GENERAL INTRODUCTION Phylogeography of tropical eel (Anguilla spp) in Indonesia Waters
1856; second group, variegated species with a toothless longitudinal groove in the maxillary and mandibular bands of teeth; A. nebulosa A. n. labiata Peters
1852; A. n. nebulosa McClelland 1844; A. marmorata Quoy and Gaimard 1824; A. reinhardti Steindachner 1867; and A. ancestralis Ege 1939; third group,
species without variegated markings and with a long dorsal fin; A. anguilla Linnaeus 1758; A. rostrata Lesueur 1817; A. mossambica Peters 1852;
A. borneensis Popta 1924; A. japonica Temminck and Schlegel 1846; and A. dieffenbachii Gray 1842; and fourth group, species without variegated
markings and with a short dorsal fin; A. bicolor A. b. bicolor McClelland 1844; A. b. pacifica Schmidt 1928; A. australis A. a. australis Richardson 1841;
A. a. schmidti Phillips 1925; and A. obscura Gunther 1871. Castle and Williamson 1974 postulated that A. ancestralis is an invalid species, based on
similarities with juvenile A. celebesensis. Currently, after scientist discovered a new species A. luzonensis in Philippines water at 2009, accepted number of
species in the genus Anguilla is 16 species Watanabe et al. 2009. At the population level, most of the freshwater eel showed randomly
mating panmictic structure on the whole species or sub-species distribution Avice et al. 1986. Panmixia is realized on the unique species or subspecies
spawning area where all individuals are potential partners. There are no mating restrictions, neither genetics or behavioral and all recombination is possible
Avise et al. 1986. Apart from their unique life history, eels are also popular as a commercial
important food, because of good nutritional value, with protein and fat content of 65 and 28 respectively Hainsbroek 2007. Among the many popular eel
dishes consumed around the world, kabayaki marinated grilled eel is a national dish in Japan, while smoked eel is favored in Europe and North America, and eel
larvae are eaten as appetizers in Spain Ringuet 2002. The international market for cultured eels exceeds 200,000 ton in year
2000. Based on FISHSTAT FAO 2009 data, total production of eels rose from 17,750 ton in 1950 year to 284,274 ton in 2007 year. In Japan, the Japanese eel
Anguilla japonica has long been esteemed as an important food fish, as much as 130,000 tons of eels are consumed per year followed by China, Korea,
America and some European countries, like Denmark, France, Italy, Belgium and Germany. However most of this production is based on catching wild of adults
and rearing of wild-caught juvenile “glass eels”. The catching activity of glass eel
2
since the mid-1990s has been increased rapidly Figure 1. The impact of exploitation of glass eel populations is unknown, although the yield of yellow and
silver eel has declined. Ecologists consider that the decline of eel production is
caused by habitat damage, illegal eel fisheries, climatic changes in the ocean, and parasites especially Anguillicola crassus in European eel. According to
Ringuet 2001, the overall production of A. anguilla and A. japonica has declined, landings of European eels, Japanese eels and American eels dropped
to 43.5, 64 and 8.3, respectively, over a period of 17 years 1984 to 2000. As a consequence, tropical eels became most important nowadays in the market,
as well as the research on tropical eel which becomes a new challenge.
Figure 1 World production of eels FAO 2009, graphic adapted from FAO 2009
On the other hand, the knowledge on tropical eel species occupying southern or tropical zones is still limited. Two thirds of the recognized 18 Anguilla
species and subspecies are found in the tropical Pacific, while only 6 in temperate regions of both the Pacific and Atlantic Oceans and seven occupy the
western Pacific around Indonesia Ege 1939; Castle Williamson 1974; Arai et al. 1999. The main differences between tropical and temperate eels are the
length of larval phase, the distribution, the spawning season and the population structure. The temperate eel generally have a longer and farther migration
distances Cheng and Tzeng 1996; Arai et al. 1999, 2001. The larvae of temperate eel enter estuaries is in spring, while that of tropical eels are found in
estuaries throughout the year with different abundance Arai et al. 1999.
3
Most studies of population genetic structure of eels have focused just on temperate species in the northern hemisphere and few have examined tropical
species. Some studies on population genetic structure of tropical eel have been conducted such as; A. marmorata by Ishikawa et al. 2004, Tseng 2012 and
Minegishi et al. 2008; A. bicolor by Minegishi et al. 2012 and A. reinhardtii by Shen and Tzeng 2007, 2012.
To uncover the existence of tropical eel, several studies have been conducted through the collaboration between the Japanese institution Ocean
Research Institute and research institutes of Indonesia LIPI to investigate the distribution of tropical eels , using the research vessels KM Baruna Jaya VII and
RV Haruko Maru in the period 1998-2003. Both research vessels collected lepothocephali around the Indonesian sea: A. borneensis caught in the Celebes
Sea, A. b. bicolor caught in the Mentawai Islands and A. celebesensis in the Tomini bay Arai et al. 1999; Wouthuyzen et al. 2009; Aoyama et al. 2007;
Setiawan et al. 2001; Miller 2003. Beside looking for the spawning areas of these eels, this expedition
confirmed also some observations quite interesting for taxonomy. According to Watanabe et al. 2004a, the tropical eels show geographic distribution and
morphological characters heavily overlapping. The comprehensive identification of eels proposed by Ege 1939, divided genus Anguilla into 15 species, three of
which were subdivided into two subspecies by using morphological character. But when the geographic distribution of each species is plotted on a map, several
species have overlapping geographic range. They have also overlapping range of morphological character. While Eges taxonomy has long been accepted since
its publication because most of the first freshwater eel studied came from temperate region and are not geographically overlapping, some doubts were
expressed Watanabe et al. 2004a. That means the identification of eels depends on the location of collection.
Watanabe et al. 2004a deduced that if only morphological characters were used for identification, the freshwater eels could be classified into only four groups.
This can be also a problem for the freshwater eels that have been transported around the world in recent years for aquaculture.
Since morphological studies are no more sufficient for freshwater eels species identification, the molecular genetics approaches become a new
challenge to develop technically and theoretically nowadays. Molecular genetics
4
have been used to evaluate certain taxa, for identification, evolution purposes and phylogenies reconstructions Freeland 2005. The application of molecular
genetics to confirm identification of freshwater eel have been conducted in several research Aoyama et al. 1999, 2001; Watanabe et al. 2004b, 2008;
Sezaki et al. 2005; Itoi et al. 2005; Gagnaire et al. 2007 and Trautner et al. 2006, most of them apply RFLP, RAPD and Real Time-PCR methods with 16S rRNA
and Cyt b gene as marker. Multiplex PCR is a variant of PCR permitting simultaneous amplification of
several targets in one reaction by using more than one pair of primers. For taxa identification purpose, the multiplex PCR produce amplicons on varying sizes that
are specific to different DNA sequences Rompler 2006. Multiplex PCR assay that using several species-specific primers enable to identify several species in a
simple, quick, low cost, sensitive, and highly reliable method Catanese et al. 2010
The molecular genetics techniques also have been used for new hypotheses of phylogeny and evolution of the genus Anguilla Tagliavini et al.
1996; Aoyama and Tsukamoto 1997; Lin et al. 2001; Bastrop et al. 2000; Aoyama et al. 2001; Inoue et al. 2001 and Minegishi et al. 2005. Molecular
phylogenetic studies upon all species of genus Anguilla have been conducted by Lin et al. 2001 who examined mitochondrial 12SrRNA and cytochrome b genes,
and Aoyama et al. 2001 examined 16SrRNA and cytochrome b genes. Both studies presented almost the same topology defining species groups and their
geographic distribution. However these contributions diverged on the position of basal species. Aoyama et al. 2001 concluded that A.borneensis was most likely
the basal species of the genus while Lin et al. 2001 suggested that the ancestor species are A. marmorata and A.nebulosa.
In recent year, Minegishi et al 2005 produced a new phylogenetic analysis based on the complete mitochondrial DNA
mtDNA sequence of all species of genus Anguilla. This phylogenetic analysis showed a better statistical support that mean more sure analysis than previous
studied. Minegishi et al. 2005 suggest A. mossambica to be most basal species using Baysian analysis, but based on MP maximum parsimony analysis,
similarly with Aoyama et al. 2001, Minegishi et al. 2005 A. borneensis appears as basal species. Moreover, because the tropical and Indo-Pacific zones have a
highest species diversity, these authors said that the Indonesia waters are the “origin of the eels” and “Indonesia is homeland of eels”.
5
A. bicolor and A. marmorata are tropical eels that have been widely analyzed due to their exceptional large distribution nearly 20,000 km east-west
in Indopacific oceans. This wide distribution is mostly in sympatry from the eastern coasts of Africa through the seas around Indonesia to New Guinea in the
Pacific Ocean. They are strongly suspected to have several spawning areas. According to Minegishi et al. 2008, A. marmorata is not taxonomically divided
into subspecies because of its morphological stability, but molecular studies have demonstrated its structure into four differentiated populations: North Pacific,
South Pacific, Indian Ocean, and Mariana Minegishi et al. 2008; Gagnaire et al. 2009. The shortfined eel, A. bicolor, of high abundance, is considered to be
structured into two subspecies A. b. bicolor in Indian Ocean especially at the west of Indonesia and A. b. pacifica in Pacific Ocean Ege 1939; Minegishi et al.
2012. However, the population structure and evolutionary history of A. bicolor needs to be investigated in detail especially in Indonesia. These fish have high
economic value, and are believed to be the best candidate eels to replace Japanese eel A. japonica and European eel A. anguilla which have been
decline for food, including fish farm growth. Indonesia is an archipelagic country that has a long coastline of 91,000
km and 71,480 islands. The western part of Indonesia is connected with Indian Ocean and the eastern was one with the Pacific Ocean, making Indonesia an
important biogeographic crossroad. Until now, there are seven recognized species that occupy Indonesia waters: A. bicolor two subspecies: A. b. bicolor
and A. b. pacifica, A. marmorata, A. celebesensis, A. borneensis, A. interioris, A. obscura and A. nebulosa subspecies: A. n. nebulosa Ege 1939; Castle
Williamson 1974; Tsukamoto Aoyama 1998 and Sugeha et al. 2008. But information about distribution, evolution, phylogenetic relationship and structure
population still are limited and without details.
Questions to solve
This study was intended to solve some questions: a. The distribution of seven eel species living in Indonesia is not really known.
This project aimed first at establishing quick methods of identification of tropical eels. This is partly due to the difficulty to determine the species just
using morphological character. From here we begin to get a clear description of the distribution of the species that live in Indonesian water. while it is quite
6
b. The genetic relationships among Anguillide in Indonesian water can be used generate a new phylogenetic tree which can help to understand the evolution
of this genus in tropical areas especially in Indonesian water. c. Indonesia is an important biogeographic crossroad, at the contact between
Indian and Pacific ichthyofaunas. Concerning the two widespread eel species A. marmorata and A. bicolor, Indonesia harbors a part of the Indian
and a part of the Pacific populations or subspecies, but nearly nothing is known on the exact distribution of each lineage in Indonesian rivers.
Biogeography of both species and populations genetics of A. bicolor will be used to understand the population structure and to know the gene flow
pattern among Anguillidae populations in the Indonesian waters.
Framework
The decreasing of temperate eel populations in the subtropical zone have encouraged biologists to help conservation and aquaculture of this group. As a
result, research on tropical eel are become a new challenge especially in Indonesian waters. Many scientists consider Indonesia as ”homeland and origin
of eels”, however, knowledge about distribution and biological traits of eel in Indonesian waters is still limited. Understanding biological aspects and population
is an important point in the development of sustainable aquaculture. In sustainable aquaculture, phylogeography and genetic population studies
are two first crucial steps to manage the fisheries resources. Such studies should provide valuable information about their status, population fragmentation
and dispersal pattern. To analyze phylogeography of eels, we should begin by their distribution map and phylogenetic relationships. Therefore samples
collection and identification become an important point. Recently many biologists agree that identification of eels is more appropriate using molecular biology
approach. Semi-multiplex PCR is one method that provides genetic information to identification of target species, by using the species-specific primers. Semi-
multiplex PCR assays can identify several species in a simple, quick, low cost, sensitive and highly reliable way on one step PCR. Phylogenetic relationships
can be analyzed based on the information resulting from mtDNA sequencing. The PCR and DNA sequencing constitute easy and fast methods, furthermore,
7
computer software provide convenient analytical methods to infer phylogenetic relationships and evolution and some statistical calculation.
The analysis of polymorphic microsatellites will provide inter and intra populations information structure. This population analysis should be conducted
on widespread species. As a summary, the outputs of this research are i a quick identification
method of ells species living in Indonesian waters; ii distribution of eels species, furthermore iii the information on systematics, phylogenetics and populations
genetics structure, which will provide data for conservation and aquaculture strategy. The framework of this study is summarized in the Fig. 2.
Phylogeography tropical eels genus Anguilla in Indonesian waters
Distribution and species composition of Anguilla
spp in Indonesian water Phylogenetic tree tropical
eel in Indonesian waters Population genetic structure
of tropical eel: Anguilla bicolor in Indonesian waters
CYT b and 16SrRNA genes to construct phylogenetic
relationships among populations and species
Morphometric and Semi- Multiplex PCR for
identification Polymorphic microsatellites
to determine the population genetic structure of
A. bicolor
Quick identification methods, dispersal and distribution, systematic and phylogenetic and
population genetic structure of tropical eels in Indonesian water
Population connectivity and conservation- aquaculture strategy of tropical eel in
Indonesian waters
Figure 2. Research framework
8
II. A Novel Semi-Multiplex PCR Assay for Identification of Tropical Eel Genus Anguilla in Indonesian Water
Abstract
A o
ne step semi-multiplex PCR is proposed for distinguishing seven species and subspecies of tropical eels including Anguilla bicolor bicolor, A. bicolor pacifica, A.
marmorata, A. interioris, A. celebesensis, A. borneensis, and A. nebulosa nebulosa in Indonesian waters. Seven pairs of species-specific primers, including two forward and
seven reverse primer sequences, were designed after the alignment of complete mitochondrial cytochrome b 1140 bp and 16S rRNA 1120 bp genes. All species-
specific primer pairs are included in one PCR, but only one pair of them can amplify a specific fragment from the template DNA that is analyzed. The semi-multiplex PCR
amplified a fragment of 230 bp for A. b. bicolor, 372 bp for A. n. nebulosa, 450 bp for A. borneensis, 620 bp for A. marmorata, 670 bp for A. b. pacifica, 720 bp for A.
celebesensis, and 795 bp for A. interioris, which are then separated by DNA agarose gel electrophoresis.
KEY WORDS: semi-multiplex PCR, Anguilla, tropical eels, molecular identification, species-subspecies specific primer
Introduction
Order Anguilliformes contains 400 genera and 800 species, most of them lives in the oceans and only genus Anguilla migrates to the freshwater for growth
Nelson 2006. Genus Anguilla is composed of freshwater eel having a catadromous life history characterized by spawning in ocean waters and by a
migration of the larvae back to the parents growing habitats in freshwater or estuarine areas. The three temperate species spawn in remote tropical waters
after a long adult migration. Their larvae, called leptocephali are passively returning to their growth habitat with the influence of subtropical currents, and
perform long migration distance Tesch 1977; Tsukamoto 1992. Oppositely, the tropical eels have shorter migration distance for both adults and leptocephali than
those of the temperate species Arai et al. 1999; Wouthuyzen et al. 2009 and Aoyama 2009
A first comprehensive identification of the genus Anguilla was proposed by Kaup 1856, who recognized 45 species. In 1870, Gunther reduced this number
to 23 species. Lastly, a revision of the genus was done by Ege 1939 who
9
divided the genus Anguilla into 16 species, three of which were subdivided into two subspecies. Based on morphological characters, the systematic organization
of Ege 1939 have long been widely accepted by many biologists. However, Watanabe et al. 2004a recently found that the morphological character
described by Ege 1939 were not sufficient to classify all species of this genus without including the information on the geographic distribution of the specimens,
which he used as a taxonomic character. Watanabe et al. 2004a considered that the Ege’s 1939 key for species identification is partly invalid because many
morphological characters used are overlapping in most species. Species recognition becomes especially important for tropical eels because nowadays
they are commercially transported around the world for food frozen and aquaculture a live purposes. Eges 1939 key is considered as insufficient
especially in tropical areas, where geographic and morphological characters of eels are heavily overlapping and where scientific data are still scarce.
Indonesia is a wide equatorial characterized by archipelagos composed of around 71,480 islands and coastline of around 91,000. Biogeographically,
Indonesia is at the crossroad of the Indian and Pacific Oceans, the western part of Indonesia is connected with Indian Ocean and the eastern is connected with
the Pacific Ocean. Two thirds of the recognized 18 Anguilla species and subspecies are found in the tropical Pacific and seven species and subspecies of
tropical eels range around Indonesia Ege 1939; Castle Williamson 1974, Arai et al. 1999. Those are A. bicolor two subspecies: A. b. bicolor and A. b.
pacifica, A. marmorata, A. celebesensis, A. borneensis, A. interioris, A. obscura and A. nebulosa subspecies: A. n. nebulosa. As a result, the position of
Indonesia appears to be center of origin the diversity of eel and is strategic in the knowledge of their evolution.
Several methods for species identification have been used on fish like conventional morphology and electrophoresis, immunoassay, liquid
chromatography or molecular genetics assay O’Reilly and Wright, 1995. Concerning eels, after demonstration that morphological characters were not
sufficient to classify all species, molecular genetics have been recommended Watanabe et al. 2004a. Most of the genetic approaches to species identification
are based on the amplification of a partial sequence of mitochondria mtDNA. The mtDNA, of maternal inheritance, shows no recombination, so that its
sequences are more conservative. The gene 16S rRNA, relatively well
10
conserved, is considered as a good marker for genera and species identification Aoyama et al. 2000, 2001; Watanabe et al. 2004b, 2005; Gagnaire et al. 2007.
However, it is not polymorphic enough between subspecies Watanabe 2003. Moreover, it is important to develop the markers that could distinguish
subspecies. One of the other genes used is cytochrome b Cytb. This functional gene is positioned between tRNA
Glu
and tRNA
Thr
genes. Many investigations on Cytb focus on inheritance and evolution Freenlad 2005. Several studies have
used Cytb as a marker for identification of subspecies Jain et al. 2008; Hyde et al. 2005.
Recently, several simple PCR techniques have been used to distinguish A. japonica and A. anguilla Sezaki et al. 2005, A. interioris and A. celebesensis
Aoyama et al. 2000 and to distinguish A. anguilla and A. rostrata Trautner 2006. Application of Real-Time PCR technique allowed identification of A.
japonica leptocephali Watanabe et al. 2004b, using single nucleotide polymorphism SNP Itoi et al. 2005, Random Amplified Polymorphic DNA
RAPD Kim et al. 2009; Lehmann 2000, Restriction Fragment Length Polymorphism RFLP Lin et al. 2001, most of these researches dealing with
temperate area. Rapid molecular identification of tropical eel began with Gagnaire et al.
2007, who developed semi-multiplex PCR and RFLP to identify four eel species in Indian Ocean. Multiplex PCR is a variant of PCR enabling simultaneous
amplification of several targets in one reaction by using more than one pair of primers. The multiplex PCR produces amplicons on varying sizes that are
specific to different DNA sequences Rompler 2006. By using the species- specific primers in multiplex-PCR assays, the identification of several species in a
simple, quick, low cost, sensitive, and highly reliable amplification is possible Catanese et al. 2010.
In the present study we developed a method derived from multiplex PCR assay. In this method, the PCR is based on two “universal” forward Anguilla
primers and so, called semi-multiplex and seven specific reverse primers, one for each eel species or subspecies know from Indonesian waters. The method is
based on the complete sequence of cytochrome b and 16S rRNA extracted from the specimens that was collected around Indonesia waters.
11
Material and Methods Specimens
The 1115 specimens examined in this study were collected around the Indonesian waters, covering all the geographic distribution of Anguilla species
that were expected to occur in the country see Appendix 1. Around 800 specimens are silver eels while the others are glass eels. Samples collection
was conducted in rivers estuaries along the coasts of Indian Ocean, Pacific Ocean and around Arafura and Celebes Seas. The specimens were collected
from 2008 to 2012. Species assignation was preliminary performed by using available morphological keys Watanabe et al. 2004a and Reveilac et al. 2007.
The first morphological characters, which are measurements in this study, a quantitative one as follows: the total length L
T
, the dorsal fin length L
D
, the anal fin length L
A
. These measurements were used to calculate the distance between the origin of the dorsal and anal fins D
A
using the formulation
D
A
=100L
D
– L
A
L
T -1
Reveillac et al. 2007 Fig.3. This character determined whether an individual was short-fin F
S
or long fin F
L
. The accuracy of the measurement is 0.01 mm by using the digital caliper. The second measurement
of morphological character was qualitative parameters that are presence or absence of marbling and breadth of maxillary bands. According to Watanabe et
al. 2004a genus Anguilla can be divided into four groups based on three characters: presence or absence of marbling, wide and narrow maxillary band of
teeth and origin of the dorsal fin; group 1, groups long dorsal fin with marbling skin and broad maxillary bands of teeth; group 2, groups long dorsal fin with
marbling skin and narrow maxillary bands of teeth; group 3, groups long dorsal fin and no marbling and group 4, groups short dorsal fin without marbling skin.
Tissues from anal fin, which were immediately stored in 95 ethanol, were used for genetic analysis.
Design of PCR primer
Nine semi-multiplex PCR primers were designed from sequence alignment performed on the cytochrome b cyt b and the 16S rRNA genes. The
Cyt b and 16S rRNA sequence dataset include sequence from GenBank ref. AP007236, AP007237, AP007238, AP007239, AP007241, AP007242,
AP007246 and 100 sequences obtained during the present study. Nine position of original sets for semi-multiplex PCR primers are shown in Table 1. Each
12
species-sp of cyt b fr
show in Ta pecific prim
ragments a able 2.
mer pairs wa nd one of t
as designed two differen
d to amplify nt lengths o
one of five of 16S rRN
different le A fragment
ngths ts, as
Figu mar
narr L
T
= of m
PCR amp
The fi suitable a
PCR in a the primer
volume of 25mM, 1
primer co 5uµl,
b a
ure 3 M
bling, b w row maxillar
total length maxillary ban
plification a
irst step of annealing te
Mastercycle rs were mix
f 10 µl cont 1.25 µl dN
ommon pri 0.2 µl d
L
T
c
easuremen without ma
ry bands of h. Eels draw
nds created
and sequen
semi-multip emperature
er gradient xed in one P
taining 2 µl TP 2mM,
mer is 1 ddH
2
O an nt morpho
arbling, c f teeth, L
D
wing are ad d by myself.
ncing
plex PCR a for all spe
Eppendorf PCR solutio
5x Green 0.5 µl eac
µl 10mM nd 1 µl
logy charac broad max
D
= dorsal fin dapted from
mplification ecies-specif
f, Le Pecq, on. The PC
GoTaq re
ch primer , 0.05 µl
template
d L
D
cter of spe xillary band
n length L
A
m Silfvergrip
n was to est fic primers
France. In R was carr
eaction buff 10mM ex
GoTaq D
DNA
L L
A
ecimen, a ds of teeth
=anal fin le 2009 and
with h, d
ength, d that
tablish the s by using s
second ste ried out in a
fer, 0.5 µl M xcept FCYT
DNA polyme around
2 same
imple ep, all
a total MgCl
2
T-EEL erase
20ng.
13
Table 1 Position of nine species-specific primers for semi-multiplex PCR on cytochrome b and 16s rRNA genes respectively. Two positions for forward primers FCYT-EEL and F16S-EEL and seven positions for reverse primers. See Table 2 for nucleotide sequence of primers.
14
Semi-multiplex-PCR was carried out in a Thermal Cycler from Bio-Rad, programmed to perform a denaturation step at 95
o
C for 5 min, followed by 35 cycles consisting of 45s at 95
o
C, 45s at 50
o
C see Results and 1 min at 72
o
C. The final extension step at 72
o
C was 10 min. Five microliters of each PCR product were loaded on a 1,5 agarose electrophoresis gel, stained with Cyber
Safe before electrophoresis at 100 volt for 90 min. The DNA band were observed under Blue Light and photographed by Canon camera digital
Five individuals of each banding pattern were sequenced on cytochrome b gene with the primer pair F-EEL-Cytb: 5’ CCA CCG TTG TAA TTC AAC 3’ and
R-EEL-Cytb: 5’ AAG CTA CTA GGC TTA TC 3’. To ensure the identification of species, alignment was done by using Mega 5.0 Kumar et al. 2008 and
compared with published sequences.
Table 2 Species-specific primer sequences for semi- multiplex PCR, and PCR product lengths expected for the seven Anguilla species and subspecies
Gene Primers
Sequence 5----3 Lengths of PCR
amplification bp Specific species
Cytochrome b FCYT-EEL TAGTGGATCTACCAACCC
Forward R-BICO
AGACAAATGAAGAAGAATGA 230 A. bicolor bicolor
R-BPAC ATGTTAGGGCAGTTAGC 670
A. bicolor pacifica R-MAR
GTGGAATGGAATTTTGTC 620
A. marmorata R-CEL
ATCTGGATCTCCAAGAAGA 720 A. celebensis
R-INT CGTAGGCGAATAGAAAG
795 A. interioris
16S rRNA F16S-EEL
AGGAGAAGAAGGAACTCG Forward R-NNEB
TTGGATCATATTTAACGTTT 372
A. nebulosa nebulosa R-BORN
AAGTTTAGGGGTATTCCC 450 A. borneensis
Result
Nine species-specific primers have been designed after the alignment of complete cytochrome b and 16S rRNA genes, including two forward primers
FEEL-CYT and FEEL-16S and seven reverse primers R-BIC0, R-BPAC, R- MAR, R-CEL, R-INT, R-NNEB and R-BORN see Table 2. The seven species-
specific fragments were successfully amplified at 50
o
C annealing temperature. Five species and subspecies of tropical eel were distinguished by cytochrome b
gene with one forward and five species-specific reverse primers are A. b. bicolor, A. b. pacifica, A. marmorata, A. celebesensis and A. interioris. Two species were
distinguished by 16S rRNA gene with one forward and two species-specific reverse primers are A. n. nebulosa and A. borneensis. For the series analyses,
the whole 9 primers were added in the mix amplifiying their corresponding DNA
15
fragm semi
beca ampl
ments in on i-multiplex
ause of the lification fra
e step PCR PCR assay
eir bad qua agments.
R. A total of y. Only 3 o
ality DNA. f 1115 sam
out of 1115 Figure 4 s
ples have b 5 sample co
shows sev been amplif
ould not be ven differen
fied by this e amplified
nt sizes of
M 1 2 3 4 5 M
M 6 7 8 9 10 11 12 133 14 15 16 177 M 18 19 200 21 22 M 23 24 25 26 27 M
395
F T
b m
u
T Unsp
deter minu
F in or
also three
indiv were
unsp but o
silve beca
Moc spec
ident Morp
pairs
Figure 4. Iden The orde of th
b. pacifica, 11 marmorata, 23
unexpected ba
The sizes o pecific ban
rmination. utes migratio
Five individ rder to conf
done for in e specimen
vidual in line e confirmed
pecific band The quan
only 769 sp r eel stage
ause the m chioka 200
cimens is sh tification of
phological a s of taxa: A
5 bp 230 bp
ntification spec he sample is a
-12 are A. bor 3-25 and 27 a
and.
of these se nds are a
The differe on of the PC
duals of eac firm the exp
dividuals sh ns showed
e 27 to Fig d as A. int
s of 230 an titative mea
pecimens po e. The qua
orphologica 03. The fo
hown in Tab all specim
analyses fa A. celebese
230 bp 670
cies and subs as follow : 1-2
rneensis, 13-1 are A. interioris
even specie also produ
ent fragme CR product
ch banding pected iden
howing une d unexpec
gure 4. One terioris. A
nd 620 bp. asurement
ossible to m alitative me
al character our morph
ble 3. The ens excep
iled to iden ensis versu
0 bp 450 bp
pecies of Ang are A. n. nebu
17 are A.celeb s, M=100 bp l
es-specific f uced, whic
nts sizes c on a 1,5
pattern typ ntification. S
expected ba cted band
e of showe As a result,
of D
A
was measureme
asurements rs in this s
ological gr right side o
pt 3, based tify glass e
us A. interi
720bp b
guilla by semi- ulosa, 3-7 are
besensis, 18-2 adder, u
fragments a ch does n
can be eas agarose e
pes were se Sequencing
anding patte among 1
ed DNA dam , A. interio
applied on ent by a qua
s are inapp tage are no
rouping dis of Table 3 i
d on semi-m eels and can
rioris, A. n.
620bp b
multiplex PCR A. b. bicolor,
22 and 26 are nspecific band
are given i not impede
ily observe lectrophore
equenced a g and alignm
ern. In this s 115 exam
mage and t oris can pro
n all 1115 s alitative one
plicable on ot clearly e
stinguishing s species-s
multiplex P nnot disting
nebulosa
bp 795
b
R samples. 8-10 are A.
A. ds, =
n Table 2. e species
ed after 90 esis gel.
nd aligned ment were
study, only ined see
two others oduce two
specimens, e that only
glass eel established
g the 769 subspecies
CR assay. guish three
versus A.
5bp
-400 -300
-200 -650
-1000 -500
-850
-100
16
marmorata and A. b. bicolor versus A. b. pacifica. Only A. borneensis is identifiable by morphological character only, as a “long fin” without marbling eel.
These results are in agreement with Watanabe 2003. Table 3. Identification eel by morphology only 796 eels were classified into the
four group and semi-multiplex-PCR 1112 eels were identified among 1115 eels
Group by morphology n Species n by multiplex PCR
− Long dorsal fin with marbling skin and broad maxillary bands of teeth 15
: A. celebenesis 47, A. interioris 16 − Long dorsal fin with marbling skin and
narrow maxillary bands of teeth 428 : A. marmorata 487, A. n. nebulosa 15
− Long dorsal fin, without marbling skin 3 : A. borneensis 3
− Short dorsal fin, without marbling skin 323 : A. b. bicolor 510, A. b. pacifica 34
Discussion
Since morphological identification was not sufficient to determine Anguilla species and subspecies, several molecular approaches have been proposed on
previous study. Most of the identification methods used simple PCR followed by sequencing Sezaki et al. 2005; Trautner 2006. However, sequencing is not
convenient for large samples because of its cost in time and money. Some of the studies have used multiple loci such as RFLP-PCR Aoyama et al. 2001, 2000;
Lin et al. 2001 and RAPD-PCR Kim et al. 2009 with non species-specific primers, which mean that many loci are needed for identification. Besides, the
number of species determined with each above-mentioned method is limited, such as two species Aoyama et al. 1999; Sezaki et al. 2005 or four species
Kim et al. 2009. The semi-multiplex method proposed here has demonstrated to be efficient
for identifying seven species and sub-species of tropical eel with only one step PCR. By using this method, one could reduce the number of necessary
sequences while the results are very sure for each species determination we easily identified 1112 specimens. All of species were obtained in this study have
show overlapping morphology and distribution. Moreover for small specimens mainly glass eels, the molecular method appears as indispensable.
Shen et al. 2010 suggested several additional criteria which must be taken into account when considering multiplex PCR assay 1 minimize primer
dimer association between all of the primers; 2 similarity of the annealing temperature of each primer; 3 primer specificity; and 4 constraint the migration
of the amplicons in order to separate the DNA fragments in agarose gel 17
18 electrophoresis. In the present survey each primer is species or subspecies-
specific and the limited cases of unexpected non-specific amplification never reduced the liability of species determination. Banding pattern of A. b. pacifica
shows a weak specific fragment of 670 and a bigger un specific band of 230, but this fragment pattern being stabile for all our A. b. pacifica specimens, there is no
difficulty to determine this species. The length of amplified fragments was clearly distinguishable after
electrophoresis migration no overlapping fragment. The primer structure was checked in order to avoid inter-molecules interaction, which is an important
precaution with 9 primers simultaneously mixed in one step PCR. Optimization of the semi-multiplex PCR mix consisted in designing an annealing temperature and
quantity of primer permitting was similar to amplification efficiency to pairs of primers.
Semi-multiplex PCR methods has been introduced recently on eels by Gagnaire et al. 2007 in order to rapidly determinate tree species of Anguilla: A.
marmorata, A. megastoma and A bicolor bicolor from West Indian Ocean. Genetic distances between each species pairs in genus Anguilla are almost 0,02
until 0.05 based on 16S rRNA Watanabe 2003. This study has established a rapid method to distinguish even two subspecies A. b. bicolor and A. b. pacifica,
although these two subspecies have low genetic distance which is 0.0068 based
on the 16S rRNA
This method has proven to be the most simple, quicker, lower cost no acrilamide migration, specificsensitive, and highly reliable way than the other
ones used before. This rapid method provides a useful tool for aquaculture, global marketing, and academic-scientific research.