been identified [6]. Their products are located in the tonoplast and plasma membrane. Sequence
comparisons have shown a high homology be- tween plant aquaporins; all published sequences
are clearly of TIP or plasma membrane intrinsic protein PIP members. These relationships even
extend to the PIP1 and PIP2 subfamilies, origi- nally introduced by Kammerloher et al. [7]; easily
classified as PIP1 or PIP2 based on specific arrays of amino acids at the N- and C-termini.
Although DNA sequences with high homology to the aquaporin genes have been identified in
several plant species [4], the water permeability and function haven’t been determined, only a few
of the gene products have been characterized [6 – 11]. Their roles in response to various physiologi-
cal and stress conditions warrants further research. Here we report the isolation of the first water
channel gene to be identified in rice, the activity of its water permeability, and the possible role in
response to osmotic and chilling stress.
2. Materials and methods
2
.
1
. Plant material, osmotic and chilling treatments
Wasetoitsu Oryza sati6a cv. Josaeng Tongil is a less chilling-tolerant hybrid rice variety devel-
oped in the Republic of Korea. Seedlings and culture cells were prepared as described previously
[12]. For treatment with mannitol and NaCl, rice seedlings at the three leaf-stage were transferred to
fresh liquid Hoagland’s medium [5 mM CaNO
3 2
, 5 mM KNO
3
, 2 mM MgSO
4
, 0.025 mM FeSO
4
- EDTA in tap water] containing 0.25 M mannitol
or 0.15 NaCl, at 25°C. For chilling, after mannitol treatment the seedling was washed with tap water,
and transferred to fresh Hoagland’s medium, incu- bated for 24 h at 4°C and then transferred to 25°C
for 24 h.
2
.
2
. cDNA library construction and screening Total RNA was extracted from leaves that had
been treated for 30 min with 0.5 M mannitol. A cDNA library was constructed in the NotI site of
lgt10. Aliquots of the cDNA were used as a template for the polymerase chain reaction PCR
with designed primers corresponding to the se- quences surrounding the Asn-Pro-Ala motif of
aquaporins [5]. A PCR product of 393 bp was subcloned into the pT7Blunt vector Novergen,
USA and sequenced on both strands using ABI373 Applied Biosystem USA. This DNA
fragment was radioactive labeled with [a
32
P]dCTP by random DNA labeling Takara, Japan and
was used as a hybridization probe to screen 3 × 10
5
plaques from the cDNA library. A positive plaque was isolated and the insert of the phage
DNA was subcloned into a pBluescript KS
+
ac- cording to the manufacturer’s protocol Strata-
gene, USA. The subcloned cDNA, rwc
1
, was sequenced and analyzed using the
GENETYX
Ver- sion 8 Software Development Co., Japan.
2
.
3
. Northern analysis Total RNA was prepared as described by Koga-
Ban et al. [13], and 5 mg of total RNA was fractionated on a 1.2 denaturing formaldehyde
agarose gel. The RNA was transferred to a Hy- bond™-N
+
membrane Amersham, UK using 200SSC [14]. Prehybridization and hybridization
were performed using a rapid-hybridization buffer, as suggested by the manufacturer Amersham.
The probe was the full-length rwc
1
sequence la- beled with
32
P by the random primer method Takara, Japan.
2
.
4
. Competiti6e PCR Transcription levels of rwc
1
were specifically determined by the competitive PCR method [15].
Competitor lambda RNA 448 bases against rice actin mRNA accession number X15863 [16] was
made from a lambda DNA fragment placed in between the rice actin 5primer 5
-AGAGCTAC- GAGCTTCCTGATGGAC-3
and 3 primer
5- GAGAGATGCCAAGATGGATCCTCC - 3 regions. A SP6 promoter 5
-ATTTAGGTGA- CACTATAGAATAC-3
, induced upstream of the 5actin primer, was used to synthesize RNA
using SP6 polymerase according to the manufac- ture’s
protocol Takara,
Japan. Competitor
lambda RNA 530 bases against rwc
1
mRNA was prepared in the same manner from a lambda DNA
fragment that was spaced by rwc
1
55 -ATCTA-
CAACAAGGACCATGCCTGGA-3 and rwc
1
3 5
- ATTACACGATTGAGTTGTTCAGGGT - 3 primer, and placed downstream of the SP6 pro-
moter. Using the rwc
1
or actin-primers, fragment sizes of 333 bp for actin and 280 bp for rwc
1
are obtained by RT-PCR using total RNA. The reac-
tion mixture contained 10 ng of sample RNA, 10
5
– 10
9
copies of competitor lambda RNA, 10 pmol of random 9 mer primer, 1 U of AMV
reverse transcriptase, 4 U of RNase inhibitor, and 4 mM dNTP mixture in 4 ml of PCR buffer 10
mM Tris – HCl, pH 8.3, 50 mM KCl and 5 mM MgCl
2
. cDNA synthesize was allowed to proceed for 30 min at 42°C, followed by denaturation for 5
min at 99°C. The 4 ml cDNA solution was then mixed with 16 ml of PCR reaction mixture contain-
ing 1 – 4 pmol each of the particular 5and 3 primers, and 0.5 U of Taq polymerase in PCR
buffer. Samples were amplified by 30 cycles at 94°C for 0.5 min, 55°C for 0.5 min, and 72°C for
1 min. An aliquot of each reaction mixture was subjected to electrophoresis on 3 NuSive agarose
gel.
2
.
5
. In 6itro synthesis of rwc
1
cRNA The rwc
1
gene which was cut from the plasmid with BamHI was inserted into the BglII site of the
Xenopus expression
construct pXbGev-1;
a pSP64T-derived
pBluescript-type vector
into which Xenopus b-globin 5and 3untranslated
sequences were inserted [1]. Recombination of the plasmid was checked by sequencing. Capped RNA
transcripts of rwc
1
were synthesized in vitro using T3 RNA polymerase and linearized recombinant
plasmids containing rwc
1
cDNA after digestion with BamHI Stratagene. After ethanol precipita-
tion, the synthesis products were suspended in diethylpyrocarbonate-treated H
2
O at a final con- centration of 1 mgml.
2
.
6
. Microinjection of cRNA into oocytes and water permeability analysis
Mature oocytes 1.2 – 1.3 mm diameter, stage V and VI were isolated from adult Xenopus la6is
[17,18] and stored in Barth’s buffer containing Na-penicillin 10 mgml and streptomycin 10 mg
ml. The follicular cell layer was removed by incu- bation with 2 mgml collagenase Boehringer,
Germany in Barth’s buffer for 2.0 – 2.5 h at 25°C with gentle continuous agitation. Defolliculated
oocytes were injected with 46 nl of cRNA 1 mgml or water using an automatic injector
Nanoject; Drummond. The oocytes were incu- bated for 2 days at 18°C in Barth’s buffer before
water permeability measurements. Individual
oocytes were
transferred from
Barth’s buffer 200 mosm to a three-fold dilution of Barth’s buffer with distilled water 70 mosm at
20°C. Oocyte swelling was checked using an area Colony Analyzer CA-7, Toyo Sottuki, Japan.
The area covered by the oocytes was measured at 5-s intervals; the total cell volume was calculated
from the cell area. The relative oocyte volume VV
was calculated from the relative oocyte area AA
using the equation VV =
AA
32
. The osmotic water permeability coefficient Pf,
cms was calculated from oocyte surface area S = 0.045 cm
2
, initial oocyte volume V =
9 × 10
− 4
cm, water volume V
w
= 18 cm
3
mol, and the initial rate of oocyte swelling, dVV
dt, using
the equation
Pf = V dVV
dt[SV
w
- osmout − osmin], where osmout is 70 mosm and
osmin is 200 mosm.
3. Results and discussion
