cesses and ENTs have been studied for protozoan parasites such as Leishmania dono6ani, Try-
panosoma brucei and Toxoplasma gondii [6 – 9]. These parasites lack the de novo purine biosynthe-
sis pathway and, consequently, have to rely on nucleoside transporters to acquire purine nu-
cleosides from their host cells [10].
Genes encoding eukaryotic ENTs have been cloned from protozoan parasites and mammals
[6 – 9,11 – 14]. Amino acid sequence comparisons suggest structural conservation of this type of
genes between mammals and protozoan parasites. Genes encoding CNTs have mainly been isolated
from mammalian cells [15 – 19]. A high degree of structural conservation is also found among the
CNT encoding genes. Nucleoside transport func- tion has been confirmed for all of the cloned genes
through in vitro expression in Xenopus lae6is oocytes followed by nucleoside uptake tests. More
recently, the Xenopus and the yeast expression systems have been employed successfully for
studying amino acid residues involved in nu- cleoside or inhibitor NBMPR binding in human
CNTs hCNTs or ENTs hENTs [20,21]. The combination of molecular genetic and biochemical
approaches is yielding new information on nu- cleoside transporters at a rapid pace. A deeper
understanding of these proteins in mammalian and protozoan biology will become available before
long.
In contrast to above progress, fewer investiga- tions have been carried out to characterize nu-
cleoside transporters
in higher
plants. Physiological studies suggest that higher plants
can salvage nucleosides and bases derived from nucleotide breakdown or from exogenous sources
[22 – 25], indicating the existence and function of nucleoside transporters in plant cells. Plant nucleic
acid sequences encoding potential polypeptides with homology to hENTs have recently been dis-
covered in EST expressed sequence tag [26] and genomic
sequencing projects
of Arabidopsis
thaliana. In the work described in this paper, we report our results on cloning and in vitro expres-
sion of the cDNA encoding a putative nucleoside transporter from Arabidopsis thaliana. Our work
presents molecular evidence for the expression of the AtENT
1
gene in the Arabidopsis plant and for the association of the AtENT1 protein with the
plasma membrane of eukaryotic cells.
2. Materials and methods
2
.
1
. Plant growth and nucleic acid isolation Arabidopsis thaliana ecotype Columbia was used
throughout this study. Seedlings germinated in composts were grown in the greenhouse at 20 –
22°C with supplemented light 14 h light10 h dark. Total RNA was isolated by using the Trizol
reagent Gibco BRL according to the manufac- turer’s instruction. Genomic DNA was isolated
using the CTAB method as described [27].
2
.
2
. RT-PCR, cDNA cloning and DNA sequencing
Conceptual translation of four ESTs EMBO accessions
N65317, T20785,
AA586285, AA712578
and one
genomic AAC18807,
PID:g3176684 Arabidopsis
sequences yielded
polypeptides showing partial homology to hENT proteins. This suggests that, in the Arabidopsis
genome, the equilibrative nucleoside transporter encoding gene AtENT has at least one member
that is transcribed. Because the genomic sequence contained regions showing complete nucleotide
homology with the four EST sequences, we de- duced that the five sequences represent a single
gene, which we named as AtENT
1
. In order to obtain the cDNA for the coding region of
AtENT
1
, two
primers, NT1
5-CTAAACG- GATCCAAATGACCACCAC-3,
the italicized
nucleotides constituted a BamHI restriction site and NT2 5-CGAAGCTTAAAGAATTCAAC-3,
the italicized nucleotides constituted an EcoRI restriction site were designed based on the avail-
able sequence information. The primers were sub- sequently synthesized by Gibco BRL and used in
RT-PCR to amplify a 1.3 kb DNA fragment corresponding to the coding region of AtENT
1
. Reverse transcription RT using AMV reverse
transcriptase Promega and total RNA extracted from 2 week-old seedlings was conducted follow-
ing the supplier’s instruction Promega. PCR re- actions with RT mixture were carried out using
the following cycling parameters: 1 cycle of dena- turing at 95°C for 5 min, 30 cycles of denaturing
at 95°C for 1 min, annealing at 52°C for 1 min and extending at 72°C for 2 min, followed by one
cycle of extending at 72°C for 10 min. The amplifi- cation product 1.3 kb was cloned into the
pGEM-T vector Promega. The insert in two independent clones was completely sequenced by a
commercial company TakaRa. One of the two clones was designated as pGEM-ANT and was
used in the subsequent hybridization and cloning experiments.
2
.
3
. Amino acid comparison and structure prediction
The cDNA sequence of AtENT
1
coding region was translated into amino acid sequence using the
ORF Finder program NCBI. The resultant amino acid sequence was compared with those of
mammalian and protozoan ENTs using the Blast program NCBI. The presence and arrangement
of transmembrane domains in AtENT
1
protein was predicted as described by Tusnady and Simon
[28] and were subsequently compared with those of hENT1 and hENT2.
2
.
4
. Southern and northern analysis Genomic DNA from Arabidopsis 5 mg was
digested with HindIII, EcoRI or DraI. The di- gested DNA was separated in 1 agarose gels.
After blotting onto the Hybond N
+
membrane Amersham, DNA samples were hybridized with
32
P-labelled probe prepared by priming AtENT
1
cDNA the insert in pGEM-ANT using the Prime-A-Gene
®
labeling system Promega [29]. Post hybridization washes used both low 2 ×
SSC0.1 SDS, 65°C for 20 min each and high 0.1 × SSC0.1 SDS, 65°C for 20 min each strin-
gency procedures. Washed membranes were ex- posed to Kodak films and autoradiographies were
obtained for all hybridized membranes.
To evaluate the expression of AtENT
1
in Ara- bidopsis thaliana, total RNA was extracted from
different organs root, leaf, rachis and flower and from plants at eight developmental stages. The
definition of the different developmental stages was as follows. Stage 1: cotyledons unfolded.
Stage 2: second true leaf emerged. Stage 3: sixth true leaf emerged. Stage 4: rosette no internodes.
Stage 5: flower buds visible. Stage 6: flower buds raised above leaves. Stage 7: First flower buds
white. Stage 8: 50 of all buds opened. Total RNA samples 20 mg each were run in formalde-
hyde-containing, denaturing agarose gels. Capil- lary transfer of RNA and blot hybridization with
32
P-labeled probe prepared as outlined above were carried out as described [29]. The hybridized
blots were washed with both low and high strin- gency procedures. After an initial exposure for the
signal generated by AtENT
1
mRNA, the blots were stripped and were further hybridized with a
probe specific for 18S rRNA to check the loading of different RNA samples during elec-
trophoresis.
2
.
5
. Expression in insect cells Two fusion genes AtENT1-His-tag and GFP-
AtENT1-His-tag were prepared for expression in insect cells using the Bac-to-Bac™ baculovirus
expression system Gibco BRL. To construct AtENT1-His-tag the His-tag is a peptide sequence
consisting of 6 histidines, two primers, NT1 Sec- tion 2.2 and NT3 5-CAAATGAATTCTCAGT-
GATGGTGATGGTGATGAATGACCCAGAACC AAGC-3, the italicized nucleotides formed the
coding sequence for His-tag, were used to amplify the coding region of AtENT
1
from the pGEM- ANT plasmid. The GFP green fluorescence
protein-AtENT1-His-tag fusion was prepared in two steps. Firstly, a DNA fragment containing the
coding region of GFP was amplified from p35S- GFP
plasmid [30]
using primers
G1 5-
GATGGATCCATGAGTAAAGGAGAAGAAC- 3
and G2
5-CTGGAGGATCCCTTTG- TATAGTTCATCC-3.
Secondly, the
GFP fragment was fused to the 5 end of the AtENT1-
His-tag fragment using the restriction site BamHI. In frame fusion between GFP and AtENT1-His-
tag was confirmed by DNA sequencing. By follow- ing the instructions detailed by Gibco BRL, the
above sequences were cloned downstream of the polyhedron promoter in the baculovirus genome.
The resulted bacmids that contained the recombi- nant baculovirus genomes were introduced into
insect cells sf21. Expression of the two fusion genes in sf21 cells was checked either by immuno-
cytochemical staining for AtENT1-His-tag or by confocal microscopy for GFP-AtENT1-His-tag.
In addition to the above bacmids specifying the expression
of AtENT1-His-tag
and GFP-
AtENT1-His-tag in sf21 cells, two more bacmids were used as controls: WT allowing the produc-
tion of the wild type baculovirus genome and P1-GFP enabling the expression of a predomi-
nantly cytosolic GFP fusion protein.
2
.
6
. Immunohistochemical staining and fluorescence microscopy
To visualize the expression of AtENT1-His-tag, sf21 cells at 48 h post transfection were collected
by centrifugation 1000 g for 2 min, fixed with 4 paraformaldehyde for 10 min and spread onto
poly-
L
-lysine Sigma treated slides. After 10 min of drying on a warm plate set at 45°C, the slides
were washed with TBS 150 mM NaCl, 100 mM Tris – HCl, pH 7.5 for 5 min, followed by an
incubation in
TBSM TBS
containing 5
skimmed milk powder for 60 min to block non- specific binding sites. After the incubation, the
cells were treated with a mouse monoclonal anti- body that recognized the His-tag Pharmacia,
1:2000 dilution in TBSM for 24 h at 4°C. The antibody reaction was terminated by washing the
cells three times 5 min each in TBS. A goat anti-mouse IgG-alkaline phosphatase conjugate
solution Sigma, 1:2000 dilution in TBS was then applied to the washed cells. After a 1-h reaction,
the cells were washed three times with TBS 5 min for each wash. To detect antibodyconjugate reac-
tion, the cells were treated with a substrate solu- tion containing NBT and BCIP as detailed by
Wang and Maule [31]. To check the specificity of the monoclonal antibody, sf21 cells transfected
with the WT bacmid were stained exactly as de- scribed above. The staining results were pho-
tographed with an Olympus microscope using Kodak color films 400 ASA.
For visualizing the expression of GFP-AtENT1- His-tag by fluorescence microscopy, cells at 48 h
post transfection were collected and spread onto clean slides. The cells were mounted in 10 glyc-
erol in 130 mM NaCl, 7 mM Na
2
HPO
4
, 3 mM NaH
2
PO
4
containing 1 mgml propium iodide Sigma and immediately examined under either a
conventional fluorescence microscope Olympus or a confocal microscope Bio-Rad 680 using
appropriate excitation and emission filters. In con- focal microscopy, selected cells were optically sec-
tioned at a 2 mm interval. On average, about 15 sections
were obtained
for each
of the
examined cells. Fluorescent signals in all sections were carefully examined and recorded. Cells trans-
fected with the P1-GFP bacmid were also exam- ined via confocal microscopy. The GFP fusion
protein specified by this bacmid was used as a positive control for observing GFP fluorescence in
insect cells.
3. Results
