tially understood. The lack of knowledge is due, in part, to the complexity of peroxidase isozymes
expressed within a given plant tissue. Cloning of plant peroxidase genes could help in elucidating
the physiological role of individual peroxidase iso- forms during plant normal development and in
response to various environmental factors. Under- standing the expression pattern of individual per-
oxidase isozymes may lead to understanding their function. Without gene-specific probes, separation
of the expression patterns of closely related perox- idases may be difficult due to similarity in se-
quence and transcript size. Cloning of plant peroxidase genes also could open the possibility of
transgenic studies and in vitro site-mutagenesis analysis of various peroxidase isoforms. In this
report, we described the isolation and characteri- zation of four closely related peroxidase cDNAs,
the development of four sets of gene-specific per- oxidase primers, and the expression of GmEPa
1
as a fusion protein in Escherichia coli and its in vitro
folding to yield an active enzyme.
2. Materials and methods
2
.
1
. cDNA library construction and screening Total
RNA was
extracted from
soybean Glycine max cul. Resnik seedbuds 21 days after
flowering as previously described [7]. PolyA-en- riched RNA was prepared from total RNA using
PolyATract Promega and the cDNA library was constructed in the unidirectional vector Uni-ZAP
XR Stratagene.
A plant peroxidase specific primer PSP was designed from a plant peroxidase conserved amino
acid region distal heme ligand, HFHDCFV 5 CACTTTTCCACTGACTTGCTTTC
TGT 3 [8]. The plant peroxidase-specific probe was generated using the 3 RACE system with
soybean seed bud total RNA and PSP as described by the manufacturer GIBCOBRL except that
hot-start PCR was performed. The PCR-RACE products were cloned into pCR™ II plasmid In-
vitrogen. DNA from 20 clones was purified and digested with EcoRI, fractionated by electrophore-
sis on a 1 agarose gel, and blotted on a nylon membrane and probed with [g-
32
P]dATP-end-la- beled PSP. A single positive clone was random-
prime-labeled with [a-
32
P]dCTP and used for primary screening of the cDNA library. Prehy-
bridization was conducted in 6 × SSPE, 5 × Den- hardt’s, 0.5 wv SDS, 100 mgml denatured
salmon sperm DNA, and 50 vv formamide at 42°C for 2 h. Hybridizations were done overnight
and the conditions were the same as those in prehybridization, except that 1 × Denhardt’s solu-
tion was used. Membranes were washed three times for 30 min each with 0.1 × SSPE and 0.1
wv SDS at 65°C.
PCR using PSP and the vector primer T
7
was used to purify single phage clones. Phage particles
were eluted by incubating primary picks andor single plagues in 500 ml of SM buffer 100 mM
NaCl, 10 mM MgSO
4
, 0.01 wv gelatin in 50 mM Tris pH 7.5 at room temperature for 2 h.
The PCR cycling parameters were 94°C for 4 min followed by 30 cycles of 1 min at 94°C, 1 min at
57°C, and 1 min at 72°C, and then followed by a final extension at 72°C for 5 min. PCR reaction
conditions were 1 × reaction buffer 500 mM KCl, 100 mM Tris – HCl, pH 9.0 and 1.0 vv
Triton X-100, 1.5 mM MgCl
2
, 200 mM each dNTP, two units of Taq DNA polymerase, 1 mM
each primer and 2 ml of phage particle elution in 50 ml total volume.
2
.
2
. DNA sequencing and analysis DNA sequencing of both strands was performed
using Sequenase Kit 2.0 USB and SK and KS primers. Synthetic primers corresponding to inter-
nal sequences of cDNA were made to complete sequencing. Sequences were optimally aligned us-
ing the PILEUP program of the Wisconsin GCG software package, and the DISTANCES program
was used to determine the similarity percentage. The dendrogram was generated using the cluster-
ing algorithm in PILEUP, which aligns the most similar sequences prior to alignment with more
distantly related sequences.
2
.
3
. Re6erse transcription PCR RT-PCR
cDNA specific primers designed from 3 un- translated regions of each peroxidase cDNA and
PSP were used in reverse transcript PCR RT- PCR to study expression patterns. For GmEpa
1
, GmEpa
2
, GmEpb
1
, and GmEpb
2
the primers were 5
AAATTAACTCAGCTGTGGG 3,
5 GGAACCCACTTATTCCATCG
3, 5
CC-
CAAGACATGCTTGAGAT 3,
and 5
AAGTTCATACTTCTAAC 3, respectively. A total of 5 mg of total RNA from different
soybean tissues was used for synthesizing the first strand of cDNA using SUPERSCRIPT™ II
Rnase H
−
REVERSE TRANSCRIPTASE as sug- gested by the manufacturer GIBCOBRL. RT-
PCR conditions were the same as those in 3 RACE except that the annealing temperature for
GmEpb
2
was 45°C. A total of 20 ml of PCR products was electrophoresed on a 1 wv
agarose gel and visualized with ethidium bromide.
2
.
4
. In 6itro folding of bacterially expressed GmEPa
1
and GmEPb
1
proteins The open reading frames including the 5 leader
sequences of GmEPa
1
and GmEPb
1
were PCR- amplified and cloned into the pET-34b + expres-
sion vector
Novagen. The
primers complementary to the lower strands were designed
with a BamH I site at the 5 ends and the primers complementary to the upper strands with a Xho I
site GmEPa
1
: 5 GACGGATCCATGGGAAG- CAACTTGAGGTTTTTG
3, 5
GACCTC- GAGTTAGCTATTTATAAATGCACAATG 3;
GmEPb
1
: 5
GACGGATCCATGGCTGT- CATGGGTGCATTCTTG 3, 5 ACCTCGAG-
TAATTCTGCAGCCCTTCTTTCCTCCTG 3.
PCR products were digested with BamH I and Xho I and ligated to pET-34b + digested with
the same two enzymes. The constructs were then transformed into BL21 DE3 competent E. coli
cells.
An overnight culture of 5 ml of BL21 was inoculated into a 100-ml culture containing 50
m gml kanamycin. The inoculated culture was
grown at 37°C with vigorous shaking until an OD
600
of 1.0. The 100-ml culture was then split into 2 × 50-ml cultures. IPTG was added to one of
the 50-ml cultures to a final concentration of 1 mM. The other culture was used as an uninduced
control. The 2 × 50-ml cultures were further grown for 5 h after IPTG induction. Different
temperatures and media additives were used dur- ing the bacterial growth. Isolation of total cell
proteins, inclusion bodies and cellulose binding domain CBD fused peroxidase were performed
according to the manufacturer Novagen. Inclu- sion bodies were washed twice with buffer 200
mM Tris – Cl pH 8.0, 100 mM EDTA, 100 mM DTT, 10 vv Triton X-100 before being fully
solubilized in 10 vol. of 6 M urea, 1 mM DTT in 50 mM Tris – Cl pH 8.0.
A single-step dilution was used for the dena- tured protein refolding. A total of 10 mg 1mgml
of the inclusion body prep was slowly diluted in 190 ml of PBS, which once diluted, contained 2 M
urea, 5 mM CaCl
2
, 10 mM hemin and 0.1 mM DTT PBS: 137 mM NaCl, 1.47 mM KH
2
PO
4
, 8.10 mM Na
2
HPO
4
, and 2.68 mM KCl, pH 8.0. After overnight incubation at room temperature,
20-ml aliquots of the folding mixtures were trans- ferred to the wells of a microtiter plate, and perox-
idase activity was monitored using substrate tetramethylbenzadine as described by Vierling and
Wilcox [9].
3. Results
