain penampilan fenotipenya masih sangat beragam.
Keragaman ciri-ciri sifat kualitatif terutama pada corak bulu, warna kulit cakar dan
bentuk jengger.
Identifikasi jenis kelamin ayam Kampung dapat dilakukan sejak DOC dengan
vent method. Metode ini membutuhkan keahlian yang tinggi, sehingga masih sedikit
orang yang dapat melakukannya. Piliang (1992) menyatakan bahwa metode ini
dilakukan dengan melihat organ kopula rudimenter di dalam kloaka. DOC jantan
akan tampak papila yang menonjol, sedangkan pada betina tidak terdapat.
Puyuh
Puyuh jepang merupakan subspesies yang berasal dari Asia. Jenis ini
dimanfaatkan untuk diambil daging dan telurnya (Minvielle, 2004). Puyuh dewasa
menunjukkan sexual dimorfism, tetapi pada puyuh anakan (DOQ) sulit untuk
ditentukan jenis kelaminnya berdasarkan fenotipe. Puyuh jantan memiliki bulu putih
yang berbentuk garis melengkung tebal di bagian kepala sampai ke bagian belakang,
bulu leher dan dadanya berwarna cokelat muda (cinamon) tanpa ada bercak
kehitaman, bulu punggung berwarna campuran cokelat gelap, abu-abu dengan garis

putih, bulu sayap seperti bulu punggung dengan belang kehitaman, panjang sayap
kira-kira 89 cm. Puyuh jantan muda mulai bersuara atau berkicau pada umur 5-6
minggu. Selama puncak musim kawin, puyuh jantan akan berkicau setiap malam
dengan suara keras. Puyuh betina dewasa memiliki warna tubuh yang mirip dengan
puyuh jantan, kecuali warna bulu pada kerongkongan dan dada bagian atas puyuh
betina berwarna cokelat muda lebih terang (sawo matang) dengan bercak cokelat tua
atau kehitam-hitaman (Kasiyati, 2009).
Sebagian puyuh dewasa juga sulit dibedakan jenis kelaminnya karena
memiliki pola fenotipe yang sulit didefinisikan (Morinha et al., 2011). Vali dan
Doosti (2011) juga mengungkapkan bahwa penentuan jenis kelamin puyuh jepang
dewasa dan DOQ sulit dilakukan.
Itik
Itik merupakan salah satu ternak unggas yang dikenal sebagai penghasil telur
dan daging. Itik alabio, itik bali, itik mojosari dan itik pegagan adalah bangsa itik
lokal yang dikenal sebagai penghasil telur (Brahmantiyo et al., 2003). Itik mojosari
menunjukkan potensi produksi telur yang cukup baik, yang sebanding dengan
potensi produksi jenis-jenis itik lokal yang lain, sehingga layak untuk dipakai dalam
program persilangan (Prasetyo dan Susanti, 1997). Pola warna bulu itik mojosari
sebagian besar didominasi oleh warna lurik-coklat gelap. Variasi warna diantaranya
adalah kombinasi warna lurik dengan belang putih pada daerah leher dan bagian
dada (Suparyanto, 2003).
Karakteristik itik mojosari menurut Prasetyo et al. (1998) memiliki bentuk
tubuh seperti botol dan berjalan tegak, warna bulu itik jantan maupun betina tidak
berbeda, yaitu berwarna kemerah-merahan dengan variasi coklat, hitam dan putih.
Itik jantan dan betina dapat dibedakan dari bulu ekor, yaitu selembar atau dua lembar
ekor yang melengkung ke atas pada jantan. Warna paruh dan kaki itik jantan lebih
hitam daripada itik betina.
Merpati
Merpati lokal yang terdapat di Indonesia adalah burung merpati pendatang
yang berasal dari burung merpati liar (Columba livia) yang penyebaran aslinya di
daerah Eropa (Antawidjaja, 1988). Merpati dapat beradaptasi dengan mudah di darat

4

maupun di udara, lehernya panjang dan fleksibel, kepalanya termasuk besar, karena
mempunyai otak yang besar, tubuhnya kompak dan kaku, organ vitalnya terlindungi
secara baik terhadap serangan musuhnya (Levi, 1945).
Merpati betina biasanya lebih kecil dan tidak terlalu ribut dibandingkan
dengan merpati jantan saat kawin. Ukuran tubuh merpati jantan lebih besar dangan
tekstur bulu lebih besar dan bulu leher tebal. Merpati jantan pada saat bercumbu
membuat gerakan melingkar, memekarkan bulu ekor dan menjatuhkan atau
merebahkan sayap (Blakely dan Bade, 1998).
Beo Nias
Burung beo memiliki kepandaian dalam menirukan suara yang didengarnya,
sehingga banyak disukai oleh masyarakat. Gracula religiosa adalah burung
monomorfik, yaitu sulit dibedakan antara jantan dan betina, dan tergolong Appendix
II dalam CITES (Soehartono dan Mardiastuti, 2002). Identifikasi jenis kelamin pada
beo dapat dilakukan dengan pengamatan tingkah laku. Berdasarkan hasil penelitian
Hayati (1999), tingkat keaktifan dan perilaku state (memeriksa sarang, masuk sarang
dan membawa bahan sarang) lebih banyak dilakukan oleh individu jantan. Individu
betina lebih aktif dalam mendekati pasangannya.
Kakatua
Kakatua tergolong burung paruh bengkok (Psittacines). Burung-burung
tersebut banyak diminati di pasar dalam negeri maupun luar negeri karena berbagai
alasan, diantaranya memiliki tingkat kecerdasan yang tinggi, jinak, warna bulu yang
cerah, dan mampu meniru berbagai suara (Soehartono dan Mardiastuti, 2002).
Identifikasi jenis kelamin burung paruh bengkok di daerah tropis sulit dilakukan
karena tidak menunjukkan perbedaan morfologi eksternal (Miyaki et al., 1998).
Kakatua Maluku. Kakatua maluku (Cacatua moluccensis) merupakan jenis burung
endemik di kepulauan Maluku. C. moluccensis memiliki bulu tubuh dengan warna
merah muda dengan panjang tubuh 52 cm (Astuti, 2011). Jenis ini digolongkan
Appendix I dalam CITES (Soehartono dan Mardiastuti, 2002) dan tergolong
terancam punah (Coates dan Bishop, 2000).

5

Kakatua-kecil Jambul-kuning. Keberadaan kakatua-kecil Jambul-kuning di alam
bebas mendekati kepunahan akibat perburuan liar dan deforestasi habitat, serta
tergolong Appendix II dalam CITES (Soehartono dan Mardiastuti, 2002). Jenis ini
terancam punah akibat penangkapan yang berlebihan untuk perdagangan burung
dalam sangkar, dan sekarang langka akibat kegiatan ini (Coates dan Bishop, 2000).

A

C

E

B.1

B.2

D

F

G

Gambar 1. Beberapa Jenis Aves (A) Ayam Kampung1, (B.1) Puyuh Jepang Jantan2,
(B.2) Puyuh Jepang Betina2, (C) Itik3, (D) Merpati4, (E) Beo Nias5, (F)
Kakatua Maluku4, dan (G) Kakatua-kecil Jambul-kuning4
Sumber

: 1. Nataamijaya (2010)
2. Kasiyati (2009)
3. www.deptan.go.id
4. Coastes dan Bishop (2000)
5. MacKinnon et al. (2010)

6

Tabel 1. Klasifikasi Taksonomi Beberapa Species dari Kelas Aves
No.

Ordo

Famili

Genus

Species

Nama Lokal

Nama Umum

Pustaka

1.

Galliformes

Phasianidae

Gallus

Gallus gallus domesticus

Ayam Kampung

Kampung chicken

Al-Nasser et al. (2007)

2.

Galliformes

Phasianidae

Coturnix

Coturnix coturnix japonica

Puyuh jepang

Japanese quail

Nishibori et al. (2002)

3.

Anseriformes

Anatidae

Anas

Anas platyrhynchos

Itik

Duck

Srigandono (1998)

4.

Columbiformes

Columbidae

Columba

Columba livia

Merpati

Pigeon

Radioputro (1985)

5.

Passeriformes

Sturnidae

Gracula

Gracula religiosa robusta

Beo nias

Hill myna

Monroe dan Sibley (1993)

6.

Psittaciformes

Psittacidae

Cacatua

Cacatua moluccensis

Kakatua maluku

Salmon-crested cockatoo

Forshaw (1989)

7.

Psittaciformes

Psittacidae

Cacatua

Cacatua sulphurea

Kakatua-kecil
Jambul-kuning

Yellow-crested cockatoo

Forshaw (1989)

7

Penentuan Jenis Kelamin pada Aves
Determinasi jenis kelamin sangat diperlukan untuk memahami bentuk-bentuk
tingkah laku, perubahan ekologi, genetika dan evolusi (Clutton-Brock, 1986). Jenis
kelamin dapat diidentifkasi menggunakan beberapa pendekatan, diantaranya: (a)
pengamatan tingkah laku, (b) ada tidaknya brooding patch, (c) perbedaan dalam pola
morfometrik, (d) pemeriksaan gonad menggunakan

laparoscopy, dan (e)

pemeriksaan kromosom jenis kelamin (Dubiec dan Zagalska-Neubauer, 2006).
Metode pertama dan kedua dapat diterapkan secara umum hanya pada musim kawin,
dan analisis morfometrik dapat menimbulkan bias. Beberapa kasus menunjukkan
bahwa pembedaan jenis kelamin berdasarkan pada morfologi sulit dilakukan
(Kocijan et al., 2011; Lee et al., 2008). Pemeriksaan gonad menggunakan
laparoscopy dan pemeriksaan kromosom jenis kelamin dapat digunakan untuk
menentukan jenis kelamin pada Aves monomorfik (Griffiths, 2000). Namun,
pemeriksaan gonad sulit dilakukan di luar musim kawin (ketika gonad mengecil) dan
karena ukuran tubuh Aves yang relatif kecil dibandingkan dengan ternak lainnya
(Dubiec dan Zagalska-Neubauer, 2006).
Selain kelima metode tersebut, dapat juga dilakukan autosexing. Metode
autosexing dapat dilakukan untuk membedakan jenis kelamin unggas dari
pertumbuhan bulu (Mincheva et al., 2012), warna bulu, dan warna kerabang telur
(Lalev et al., 2012). Mincheva et al. (2012) menyebutkan bahwa adanya alel
pertumbuhan bulu cepat dan lambat pada ayam White Plymouth Rock
memungkinkan untuk dilakukan autosexing berdasarkan laju pertumbuhan bulu.
Ayam jantan akan memiliki frekuensi alel pertumbuhan bulu lambat yang lebih
tinggi daripada ayam betina.
Secara umum, determinasi jenis kelamin pada Aves cukup sulit sebelum
dewasa. Namun, pada jenis-jenis monomorfik hal ini sulit dilakukan meskipun telah
melewati masa pubertas. Beberapa jenis Aves seperti ayam, kalkun, itik, angsa,
burung hantu dan burung paruh bengkok sulit untuk diidentifikasi jenis kelaminnya
secara morfologis (Griffiths dan Tiwari, 1995; Griffiths et al., 1998). Teknik PCR
dengan menggunakan primer spesifik untuk penentuan jenis kelamin telah diketahui
dapat digunakan sebagai penentu jenis kelamin burung monomorfik (Ellegren, 1996).
Teknik ini dapat mendeteksi adanya kromosom W dan Z melalui gen yang berada

8

pada kedua kromosom tersebut, yaitu gen Chromodomain Helicase DNA-binding
(Ellegren, 2001; Dubiec dan Zagalska-Neubauer, 2006; Cerit dan Avanus, 2007).
Gen Chromodomain Helicase DNA-binding (CHD)
Betina pada Aves membawa masing-masing satu kopi kromosom Z dan W
(heterogamet), sedangkan jantan adalah homogamet (membawa sepasang kromosom
Z) (Ellegren, 2001). Terdapat dua gen yang diketahui terdapat pada kromosom W,
yaitu CHD-W dan ATP synthesis α-sub unit (ATP5AW). Kedua gen tersebut berada
pada bagian nonrekombinan kromosom W. Bagian homolog dari kedua gen tersebut
(yaitu CHD-Z dan ATP5AZ) terdapat pada kromosom Z (Cerit dan Avanus, 2007).
Gen merupakan penanda yang paling akurat untuk identifikasi jenis kelamin karena
gen terbuat dari DNA fungsional dan berubah sangat lambat. Gen CHD pada
kromosom Z dan W dapat dijadikan penanda yang paling umum digunakan untuk
identifikasi jenis kelamin pada Aves (Dubiec dan Zagalska-Neubauer, 2006).
Perbedaan rekombinasi diantara fragmen Z dan W pada gen ini menunjukkan
bahwa keduanya berada di luar pseudoautosomal region. CHD terdiri dari dua intron
yang berlokasi diantara fragmen-fragmen yang berubah dengan sangat lambat,
dimana intron pada kromosom Z berbeda panjangnya dengan intron pada kromosom
W. Pasangan primer digunakan dalam penentuan jenis kelamin yang dirancang untuk
membatasi fragmen gen dalam intron. Hal ini menyebabkan dapat dibedakannya
produk dari kromosom Z dan W dalam gel. Oleh sebab itu, jantan diidentifikasi
dengan satu pita dan betina diidentifikasi dengan dua pita dalam gel (Gambar 2),
dengan beberapa pengecualian (Dubiec dan Zagalska-Neubauer, 2006).

Gambar 2. Penentuan Jenis Kelamin pada Aves: (1) dan (3) Jantan, (2) dan (4)
Betina
Sumber

: Dawson et al. (2001)

9

Sumber DNA Total
Teknik PCR memerlukan suatu DNA cetakan (DNA template) yang akan
diperbanyak secara in vitro. DNA terdapat pada semua makhluk hidup mulai dari
mikroorganisme sampai organisme tingkat tinggi seperti manusia, hewan dan
tanaman. DNA terdapat di dalam sel dan di dalam inti sel. DNA yang terdapat di
dalam sel dapat berupa DNA mitokondria, DNA kloroplas (pada tumbuhan) atau
DNA penyusun kromosom (pada mikroorganisme), sedangkan DNA yang terdapat di
dalam inti sel disebut juga sebagai DNA inti. Keseluruhan DNA yang menyusun
masing-masing komponen tersebut disebut sebagai DNA genom (Muladno, 2002).
Sel terdapat di semua bagian tubuh makhluk hidup, sehingga DNA dapat
diekstrak dari segala macam organ tubuh (Muladno, 2002). Sumber DNA pada Aves
secara umum dapat diperoleh dari darah. Darah dalam jumlah sedikit dapat
dikumpulkan dengan mengambil darah pada bagian vena lengan atau sayap
(tergantung spesies dan umur Aves) (Dubiec dan Zagalska-Neubauer, 2006). DNA
juga dapat diperoleh melalui isolasi dari bulu burung, karena koleksi sampel bulu
menimbulkan rasa sakit yang lebih sedikit daripada pengambilan darah. Selain itu,
biaya yang dibutuhkan lebih murah dan dapat mengurangi risiko kontaminasi (Cerit
dan Avanus, 2007). Ekstraksi DNA dari fosil, spesimen museum, sampel forensik,
rambut atau bulu dan feses biasanya lebih sulit dilakukan (Taberlet et al., 1996).
Ekstraksi dan purifikasi DNA pada prinsipnya adalah suatu cara atau metode
untuk memisahkan DNA total dari komponen sel lainnya (Sulandari dan Zein, 2003).
Isolasi DNA dari organisme eukariote (seperti hewan, manusia dan tanaman)
biasanya dilakukan melalui proses penghancuran sel, pemusnahan protein dan RNA,
dan pemurnian DNA. Secara kimiawi penghancuran sel dilakukan dengan
memanfaatkan senyawa kimia seperti lisozim, EDTA (etilendiamin tetraasetat) dan
SDS (sodium dodesil sulfat). Protein dan RNA dihilangkan menggunakan phenol,
chloroform dan enzim proteinase. Pemberian etanol dan NaCl dilakukan untuk
memurnikan DNA (Muladno, 2002).
Kualitas dan jumlah DNA yang diperoleh dapat bervariasi tergantung asal
jaringan, metode penyimpanan, dan cara ekstraksi. Pengukuran kualitas dan jumlah
DNA dapat dilakukan dengan alat spektrofotometer atau dengan melihat intensitas
molekul DNA dalam gel. Tingkat kemurnian berkorelasi dengan kualitas DNA.

10

Kemurnian DNA ditentukan dengan menghitung rasio antara nilai A260 dan A280 pada
sampel DNA yang diukur menggunakan spektrofotometer (Muladno, 2002). Molekul
DNA dikatakan murni apabila rasio kedua nilai tersebut lebih dari 1,8 (Marerro et
al., 2009).
Polymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR) merupakan teknik untuk menggandakan
jumlah molekul DNA secara in vitro. Proses ini berjalan dengan bantuan enzim
polimerase dan primer. Primer merupakan oligonukleotida spesifik pada DNA
template yang berukuran pendek, yaitu sekitar 18-24 pasang basa. Primer akan
menempel pada DNA cetakan di tempat spesifik. Enzim polimerase merupakan
enzim yang dapat mencetak urutan DNA baru. Hasil PCR dapat langsung
divisualisasikan dengan elektroforesis atau dapat digunakan untuk analisis lebih
lanjut (Williams, 2005). PCR diaplikasikan dalam diagnosis dan dalam deteksi gen
tertentu (baik yang menguntungkan maupun yang membahayakan) pada ternak
domestik (Nicholas, 2004).
Prinsip perbanyakan molekul DNA pada target yang diinginkan melalui
teknik PCR terdiri dari denaturasi, annealing, dan ekstensi. Denaturasi awal
dilakukan sebelum enzim Taq polymerase ditambahkan. Proses ini berlangsung
selama tiga menit untuk meyakinkan bahwa molekul DNA yang ditargetkan ingin
dilipatgandakan jumlahnya benar-benar telah terdenaturasi menjadi DNA untai
tunggal. Denaturasi berikutnya membutuhkan waktu 30 detik pada suhu 95 oC. Pada
suhu 95 oC molekul DNA mengalami denaturasi sehingga strukturnya berubah dari
untai ganda menjadi untai tunggal. Suhu kemudian diturunkan menjadi 50 oC sampai
60 oC. Pada kisaran suhu ini akan terjadi annealing atau penempelan primer. Primer
forward dan primer reverse akan berkomplemen dengan posisi komplemen masingmasing. Setelah kedua primer tersebut menempel di posisi masing-masing, enzim
Taq polymerase mulai mensintesis molekul DNA baru dari ujung 3’ masing-masing
primer ke ujung 5’. Sintesa molekul DNA baru ini terjadi pada suhu 72 oC. Proses ini
disebut dengan ekstensi. Siklus PCR biasanya berlangsung sebanyak 30 - 35 kali
(Muladno, 2002).

11

MATERI DAN METODE
Lokasi dan Waktu
Penelitian dilaksanakan di Laboratorium Genetika Molekuler Ternak,
Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan IPB dan
Laboratorium Terpadu, Departemen Ilmu Produksi dan Teknologi Peternakan,
Fakultas Peternakan IPB. Penelitian ini dilakukan pada bulan Januari sampai dengan
bulan Mei 2012.
Materi
Sampel
Sampel darah sebagai sumber DNA diambil dari ayam, puyuh, itik dan
merpati. Sedangkan sampel bulu diambil dari beo nias, kakatua maluku, kakatuakecil Jambul-kuning. Sumber dan jumlah masing-masing tersebut ditunjukkan pada
Tabel 2, sedangkan gambar sampel-sampel Aves yang digunakan ditunjukkan pada
Gambar 3. Bahan-bahan yang digunakan dalam mengambil sampel darah
diantaranya kapas, alkohol dan EDTA. Alat-alat yang dibutuhkan diantaranya spoit,
pipa kapiler haematokrit dan tabung 1,5 ml. Sedangkan untuk menyimpan sampel
bulu digunakan plastik seal kemudian disimpan di dalam freezer.
Tabel 2. Sampel Aves yang Digunakan dalam Penelitian
Jenis Aves

Lokasi Pengambilan Sampel

Jenis
Sampel

Jumlah (ekor)




Ayam Kampung

Kandang ABC Fakultas Peternakan
IPB

Darah

2

2

Jenis Kelamin
tidak diketahui
-

Puyuh jepang

Kandang B Fakultas Peternakan IPB

Darah

2

2

-

Itik

Kandang B Fakultas Peternakan IPB

Darah

2

2

-

Merpati

Dramaga, Bogor

Darah

2

2

-

Beo nias

Penangkaran Burung Megananda Bird
Orchid Farm (MBOF), Ciluer, Bogor

Bulu

-

-

1

Kakatua maluku

Penangkaran Burung Megananda Bird
Orchid Farm (MBOF), Ciluer, Bogor

Bulu

-

-

2

Kakatua-kecil
Jambul-kuning

Penangkaran Burung Megananda Bird
Orchid Farm (MBOF), Ciluer, Bogor

Bulu

-

-

2

A.1

A.2

B.1

C

B.2

D

F

E

G

Gambar 3. Sampel Aves yang Digunakan dalam Penelitian: (A.1) Ayam Kampung
Jantan, (A.2) Ayam Kampung Betina, (B.1) Puyuh Jantan, (B.2) Puyuh
Betina, (C) Itik, (D) Merpati, (E) Beo Nias, (F) Kakatua Maluku, dan (G)
Kakatua kecil-Jambul kuning
Sumber

: Dokumentasi Pribadi

13

Ekstraksi DNA Total
Bahan-bahan yang dibutuhkan untuk ekstraksi DNA dari sampel darah
diantaranya RBC lysis buffer, buffer 1x STE, SDS (Sodium Dodesil Sulfat) 10%,
Proteinase K (5 mg/ml), phenol, CIAA (Chloroform Isoamil Alkohol), NaCl (5 M),
EtOH 96% dan TE 80%. Peralatan yang digunakan diantaranya satu set micropippet
beserta tipnya, vortex, sentrifuge, inkubator, dan freezer.
Ekstraksi DNA dari sampel bulu menggunakan bahan-bahan Yang with Urea,
Proteinase K (10 mg/ml), PB Buffer, PE Buffer, dan Elution Buffer. Alat-alat yang
digunakan diantaranya satu set micropippet beserta tipnya, sentrifuge, inkubator,
tabung spin, tabung 1,5 ml dan spektrofotometer.
Polymerase Chain Reaction
Bahan-bahan yang digunakan dalam PCR adalah sampel DNA, destilation
water, 10 x buffer, MgCl2, pasangan primer forward dan reverse, enzim Taq
polymerase dan dNTPs. Alat-alat yang digunakan diantaranya mesin PCR
thermocycler, vortex, micro sentrifuge, tabung PCR, satu set mikopipet dan tipnya,
dan refrigerator.
Primer yang digunakan dalam penelitian ini berdasarkan Fridolfsson dan
Ellegren (1999) yaitu 2550F dan 2718R yang terdiri dari: primer forward: 5´-GTT
ACT GAT TCG TCT ACG AGA-3´ dan primer reverse: 5´-ATT GAA ATG ATC
CAG

TGC

TTG-3´.

Sekuen

gen

CHD

diperoleh

dari

NCBI

(http://www.ncbi.nlm.nih.gov/). Nomor akses dari sekuen gen CHD-Z dan CHD-W
merpati masing-masing adalah AY517719 dan AY517718. Nomor akses dari sekuen
gen CHD-Z dan CHD-W pada ayam Hutan masing-masing adalah GU132943 dan
GU132944.
Agarose Gel Electrophoresis
Bahan-bahan yang digunakan untuk membuat agarose gel 1,5% diantaranya
larutan 0,5 x TBE (Tris-Borat EDTA) 30 ml, serbuk agarose 0,45 gram, EtBr 2,5 μl.
Bahan-bahan lainnya yang dibutuhkan dalam elektroforesis menggunakan gel
agarose adalah sampel DNA hasil PCR, loading dye (0,01% Xylene Cyanol, 0,01%
Bromtimol Blue, 50% gliserol), dan marker 100 bp. Peralatan yang digunakan

14

diantaranya satu set tray pencetak gel, timbangan digital, power supply 100 volt,
pipet mikro, tip, beaker glass, microwave, stirrer, dan UV Transilluminator.
Prosedur
Pengambilan Sampel Darah dan Bulu
Sampel darah diperoleh dengan mengambil darah menggunakan spoit atau
pipa kapiler haematokrit di vena axillaris bagian sayap. Bagian kulit yang akan
diambil darahnya dioles alkohol terlebih dahulu. Darah yang diambil sebanyak 1,5
ml kemudian dimasukkan ke dalam tabung 1,5 ml dan dicampur dengan serbuk
EDTA agar tidak menggumpal. Sampel darah disimpan dalam refrigerator (suhu + 4
o

C) sebelum diproses lebih lanjut. Sedangkan sampel bulu yang didapatkan segera

dikemas dalam plastik seal dan disimpan di dalam freezer sebelum diekstraksi.
Ekstraksi DNA Total
Sampel Darah. Ekstraksi DNA dilakukan menggunakan acuan Sambrook et al.
(1989) yang dimodifikasi. Sebanyak 50 µl darah ditambahkan dengan 800 µl RBC
lysis buffer, kemudian disentrifugasi 800 rpm selama lima menit hingga terbentuk
endapan. Endapan tersebut ditambah dengan 1 x STE sebanyak 300 µl, 40 µl 10%
SDS dan 10 µl Proteinase K 5 mg/ml lalu diinkubasi selama dua jam dengan suhu 55
o

C. Setelah itu ditambahkan 400 µl phenol, 400 µl CIAA dan 40 µl NaCl 5M,

kemudian digoyang pelan di suhu ruang selama satu jam. Tahap selanjutnya adalah
sentrifugasi dengan kecepatan 12000 rpm selama lima menit. Sebanyak 400 µl cairan
bening di lapisan paling atas dipindahkan ke tabung baru dan ditambahkan 800 µ l
EtOH absolut (70%) dan 40 µl NaCl 5 M lalu dibekukan selama 12 jam. Sampel
kemudian disentrifugasi dengan kecepatan 12000 rpm selama lima menit dan
terbentuk endapan putih. Endapan tersebut ditiriskan dan ditambah dengan 100 µl TE
80%.
Sampel Bulu. Sampel bulu bagian calamus (Gambar 4) dipotong kecil dan masingmasing ditambahkan 1000 µl Yang with Urea dan 100 µl Proteinase K (10 mg/ml)
lalu diinkubasi selama 12 jam pada suhu 38 oC. Selanjutnya, sampel ditambahkan
dengan 20 µl Proteinase K (10 mg/ml) dan diinkubasi pada suhu 55 oC selama dua
jam. Sampel disentrifugasi dengan kecepatan 2000 rpm selama lima menit. Sebanyak

15

500 µl sampel diambil, kemudian ditambahkan dengan 2500 µl PB Buffer. Campuran
tersebut dipindahkan ke tabung spin column sebanyak 750 µl dan disentrifugasi
dengan kecepatan 13000 rpm selama satu menit. Tahapan ini diulangi hingga seluruh
campuran sampel dan PB Buffer habis. Sebanyak 750 µl PE Buffer dimasukkan ke
dalam tabung spin column dan disentrifugasi kembali dengan kecepatan 13000 rpm
selama satu menit. Kemudian ditambahkan 50 µl Elution Buffer pada tabung spin
column. Selanjutnya, sampel didiamkan selama lima menit dan disentrifugasi dengan
kecepatan 13000 rpm selama satu menit. Sebanyak 50 µl Elution Buffer ditambahkan
kembali dan didiamkan selama lima menit, kemudian disentrifugasi.

Calamus

Gambar 4. Bagian Calamus pada Bulu Aves
Sumber

: Dokumentasi Pribadi

Uji Kualitas DNA. Kualitas DNA hasil ekstraksi diukur kemurnian dan
konsentrasinya menggunakan spektrofotometer. Selain itu, secara kualitatif kualitas
DNA dapat dilihat dengan elektroforesis menggunakan agarose gel 1,5%.
Polymerase Chain Reaction (PCR)
Sampel DNA hasil ekstraksi diambil sebanyak 0,1 - 2 µl ditambah dengan
premix dengan volume 23 µl. Premix dibuat dengan campuran 0,3 µl primer; 0,2 µl
dNTPs; 1 µl MgCl2; 2,5 µl 10 x buffer; 0,1 µl enzim Taq polymerase; dan 18,9 µ l
destilation water. Campuran sampel DNA dan premix tersebut diinkubasi
menggunakan mesin PCR thermocycler. Proses amplifikasi diawali tahap denaturasi
pada suhu 94 oC selama lima menit. Tahap kedua terdiri dari 30 siklus, masingmasing siklus terdiri dari proses denaturasi pada suhu 94 oC selama 30 detik,
annealing primer pada suhu 60 oC selama 45 detik dan ekstensi DNA pada suhu 72

16

o

C selama satu menit. Tahapan terakhir adalah pemanjangan primer pada suhu 72 oC

selama sepuluh menit. Hasil amplifikasi DNA tersebut divisualisasi dengan
elektroforesis.
Elektroforesis
DNA hasil amplifikasi dielelektroforesis menggunakan agarose gel dengan
konsentrasi 1,5%. Sebanyak 0,45 g serbuk agarose ditambahkan dengan 30 ml 0,5 x
TBE. Campuran tersebut dipanaskan hingga mendidih dan ditambahkan dengan 2,5
µl EtBr, kemudian dicetak pada cetakan hingga mengeras. Masing-masing sampel
DNA hasil PCR sebanyak 5 µl ditambahkan dengan 1 µl loading dye dan
dimasukkan ke dalam sumur-sumur di dalam gel, kemudian di-running pada larutan
0,5 x TBE dengan voltase 100 volt selama kurang lebih 30 - 45 menit. Pita-pita DNA
akan tampak dengan bantuan sinar ultra violet pada UV Transilluminator.
Rancangan dan Analisa Data
Genotyping
Jenis kelamin pada Aves ditentukan dengan jumlah pita hasil elektroforesis.
Pita tunggal menunjukkan jenis kelamin jantan, dan pita ganda menujukkan jenis
kelamin betina (Cerit dan Avanus, 2007).

17

HASIL DAN PEMBAHASAN
Ekstraksi dan Purifikasi DNA Total
DNA total yang diperoleh dalam penelitian bersumber dari darah dan bulu.
Ekstraksi DNA yang bersumber dari darah dilakukan dengan metode phenolchloroform, sedangkan ekstraksi DNA dari bulu dilakukan menggunakan kit
extraction. Kualitas DNA yang dihasilkan dari dua sumber tersebut diukur secara
kualitatif dan kuantitatif. Pengukuran kualitas DNA secara kuantitatif dilakukan
menggunakan spektrofotometer, sedangkan pengukuran kualitas DNA secara
kualitatif dilakukan dengan menggunakan agarose gel electrophoresis dengan
konsentrasi 1,5%. Kualitas DNA bersumber dari darah yang diukur menggunakan
spektrofotometer ditunjukkan pada Tabel 3.
Tabel 3. Hasil Pengukuran Kualitas DNA yang Bersumber dari Darah
No.

Sampel

Kemurnian

Konsentrasi (µg/ml)

1.

Ayam Kampung (a)

1,546

1670

2.

Ayam Kampung (b)

1,438

230

3.

Ayam Kampung (c)

0,996

5640

4.

Ayam Kampung (d)

1,741

1010

5.

Puyuh (a)

1,417

340

6.

Puyuh (b)

1,417

170

7.

Puyuh (c)

1,391

320

8.

Puyuh (d)

1,100

110

9.

Itik (a)

1,100

110

10.

Itik (b)

1,200

60

11.

Itik (c)

1,433

2020

12.

Itik (d)

1,611

580

13.

Merpati (a)

1,571

110

14.

Merpati (b)

1,667

100

15.

Merpati (c)

1,429

100

16.

Merpati (d)

1,500

150

Rataan

1,410

795

Kemurnian DNA yang bersumber dari darah tergolong rendah, karena
molekul DNA dikatakan murni menurut Marerro et al. (2009) apabila kemurniannya
lebih dari 1,8. Hal ini disebabkan adanya pengotor DNA yang berupa protein darah.
Seperti yang dijelaskan oleh Tataurov et al. (2008), bahwa sampel asam nukleat
dapat terkontaminasi dengan molekul lain seperti protein, senyawa organik dan lainlain. Rodwell (1983) mendefinisikan protein darah sebagai salah satu bentuk
makromolekul disamping asam nukleat dan polisakarida, biokatalisator, hormon
reseptor, dan tempat penyimpanan informasi genetik. Darah adalah jaringan yang
beredar dalam sistem pembuluh darah yang tertutup. Darah terdiri dari unsur-unsur
sel darah (merah dan putih) dan trombosit yang terdapat dalam medium cair yang
disebut plasma, campuran yang sangat kompleks tidak hanya terdiri dari protein
sederhana tetapi juga protein campuran seperti glikoprotein dan berbagai jenis lipoprotein. Adanya protein ini menyebabkan kemurnian DNA pada darah tergolong
rendah. Sedangkan kualitas DNA bersumber dari bulu yang diukur menggunakan
spektrofotometer ditunjukkan pada Tabel 4.
Tabel 4. Hasil Pengukuran Kualitas DNA yang Bersumber dari Bulu
No.

Sampel

Kemurnian

Konsentrasi (µg/ml)

1.

Beo nias

1,429

200

2.

Kakatua maluku (a)

1,273

280

3.

Kakatua maluku (b)

1,643

230

4.

Kakatua-kecil Jambulkuning (a)

1,250

200

5.

Kakatua-kecil Jambulkuning (b)

1,400

210

Rataan

1,399

224

Hal yang menyebabkan rendahnya kemurnian DNA yang bersumber pada
bulu adalah adanya keratin pada bulu. Bulu burung merupakan suatu modifikasi dari
jaringan kulit yang menanduk. Pough et al. (2005) menjelaskan bahwa lebih dari
90% bagian bulu adalah beta keratin, 1% lipid, 8% air, dan sisanya protein dan
pigmen, seperti melanin. Keratin pada bulu dapat menjadi pengotor DNA maupun
penghambat (inhibitor) pada saat proses PCR (Schill, 2007). Adanya faktor
penghambat menyebabkan ekstraksi DNA dari bulu sulit dilakukan dengan metode
19

phenol-chloroform, sehingga ekstraksi dilakukan dengan menggunakan kit. Schill
(2007) menjelaskan bahwa ekstraksi DNA dengan menggunakan kit umumnya
menghasilkan DNA dengan kualitas yang lebih baik.
Pengukuran jumlah DNA dengan spektrofotometer didasarkan pada prinsip
iradiasi sinar ultraviolet yang diserap oleh nukleotida dan protein dalam larutan.
Analisis asam nukleat umumnya dilakukan untuk penentuan konsentrasi rata-rata dan
kemurnian DNA yang terdapat dalam sampel. Jumlah dan kemurnian tertentu
diperlukan untuk kinerja optimal sampel DNA yang digunakan. Asam nukleat
menyerap sinar ultraviolet dengan pola tertentu. Sampel ditembus sinar ultraviolet
dan fotodetektor cahaya pada 260 nm, semakin besar cahaya yang diserap sampel,
maka semakin tinggi konsentrasi asam nukleat dalam sampel (Sambrook dan Russel,
2001). Spektrofotometer dapat digunakan untuk penentuan tingkat kemurnian DNA
yang berkorelasi dengan kualitas DNA yaitu dengan melihat rasio absorbansi pada
panjang gelombang 260 dan 280 nm (A260/280). Rasio absorbansi pada 260 nm dan
280 nm umumnya digunakan untuk menilai kontaminasi DNA oleh protein karena
protein menyerap cahaya pada panjang gelombang 280 nm (Tataurov et al., 2008).
Jumlah atau kuantitas DNA yang diukur menggunakan spektrofotometer
menunjukkan jumlah DNA yang bersumber dari darah lebih tinggi daripada DNA
yang bersumber dari bulu. Darah mengandung lebih banyak sel berinti daripada bulu.
Bagian bulu yang digunakan untuk ekstraksi adalah bagian calamus. Sel berinti dari
bulu diperoleh dari sel epitel dan darah yang menempel pada calamus. Calamus
merupakan bagian bulu yang tertanam pada kulit (Pough et al., 2005).
Selain menggunakan spektrofotometer, kualitas DNA ditentukan oleh
intensitas cahaya pita DNA yang muncul pada agarose gel (Gambar 5). Pita DNA
dari darah lebih terang daripada DNA dari bulu. Hal ini menunjukkan konsentrasi
DNA yang berasal dari darah lebih tinggi daripada DNA yang berasal dari bulu.
Konsentrasi DNA yang digunakan dalam penelitian ini yaitu 50 μg/ml, adapun untuk
sampel yang memiliki konsentrasi DNA di atas 50 μg/ml dilakukan pengenceran
dengan menambahkan air destilata. Penggunaan sampel dengan konsentrasi DNA
yang sama dilakukan agar keberhasilan amplifikasi seragam.

20

(-)

(+)
Gambar 5. Elektroforesis DNA Hasil Ekstraksi dengan Agarose Gel 1,5%
Amplifikasi dan Visualisasi Gen CHD
DNA

hasil

ekstraksi

kemudian

diamplifikasi

menggunakan

proses

Polymerase Chain Reaction (PCR). Sebanyak 21 sampel DNA Aves berhasil
diamplifikasi dengan suhu annealing 60 oC untuk sampel DNA ayam dan puyuh, dan
suhu annealing 55 oC untuk sampel DNA itik, merpati, beo nias, kakatua maluku,
dan kakatua-kecil Jambul-kuning. Sambrook et al. (1989) menjelaskan bahwa setiap
1% ketidakcocokan dari basa dalam DNA untai ganda (double-stranded DNA)
mengurangi melting temperature (Tm) 1-1,5 oC.
Sebanyak 21 sampel DNA hasil PCR dielektroforesis menggunakan agarose
gel dengan konsentrasi 1,5%, dan berhasil diidentifikasi jenis kelaminnya (Gambar
6). Secara fisik, agarose tampak seperti bubuk putih yang sangat halus. Agarose
yang dijual secara komersial terkontaminasi dengan polysacarida, garam dan protein.
Banyak sedikitnya kontaminasi di dalam gel dapat mempengaruhi migrasi DNA di
dalam gel dan kemampuan mengambil DNA dari dalam gel untuk digunakan sebagai
substrat dalam reaksi enzimatis (Muladno, 2002).

21

(-)

600 bp
400 bp

(+)
Gambar 6. Hasil PCR Gen CHD-Z dan CHD-W pada Tujuh Spesies Aves: (a) Ayam
Kampung, (b) Puyuh, (c) Itik, (d) Merpati, (e) Beo Nias, (f) Kakatua
Maluku, dan (g) Kakatua-kecil Jambul-kuning dengan Agarose Gel
Electrophoresis 1,5%
(-)

600 bp
400 bp

(+)
Gambar 7. Rekonstruksi Hasil PCR Gen CHD-Z dan CHD-W pada Tujuh Spesies
Aves: (a) Ayam Kampung, (b) Puyuh, (c) Itik, (d) Merpati, (e) Beo Nias,
(f) Kakatua Maluku, dan (g) Kakatua-kecil Jambul-kuning dengan
Agarose Gel Electrophoresis 1,5%
Seluruh sampel dari Aves jantan menunjukkan pita tunggal, sedangkan pada
betina menunjukkan pita ganda, kecuali pada itik dan merpati (Gambar 6 dan
Gambar 7). Pita tunggal pada Aves jantan dikarenakan gen CDH yang teridentifikasi
adalah gen CHD-Z, yaitu gen CHD yang berada pada kromosom Z. Sedangkan pada
betina, gen CHD berada pada kromosom Z (CHD-Z) dan juga W (CHD-W),
sehingga muncul dua buah pita DNA (Cerit dan Avanus, 2007; Dubiec dan ZagalskaNeubauer, 2006). Dubiec dan Zagalska-Neubauer (2006) menjelaskan bahwa primer

22

2550F/2718R menghasilkan satu pita pada beberapa spesies Aves betina. Namun,
betina dan jantan pada itik dan merpati dapat dibedakan secara mudah karena
keduanya memiliki panjang fragmen yang berbeda.
Situs penempelan primer forward dan reverse pada merpati dan ayam Hutan
tersebut dapat dilihat pada Gambar 8. Sedangkan untuk jenis Aves lainnya yang
diteliti belum ada sekuen gen CHD-Z maupun CHD-W, sehingga tidak diketahui
letak situs penempelan primer dan panjang sekuen gen CHD-Z dan CHD-W.
CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

1

ATTGAAATGATCCAGTGCTTGTTTCCTTAGTTCCCCTTTTATTG
GTTACTGATTCGTCTACGAGAACGTGGCAACAGAGTACTGATTT
GCTACTGATTCGTCTGCGAGAACGTGGCAACAGAGTTCTGATTT
GTTACTGATTCGTCTACGAGAACGTGGCAACAGAGTACTGATTT

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

45

ATCCATCAAGTCTCTAAAGAGATTGAATACTATAGTTAAAAAGC
TCTCTCAGATGGTTAGGATGCTAGACATATTAGCAGAGTATTTG
TCTCTCAGATGGTGAGGATGCTGGACATCCTAGCAGAATATCTG
TCTCTCAGATGGTGAGGATGCTAGACATCCTAGCAGAATACTTG

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

89

AATTTTATATTCAAAATATTCTAATATTCTCTATACAAAATCTC
AAGTATCGTCAATTTCCCTTTCAGGTGAGAATTTTTCTGGTAGT
AAGTATCGCCAGTTTCCCTTCCAGGTAACAATCTCGAGTAACCA
AAGTATCGTCAGTTTCCTTTTCAGGTAAGAATTTTGATGGTAGT

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

133

AGAGCACCTTGAATTCTCAACTGCTAAAACTGTTATGTGAAGGT
AGCCAAGAAGCCTTGATCTTTACCACTTTATCCTTTTTGTAGAT
AGAGGTCTTGATCCTGAACTTAAGAAAAATCATGTTTATATTCT
AGCCAAGAAGCCTTGATCTTTGCCACTTTATCTTAAGTAAAAGT

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

177

GAAAAAAGTAACGCAACACTGCACATAATTTTTAAATTAATCTA
TTATGAAAGTTTAATTTTACATACAGGAAAAGACTGGCAATTAA
GAGGGTGACATGGTGGAGTGAGCTGTACAGATGTCGTGAAATCT
GTCCTTTCTGTAGAAAAGACTTCTAAAAGTTTAATTTTATGTAT

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

221

TTTCCTTTCAAAATACTACTTAGTACAAAACCACATTTTCTTTT
TGCATGCTAAATAGTATTTTGAAGTTAAACTGATGAATTAGAAA
CCATTCTCTGTGATACATAAAAGTCAACTGGGCACTGTCCTGGT
AGAAAAAGACTGGCAATTACTATGGTGTGAGGTGTTGCATTATT

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

265

ATCTTTTCTTAAGCAAAGTGGTAAAGATCATATAATTGCAAAAC
GATGAAGTGTTTACATTACTTTTATTCCACCCCACCCCCTCAGT
TAGCCTGCTGTAGCAGACCTTGCTTGGAAACAGGACAAGATGAC
CTCCTCCTCCTCCTTCCCCCCCATTCCTCCCCTTGCCCTCAGTT

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

309

AGTCGAATTTGGAAAGGACTGCTGGAGGTCATCTTGTCTAAGTC
TGTTTTGGCAATTGAGAATTAAAGTTGCTCTGATTAGAATATAG
CTCTAGAGGTCGTTGCCAGTATTTCAACCATCTGTGATTATTTG
GTTTTGGCAATTGAGTATTCAGGTTGCTCTGATTAGAATATAGT

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

353

CCCTACTCAGGTGGGGACAGTTAAAGCAGGTTTCACACGGTTAT
AAGGAATTCCTTTTTAACTGTATTATTCAATCTCTTTAGAGACT
ATCTTCACCATTTTGCTTAAGAAAAGAAAGCAACTTTCAGTTAA
ATGAGTTCCTTTTTAACTGTAATATTTGATCTCTTTAGAGACTT

dilanjutkan...
23

lanjutan...
CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

397

GTCCAGGTGGCTTTTGAATGTCAAAGAGGATGGAGATTCCATGA
TGATGGATCAATAAAAGGGGAATTGAGGAAACAAGCACTGGATC
AAAGATTATGTGAACAAATATGTTAACATTCCTTCTTTTTGTTC
GATGGATCAATAAAAGGAGAACTGAGGAAACAAGCACTGGATCA

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

441

CCTCTGGGCAACTTGTTCAGTGCTCCGTCAGCCTCAGAGTAAAG
ATTTCAAT-----------------------------------CTTCACATTGCTGTTTTATCAGTTAAAAAGTCAAGTTACTGTGA
TTTCAAT-------------------------------------

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

485

AAAAGATTTTTCTTATATTCAAGGTCAAAGCTTCTTGGCTACTA
-------------------------------------------TGGGAATATAGCTAAAGAATTACTTTTAGACTGTAGTTTTCAAT
--------------------------------------------

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

529

CCACCACAACTCTTACCTGAAAAGGAAACTGACGATACTTCAGA
-------------------------------------------CTCTTTAGAGACTTGATGGATCAATAAAAGGGGAATTGAGGAAG
--------------------------------------------

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

573

TATTCTGCTAAGATGTCCAGCATCCTCACCATCTGTGAGAAAAT
-------------------------------------------CAAGCACTGGATCATTTCAAT------------------------------------------------------------------

CHDZ
CHDW
CHDZ
CHDW

C.
C.
G.
G.

livia
livia
gallus
gallus

617

GAGTACTCTGTTGCCACGTTCTCGTAGACGAATCAGTAAC-------------------------------------------------------------------------------------------------------------------------------------

Gambar 8. Situs Penempelan Primer pada Sekuen Gen CHD-Z dan CHD-W pada
Columba livia dan Gallus gallus. Situs Penempelan Primer Forward
(Warna Kuning), Situs Penempelan Primer Reverse (Warna Hijau)
Sekuen target gen CHD-Z yang dibatasi oleh primer 2550F/2718R pada
merpati berukuran lebih panjang daripada gen CHD-W. Panjang sekuen gen CHD-Z
pada merpati adalah 656 bp, dan panjang CHD-W 448 bp. Sekuen target gen CHD-Z
dan CHD-W tidak ditemukan pada ayam Kampung, tetapi ditemukan pada ayam
Hutan. Sekuen gen CHD-Z pada ayam Hutan (593 bp) juga berukuran lebih panjang
daripada sekuen gen CHD-W (447 bp) seperti yang ditunjukkan pada Gambar 8.
Panjang pita CHD-Z yang lebih panjang daripada CHD-W menyebabkan pita CHDZ berada di atas pita CHD-W. Muladno (2002) menjelaskan bahwa migrasi molekul
DNA berukuran besar lebih lambat daripada migrasi molekul berukuran kecil.
Perbedaan panjang antara sekuen gen CHD-Z dan CHD-W berjarak 146 bp pada
ayam Hutan dan 208 bp pada merpati. Dubiec dan Zagalska-Neubauer (2006)
menyatakan bahwa primer 2550F/2718R dapat mengamplifikasi gen CHD-Z dan
CHD-W dengan perbedaan sekitar 150-250 bp.

24

Implementasi Penentuan Jenis Kelamin Aves di Indonesia
Metode ini akan berguna untuk studi, program pemuliaan dan program
konservasi burung-burung langka seperti kakatua dan beo. Pengembangan keilmuan
dapat dilakukan seperti untuk mengobservasi gen-gen lain yang berada di kromosom
jenis kelamin untuk keperluan penentuan jenis kelamin. Hasil penelitian juga dapat
dijadikan acuan untuk menentukan jenis kelamin bangsa-bangsa lain dalam species
yang sama. Misalnya, dengan diketahuinya pola pita CHD-Z dan CHD-W pada
Gallus gallus maka dapat dijadikan acuan untuk bangsa-bangsa ayam lain, seperti
ayam pelung, ayam cemani, ayam arab, dsb. Penentuan jenis kelamin juga penting
untuk kepentingan pemulian ternak, salah satunya untuk seleksi pejantan dan
indukan, sehingga dapat mengembangkan ternak sesuai dengan tujuan.
Beo nias, kakatua maluku dan kakatua-kecil Jambul-kuning termasuk dalam
daftar Appendix CITES. CITES merupakan peraturan yang mengatur perdagangan
internasional flora dan fauna yang dilindungi. Beo nias dan kakatua-kecil Jambulkuning terdaftar dalam Appendix II, sedangkan kakatua maluku tercatat dalam
kategori Appendix I. Kedua kategori ini dilarang diperdagangkan kecuali dalam
kondisi tertentu, misalnya keturunannya (Soehartono dan Mardiastuti, 2002).
Ketiga jenis burung endemik Indonesia ini sangat diminati di pasar
internasional. Pasar terbesar untuk kakatua maluku dan kakatua-kecil Jambul-kuning
diantaranya Amerika Serikat dan Eropa, sedangkan pasar beo nias adalah negaranegara Asia (Soehartono dan Mardiastuti, 2002). Tingginya permintaan burungburung tersebut menyebabkan populasinya menurun drastis di alam, sehingga
dibuatlah peraturan perdagangan seperti yang tertera dalam CITES. Namun, hingga
kini permintaan ketiga jenis burung tersebut masih tinggi. Penangkaran atau captive
breeding merupakan solusi dari tingginya permintaan pasar ketiga jenis burung
tersebut. Penangkaran diartikan sebagai suatu kegiatan untuk mengembangbiakan
jenis-jenis satwa liar dan tumbuhan alam, bertujuan untuk memperbanyak
populasinya dengan mempertahankan kemurnian jenisnya, sehingga kelestarian dan
keberadaannya di alam dapat dipertahankan yang meliputi pula kegiatan
mengumpulkan bibit atau induk, pembiakan atau perkawinan atau penetasan telur,
pembesaran anak, serta restocking atau pemulihan populasinya di alam (Thohari,
1987).

25

Penangkaran beo nias, kakatua maluku maupun kakatua-kecil Jambul-kuning
belum banyak berkembang di Indonesia. Hal ini disebabkan karena para penangkar
kesulitan untuk mengawinkan burung akibat sulitnya menentukan burung jantan dan
betina. Dengan penentuan jenis kelamin yang akurat seperti dengan menggunakan
pendekatan molekuler, diharapkan dapat memperbaiki manajemen perkawinan dan
meningkatkan populasi jenis-jenis endemik Indonesia.

26

KESIMPULAN DAN SARAN
Kesimpulan
Sebanyak 21 sampel Aves dapat ditentukan jenis kelaminnya berdasarkan gen
CHD menggunakan primer 2550F san 2718R. Jenis-jenis Aves tersebut adalah ayam
Kampung, puyuh jepang, itik, merpati, beo nias, kakatua maluku, dan kakatua-kecil
Jambul-kuning.
Saran
Perlu dilakukan penelitian lebih lanjut untuk mengetahui sekuen lengkap gen
CHD-Z dan CHD-W pada puyuh jepang, itik, beo nias, kakatua maluku, dan
kakatua-kecil Jambul-kuning, yaitu dengan menggunakan metode sequencing. Selain
itu, perlu dilakukan penelitian untuk mengisolasi DNA secara non-invasif, seperti
dengan menggunakan feses atau bulu yang rontok.

27

PENENTUAN JENIS KELAMIN PADA KELAS AVES
MENGGUNAKAN METODE POLYMERASE
CHAIN REACTION (PCR)

SKRIPSI
ISYANA KHAERUNNISA

DEPARTEMEN ILMU PRODUKSI DAN TEKNOLOGI PETERNAKAN
FAKULTAS PETERNAKAN
INSTITUT PERTANIAN BOGOR
2012

1

PENENTUAN JENIS KELAMIN PADA KELAS AVES
MENGGUNAKAN METODE POLYMERASE
CHAIN REACTION (PCR)

SKRIPSI
ISYANA KHAERUNNISA

DEPARTEMEN ILMU PRODUKSI DAN TEKNOLOGI PETERNAKAN
FAKULTAS PETERNAKAN
INSTITUT PERTANIAN BOGOR
2012

1

RINGKASAN
ISYANA KHAERUNNISA. D14080155. 2012. Penentuan Jenis Kelamin pada
Kelas Aves Menggunakan Metode Polymerase Chain Reaction (PCR). Skripsi.
Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan, Institut
Pertanian Bogor.
Pembimbing Utama : Dr. Jakaria, S.Pt., M.Si.
Pembimbing Anggota : Maria Ulfah, S.Pt., M.Sc.Agr.
Jenis kelamin pada Aves penting diketahui untuk berbagai tujuan terutama
dalam bidang pemuliaan, konservasi dan pengembangan keilmuan. Penentuan jenis
kelamin sulit dilakukan pada beberapa jenis Aves, terutama pada jenis-jenis burung
monomorfik seperti kakatua (Psittacidae) dan beo (Sturnidae). Hal ini menyebabkan
hampir semua