Journal of Life Sciences Volume 5 Number (7)
J LS
Journal of Life Sciences
Volume 5, Number 8, August 2011 (Serial Number 40)
Contents
Research Papers
Quantifying Neuromuscular Electrical Stimulation Dosage after Knee Arthroplasty
Adam R. Marmon and Lynn Snyder-Mackler 584
The Role of Mouse Wnt9a in MA891 Breast Cancer Cell Proliferation
Xueqin Zheng, Xiaonian Zhong, Wenjing Meng, Chengneng Mi, Shuangmei Liu, Yuehui Li, Shen Yu, Jie Zhao, Lin Zhang, Dongxiang Li, Dongsong Nie and Yang Xiang
A Family of Origin Scale in Mothers of Children with Autistic Spectrum Disorder-Preliminary Report
Piotr W. Gorczyca, Agnieszka Kapinos-Gorczyca, Maciej Kapinos, Aleksandra Leksowska, Katarzyna Ziora, Joanna O święcimska and Jarosław Sobiś
Modified Multiple Scale/Segment Entropy (MMPE) Analysis of Heart Rate Variability of NHH, CHF & AF Subjects
Chodavarapu Renu Madhavi and Alevoor Gopal Krishnachar Ananth
598 Proteome Profiles of Longissimus and Biceps Femoris Porcine Muscles Related to Exercise and Resting
Marinus F.W. Te Pas, Els Keuning, Dick J.M. Van De Wiel, Jette F. Young, Niels Oksbjerg and Leo
Kruijt 609
Effects of Sublethal Doses of Chlorfluazuron on Ovarioles in the Common Cutworm, Spodoptera Litura (F.) (Lepidoptera: Noctuidae)
Farzana Perveen
40 614 Potassium 40 Concentration by Natural K- Ar γ Rays Detection in Four Basic Diet Products (Milk,
Eggs, Wheat and Corn)
Juan Manuel Navarrete, Trinidad Martínez, Luis Cabrera, Pilar Lizárraga, Miguel Angel Zúñiga and
Michelle Camacho 618
Influence of Saline Stress on Ionic Balance of Wheat (Triticum Aestivum) and Its Wild Congeners
Nina Terletskaya, Batyrbek Sarsenbayev and Yerlan Kirshibayev 625
The Research on the Distribution, Abundance and Some Ecological Characteristics of Neuroterus
Species (Hymenoptera: Cynipidae) in Oak Forest of West Azerbaijan (Iran)
Mohammed Reza Zargaran, Mohammed Hassan Safaralizadeh, Ali Asghar Pourmirza and Esmaeil Alizadeh
634
Effect of Natural Infection with Onion Yellow Dwarf Virus (OYDV) on Yield of Onion and Garlic Crops in Egypt
Salah Elnagar, Mohamed Abdel-Kader El-Sheikh and Abeer Salah El-Deen Abd El-Wahab 639
In Vitro and In Silico Studies of Lunacridine from Lunasia Amara Blanco as Anticancer
Zubair M. Sulaiman, Subehan Lallo and Natsir Djide 646
The Influence of the “Terroir” Concerning the Quantity and Quality of Grapes Yield at White Grapevine Varieties Growing in the Iasi Vineyard
Liliana Rotaru, Vasile Stoleru, Feodor Filipov, Mihai Mustea and Gabriela Petrea 654
Food Color Memory and Names–A Linguistic Vantage
Jodi Louise Sandford 661
Analytical Study of Ground Painting Layers and Conservation Processes of an Egyptian Painted Coffin
Hala Afifi Mahmood and Mostafa Ahmed AbdEl Fatah 670
An Investigation of Environmental Education Knowledge for Sustainable Development in High School Sectors in UK
Mayowa Akinyele Abolaji, Olusegun Adekunle Oke and Adekunle Adebanjo
Journal of Life Sciences 5 (2011) 581-583
Quantifying Neuromuscular Electrical Stimulation Dosage after Knee Arthroplasty
Adam R. Marmon and Lynn Snyder-Mackler Department of Physical Therapy, University of Delaware, Newark, DE 19716, USA
Received: February 25, 2011 / Accepted: May 13, 2011 / Published: August 30, 2011.
Abstract: Recovering functional ability after total knee arthroplasty (TKA) requires recovery of strength and voluntary activation. Short-term recovery of strength and activation are enhanced following a protocol combining strength training with neuromuscular electrical stimulation (NMES). The purpose of the study was to determine if a dose response curve could be constructed for patients who received NMES as part of their treatment after TKA. NMES dosage was quantified as the electrically evoked knee extensor torque, expressed as a percentage of the subject’s maximal voluntary contraction. Dose-response curves were generated, with the associations between NMES training intensity and quadriceps strength, voluntary activation, and lean muscle cross-sectional area examined using Pearson Product-Moment Correlation Coefficients. Significantly, linear correlations were observed between NMES training intensity and both quadriceps strength and voluntary activation, but not lean muscle cross-sectional area. These results suggest that maximizing the elicited training force during rehabilitation will enhance short-term recovery following TKA.
Key words: Quadriceps strength, voluntary activation, total knee arthroplasty, neuromuscular electrical stimulation, rehabilitation.
1. Introduction and voluntary activation. The purpose of this study was to establish a dose-response curve and determine how
Total knee arthroplasty (TKA) procedures are the intensity of NMES treatment after TKA influences expected to increase substantially over the next 20 the improvement in quadriceps strength, atrophy, and years [1]; however, consensus on treatment regimens activation. We hypothesized a positive dose-response following TKA remains equivocal. Quadriceps
relationship for all.
strength is a primary determinant of lower extremity functional ability [2]; with a larger portion of the
2. Materials and Methods
quadriceps weakness observed in patients following
2.1 Subjects
TKA attributable to reductions voluntary activation than to muscle atrophy [3]. Improvements in both
Seventy individuals (29 women; 51-82 yrs) quadriceps strength and voluntary activation have been
scheduled for unilateral TKA who were included in the demonstrated after surgery with the use of progressive
NMES arm of the trial were the subjects for this study quadriceps strength training combined with [4]. Exclusion criteria included severe obesity (BMI ≥ neuromuscular electrical stimulation (NMES) [4].
40 [5]), history of diabetes, uncontrolled high blood Therefore, it is important to understand how the
pressure, cardiovascular disease, and symptomatic training dosage of NMES used for patients who have
osteoarthritis in the contralateral knee or history of undergone TKA influences quadriceps strength, size
other function-limiting lower extremity pathologies. Subjects who received NMES were evaluated for
Corresponding author: Adam R. Marmon, Ph.D., changes in quadriceps strength and voluntary postdoctoral researcher, research fields: applied and basic
concepts in neuromuscular physiology. E-mail: activation at initial evaluation (IE; ~4 weeks after marmon@udel.edu.
Quantifying Neuromuscular Electrical Stimulation Dosage after Knee Arthroplasty
surgery), midway through the intervention (Mid), and burst super-imposition technique [7]. A Grass S8800 after completing the intervention (End). Atrophy was
stimulator delivered a 12-pulse, 100-Hz train of stimuli assessed before and after the intervention with magnetic
at 135 Volts (Grass Instruments; West Warwick, RI) resonance imaging (MRI). The study was approved by
through two electrodes (7.2 × 12.7 cm; CONMED the University of Delaware’s Human Subject Review
Corp, Utica, NY) applied proximally over the rectus Board and subjects provided informed consent.
femoris and distally over the vastus medialis. A program controlled the timing of stimuli to be delivered
2.2 Neuromuscular Electrical Stimulation Training during the plateau in force of an MVC (LabView 4.01,
Subjects received 6-weeks of progressive strength National Instrument; Austin, TX). Voluntary activation training [6] with neuromuscular electrical stimulation
was quantified with the central activation ratio (CAR) [4] (2-3 times/week) beginning 3-4 weeks after surgery [4].
as the percentage increase in force after stimulation The NMES was performed on an electromechanical
above the MVC force.
dynamometer (KinCom; Chattanooga Corporation, Lean Muscle Cross Sectional Area (LMCSA) of the Chattanooga, TN), with the knee flexed to 60° and the
quadriceps was quantified in 29 of 70 subjects using hip flexed to ~90°. The protocol comprised 10
MRI before (IE) and after (End) the intervention. electrically evoked contractions of the quadriceps
Subjects were imaged axially, from greater trochanter delivered through two self-adhesive electrodes (7.62 ×
to tibial plateau (7 mm interslice intervals) while laying
12.70 cm; ConMed; Utica, NY) for 10 s, with a 2.5 kHz supine, knees extended, in a 1.5 Tesla body coil (Signa, sinusoidal wave at 50 Hz (Electro Med Health
General Electric, Waukesha, WI) using standard Industries; Miami, FL). Stimulus intensity was sequence imaging (GE SPGR: 2-D spoiled determined by each subject’s maximum tolerance, with
gradient-echo, 500-ms pulse TR, 8-ms TE with a 256 X target dosage of at least 30% of the subject’s maximal
256 encoding matrix and 480X480-mm field of view). voluntary contraction (MVC). The dose of each
Images were processed in IMOD software (The contraction was recorded as a percentage of the
Boulder Laboratory for 3D Electron Microscopy of involved knee MVC. Dose was defined as the average
Cells; Boulder, Colorado) digitally outlining the recorded dose over the 18 sessions.
quadriceps (Intuos 2; Wacom Corporation; Vancouver, Washington). Customized software scaled the outlines
2.3 Quadriceps Strength, Voluntary Activation, and Size and removed intramuscular fat and connective tissue to
Quadriceps strength and voluntary activation were calculate the enclosed LMCSA. The MRI image with also recorded on a KinCom, with hip flexed ~90 ° and
the largest LMCSA was used for data analyses. knee flexed ~75 °. The axis of rotation was aligned with
2.4 Data Analysis
the lateral femoral condyle and the distal end of the lever arm secured to the lower leg ~2 cm above the
Repeated measures ANOVAs were performed to lateral malleolus. Subjects completed submaximal and
examine changes in QI and CAR across time (IE, Mid, maximal knee extension contractions for familiarization
End) with Least Significant Difference used for and warm-up, with strength recorded as the peak force
pairwise comparisons in the presence of a main effect during a MVC; subjects received visual feedback and
(SPSS v15.0; SPSS Inc.; Chicago, IL). Huynh-Feldt strong verbal encouragement. Analysis of changes in
corrections were applied for unequal variance of the quadriceps strength was evaluated using the quadriceps
repeated measures factors. Paired samples t-test was index (QI = involved MVC/uninvolved MVC).
performed to determine changes in LCSA from IE to Voluntary muscle activation was assessed using the
End. The relations between training dose and response
Quantifying Neuromuscular Electrical Stimulation Dosage after Knee Arthroplasty
(change in QI, CAR and LMCSA) were evaluated using Pearson Product-Moment Correlation Coefficients. Significance for statistical analyses was P ≤ 0.05.
3. Results and Discussion
The treatments produced main effects for strength and activation (P < 0.001). Strength improved at each time point of the intervention, evident by significant changes in the QI (IE = 49.9 ± 22.9%; Mid = 66.2 ± 24.3%; End = 81.3 ± 26.7%). Similarly, activation levels increased at each time point (IE = 78.3 ± 15.4%; Mid = 87.7 ± 12.6%; End = 89.5 ± 10.1%). The
LMCSA significantly improved from IE (30.8 ± 12.7 cm 2 )
to the End (36.4 ± 14.6 cm 2 ) of treatment (P < 0.001). The average dose exceeded the minimal target of
30% MVC for all but eight subjects; one subject’s average dose was 10% MVC, seven subjects had average doses 23-29% MVC, with the group average of
55.6 ± 28.9% MVC (range 10%-203%). The stimulation training dosage was significantly
Fig. 1 The changes in quadriceps index (QI; A) and central
and positively correlated with changes in QI (r = 0.480;
activation ratio (CAR; B) as a function of the average
P < 0.001; Fig. 1A) and CAR (r = 0.574, P < 0.001; Fig.
training dosage were significant, P < 0.001.
1B), but not LMCSA (r = -0.325; P = 0.086). [2] R.L. Mizner, S.C. Petterson, J.E. Stevens, K. Vandenvorne,
Quadriceps strength, voluntary activation, and LMCA L. Snyder-Mackler, Early quadriceps strength loss after had statistically and clinically important improvements total knee arthroplasty, the contributions of muscle atrophy and failure of voluntary muscle activation, The
over the intervention period. NMES dose was Journal of Bone and Joint Surgery 87 (2005) 1047-1053.
significantly and positively correlated with strength [3] R.L. Mizner, J.E. Stevens, L. Snyder-Mackler, Voluntary and activation improvements, but not with increases in
activation and decreased force production of the LMCSA. NMES overcomes activation deficits during quadriceps femoris muscle after total knee arthroplasty, Physical Therapy 83 (2003) 359-365.
application. Perhaps the main mechanism by which [4] S.C. Petterson, R.L Mizner, J.E. Stevens, L. Raisis, A. NMES contributes to muscle strength gain is via its
Bodenstab, W. Newcomb, et al., Improved function from effects on voluntary muscle activation.
progressive strengthening interventions after total knee arthroplasty: A randomized clinical trial with an imbedded
Acknowledgments
prospective cohort, Arthritis & Rheumatism 61 (2009) 174-183. [5] World Health Organization, Obesity: Preventing and
The authors gratefully acknowledge the funding managing the global epidemic, Report of a WHO Consultation, source for this study, The National Institutes of Health
WHO Technical Report Series 894, Geneva, 2000, p. 9. [6] J.E. Stevens, R.L Mizner, L. Snyder-Mackler,
NIH R01-HD041055. Neuromuscular electrical stimulation for quadriceps muscle strengthening after bilateral total knee arthroplasty:
References
A case series, The Journal of Orthopaedic and Sports, [1] S. Kurtz, F. Mowat, K. Ong, N. Chan, E. Lau, M. Halpern,
Physical Therapy 34 (2004) 21-29. Prevalence of primary and revision total hip and knee
[7] J.A. Kent-Braun, R. Le Blanc, Quantification of central arthroplasty in the United States from 1990 through 2002,
activation failure during maximal voluntary contractions The Journal of Bone & Joint Surgery 87 (2005) 1487-1497.
in humans, Muscle Nerve 19 (1996) 861-869.
Journal of Life Sciences 5 (2011) 584-589
The Role of Mouse Wnt9a in MA891 Breast Cancer Cell Proliferation
Xueqin Zheng, Xiaonian Zhong, Wenjing Meng, Chengneng Mi, Shuangmei Liu, Yuehui Li, Shen Yu, Jie Zhao, Lin Zhang, Dongxiang Li, Dongsong Nie and Yang Xiang Department of Chemistry and Chemical Engineering, Hunan Institute of Science and Technology, Yueyang 414000, China
Received: March 06, 2011 / Accepted: May 04, 2011 / Published: August 30, 2011.
Abstract: Wnts are powerful regulators of cell proliferation and differentiation. Activation of Wnt signalling in many tissues has also been associated with cancer. RNAi is a process of posttranscriptional gene silencing, by which dsRNA induces sequence-specific degradation of homologous gene transcripts. In many eukaryotes, expression of nuclear-encoded mRNA can be strongly inhibited by the presence of a small double-stranded RNA corresponding to exon sequences in the mRNA. In this study the pAVU6+27 vector, which has SalI and XbaI clone sites, was used to construct the siRNA expression vectors for mouse wnt9a. Four kinds of small interfering RNA inserts were designed, synthesized and visually tested for efficacy by in situ hybridization, the results demonstrated that dramatically reduced wnt9a signals were observed in the cells transfected with U6+27 cassettes with anti-wnt9a hairpin siRNA inserts compared with the untransfected. The results of flow cytometry analysis showed that the cell proliferation was promoted after lowering expression of the mouse wnt9a in MA891 cells by RNAi. All that suggest the expression level of mouse wnt9a in breast cancer MA891 cells may play a role in adjusting the rate of proliferation.
Key words: Mouse wnt9a, RNAi, MA891, proliferation.
1. Introduction adhesion are involved in cancer induction and progression. Loss of cadherin expression can also
Wnts are secreted lipid-modified signaling proteins
promote tumorigenesis.
and powerful regulators of cell proliferation and RNA interference (RNAi) is a process of differentiation, and their signaling pathway involves posttranscriptional gene silencing, by which proteins that directly participate in both gene double-stranded RNA (dsRNA) induces transcription and cell adhesion [1]. The central player sequence-specific degradation of homologous gene is β-catenin, which is a transcription cofactor with T transcripts [4]. Efficient RNA-interference cell factor/lymphoid enhancer factor TCF/LEF in the technologies are used to antagonize gene function.
Wnt pathway [2] and a structural adaptor protein RNAi is now established as a general method to silence
linking cadherins to the actin cytoskeleton in cell-cell gene expression in a variety of organisms. When
adhesion. Wnts influence multiple processes in animal development [1]. Nineteen Wnt genes exist in
introduced into cells the dsRNA will interfere with the expression of homologous genes, subsequently
mammalian genomes [2]. In many tissues, activation of Wnt signalling has also been associated with cancer [3].
disrupting their normal function. This suppression is Unchecked Wnt signaling and/or the loss of cell-cell
mediated by a small RNA duplex of 21-23-nt length with symmetrical 2-nt 3’ overhangs [5], which induce
Corresponding author: Yang Xiang, Ph.D., professor, research field: molecular and cell biology. E-mail:
degradation of mRNA based on complementary base xiangyangbio@126.com.
pairing. The input RNA molecule can be either in the Dongsong Nie, Ph.D., research field: molecular and cell
biology. E-mail: ndz1997@126.com. form of a long dsRNA or a hairpin dsRNA [6], both
The Role of Mouse Wnt9a in MA891 Breast Cancer Cell Proliferation
being subsequently processed into siRNA by Dicer expressed shRNA vector pAVU6+27/m9aRNAis, endonuclease [7]. However, the long dsRNAs provoke
leading to dramatic reduction of wnt9a signals
a strong cytotoxic response through the activation of observed by in situ hybridization test as compared to RNA-Dependent Protein Kinase PKR in mammalian
the untransfected cells. Cell cycle analysis by flow cells [8]. This non-specific cytotoxic effect can be
cytometry suggested that cell proliferation was overcome by directly applying synthetic siRNAs, pools
promoted after RNAi for mouse wnt9a in MA891 cells, of siRNAs, or DNA vector-expressed small RNA
and was reduced after-over expression of mouse wnt9a. transcripts, including shRNAs and siRNAs.
2. Materials and Methods
Considering the delivery of shRNA (short-hairpin RNA) into mammalian cells, the best-characterized transient
2.1 Construction of siRNA Expression Vectors expression methods are the systems based on the
pAVU6+27, which contains human U6 promoter pAVU6+27 integration and pAVU6+27, which contains
and the first 27-bp of U6 RNA coding sequence, has human U6 promoter, the first 27-bp of U6 RNA
been described by Paul et al. [9]. A series of shRNA coding sequence and SalI / XbaI clone sites, have been
expression vectors were generated by inserting described by Paul et al. [9]. pAVU6+27 vectors were
annealed oligos sequence into pAVU6+27 vector used researing RNAi for human and mouse genes [10].
between SalI and XbaI sites respectively. The However, the emergence of gene ablation technologies
pAVU6+27 vector was digested with SalI and XbaI to based upon the RNA interference phenomenon has
generate compatible ends for cloning. The sequences of opened up new experimental opportunities. In four siRNAs for mouse wnt9a were designed by using
particular, the generation of vectors directing the the Ambion web-based criteria. Their primer pairs for synthesis of short hairpin RNAs that are processed to
RT-PCR were synthesized by Invitrogen Co. as follows: small siRNAs enables suppression of endogenous gene
M9A RNAi-1 F 5-TCGA aagtacagcagcaagtttgtc expression [11]. Synthetic siRNA duplexes and
CTTG gacaaacttgctgctgtactt TTTT-3, vector-derived siRNAs have been shown to inhibit the
M9A RNAi-1 R 5-CTAG AAAA expression of mouse Wnt16 that targeted-Wnt16b
aagtacagcagcaagtttgtc CAAGgacaaacttgctgctgtactt-3; inhibition leads to apoptotic cell death of
M9A RNAi-2 F 5-TCGAaa caacctcgtgataaaggct lymphoblastoid leukemia cells [12]. Wnt 9a
CTTG agcctttatcacgaggttgtt TTTT-3, predominantly expressed in the mural trophoblast and
M9A RNAi-2 R 5-CTAG AAAA inner cell mass cells surrounding [13]. Wnt9a has been
aacaacctcgtgataaaggct CAAGagcctttatcacgaggttg-3; implicated as being a player in joint induction, based on
M9A RNAi-3 F 5-TCGA aaccacttgcaaatgccatgg gain-of function experiments in chicken and mouse.
CTTG ccatggcatttgcaagtggtt TTTT-3, Wnt9a is a temporal and spatial regulator of Indian
M9A RNAi-3 R 5-CTAG AAAA hedgehog (Ihh), a central player of skeletogenesis.
aaccacttgcaaatgccatgg CAAGccatggcatttgcaagtggtt-3; Wnt9a signaling is required for joint integrity,
M9A RNAi-4 F 5-TCGA aacacaaatatgagacctcgc regulation of Ihh during chondrogenesis [14], and
CTTG gcgaggtctcatatttgtgtt TTTT-3, required for joint integrity and regulation of Ihh during
M9A RNAi-4 R 5-CTAG AAAA chondrogenesis. Wnt9a secreted from the walls of
aacacaaatatgagacctcgc CAAGgcgaggtctcatatttgtgtt-3. hepatic sinusoids is essential for morphogenesis,
Every pairs of primers were incubated at 95 °C for 5 proliferation, and glycogen accumulation of chick
min with 1×annealing buffer (10 mmol/L Tris-HCL hepatic epithelium [15]. In this study, we show that the
and 100 mmol/L NaCl), and then gradually cooled to mouse wnt9a mRNA were targeted by transiently
room temperature. The annealed shDNAs were
The Role of Mouse Wnt9a in MA891 Breast Cancer Cell Proliferation
inserted into the digested pAVU6+27 vectors with SalI AGTTCCGCCCATTCTCCGCCCCATG-3’. The probes and XbaI clone sites. The shRNA expression vectors,
were labeled with digoxigenin. To get specific signals, pAVU6+27/m9aRNAi-1, pAVU6+27/m9aRNAi-2, in situ hybridization was done as follows: cells were pAVU6+27/m9aRNAi-3 and pAVU6+27/m9aRNAi-4,
washed in 0.1 M PBS (pH 7.2-7.6) twice, each for 5 were transformed into E.coli DH5a and identified by
min, treated with H 2 O 2 mix (H 2 O 2 :methanol = 1:50) for RT-PCR using sense primer, 30 min and washed in distilled water for three times,
5 ′-CTAACTGACACACATTCCAC-3′ and antisense each for 5 min. Then the cells were digested by 3% primer, 5 ′-GCAATAAACAAGTTACTAGTCC-3′.
pepsin (diluted by citric acid) for 30 s, washed in 0.5 M The resulting products were analyzed by PBS (pH 7.2-7.6) three times, each for 5 min. Washed electrophoresis on a 2.0% agarose gel and sequenced.
cells in distilled water for 5 min and then post-fixed in buffered 1% paraformaldehyde in 0.1 M PBS (pH
2.2 Cell Culture and Transfection 7.2-7.6) containing 0.1% DEPC and washed cells in
A mouse MA891 breast cancer cells were distilled water three times, each for 5 min. maintained in RPMI-1640 medium supplemented with
Pre-hybridization was performed for 3 h. Subsequently, heat-inactivated 10% fetal calf serum (FCS) and 1%
hybridization was performed in a solution containing antibiotic/antimycotic solution at 37 °C in a humidified
digoxigenin-labeled mouse wnt9a probes. The control
cells were treated with the solution without wnt9a split three to four times a week after trypsinization.
incubator with 5% CO 2 . The cell line was routinely
probes. Slides were incubated at 38 °C for 16 h in a Twenty-four hours before transfection, MA891 cells
humidified chamber. Post-hybridization washes were were splitted and seeded in 6-well culture plates at
performed at 37 °C by incubation in 2×SSC twice, each 1×10 5 cells per well. The cells were transiently
for 5min; in 0.5×SSC for 15 min and in 0.2×SSC twice, transfected with 2.0 μg of the empty vectors
each for 15 min. The cells were incubated in blocking pAVU6+27 and 2.0 μg of the RNA expression vectors
buffer for 30min at 37 °C and then incubated with pAVU6+27/m9aRNAis using Lipofectamine 2000
biotined antidigoxigenin antibody at 37 °C for 2 h. The (Invitrogen, Carlsbad, CA, USA) according to the
slides were washed in 0.5 M PBS (pH 7.2-7.6) four manufacturer’s instructions. The cells were splitted
times, each for 5 min. Cells were incubated in SABC at after one day transiently transfected and then the cells
37 °C for 20 min. Slides were washed in 0.5 M PBS were collected at three days post-tansfection for flow
(pH 7.2-7.6) three times, each for 5 min. After that, cytometry analysis, or were reserveted for in situ
cells were incubated in biotined peroxidase at 37 °C for hybridization.
20 min. Slides were washed in 0.5 M PBS (pH 7.2-7.6) four times, each for 5min. The specific signals were
2.3 In Situ Hybridization Analyses visualized by incubation in DAB buffer. Water was
Mouse wnt9a in situ hybridization kit was purchased used to end the reactions. Cells were re-dyed with from Boster Bio-engineering Co.. Being longer probes
haematoxylon and photographs were taken. were difficult to penetrate the cell, short
2.4 Cell Cycle Analysis by Flow Cytometry oligonucleotide probes were used in this study. To
strengthen the signals, three probes were used. The Cell-cycle phase distribution was analyzed by flow sequences of oligonucleotide probes were as follows:
cytometry using PI staining. Briefly, control for (1) 5’-GCACGGTGTTTCGTCCTTTCCACAAGAT
treating MA891 cells were harvested after ATATAAA-3’; (2) 5’-ATAGGCCCTCTTCCTGCCC
trypsinization and washing with 1×PBS, then fixed in GACCTTGGATCCGGCT-3’; (3) 5’-AACTCCGCCC
70% ethanol at a cell concentration of 1×10 6 /mL with
The Role of Mouse Wnt9a in MA891 Breast Cancer Cell Proliferation
samples not exceeding 3×10 6 cells, and then stained
with 50 μg/mL propidium iodide (containing 10 mg/ml RNase A) for 30 min at 4 ℃ . Resulting DNA distributions were analyzed on a FACSort (Becton Dickinson , San Jose , CA) with Cell Quest software (version 313) for the proportions of cells in G1, S and G2 phases of the cell cycle.
3. Results and Discussion
3.1 Construction of Expression Vector for Silence
Mouse Wnt9
Fig. 1 Four kinds of tested inserts of anti-mouse wnt9a RNA. Each would begin immediately after the SalI sequence,
In this study, the authors used pAVU6+27 vector,
and most terminations occur after the UUUU at 3’ terminus
which contains the SalI / XbaI cloning sites, to
of the insert.
construct the RNAi expression vector for the mouse to 4 U 3’-end overhangs [17]. Results from the wnt9a . siRNA expressed by using RNA polymerase III
experiment with synthetic siRNA [18] suggest that from the U6+27 cassettes was expressed primarily as
such 3’ overhangs can increase efficacy. full-length transcripts and was located in nucleus [16].
3.2 The Reduction of Mouse Wnt9a RNA Level after U6+27 transcripts contain the first 27 nucleotides of
mouse U6 RNA. Cassettes are designed so that the RNAi Examined by in situ Hybridization short RNA coding sequences are inserted between
To examine whether expressed shRNA duplexes unique SalI and XbaI sites. After the XbaI site, the
specifically target to mouse wnt9a and reduced the cassette encodes a strong stem to protect the transcripts
expression levels, the authors generated four kinds of against 3’-5’ exonuclease attack, then a poly (U)
shRNA expression vectors. The synthetic DNA oligos transcription termination sequence. However, the
encoding shRNAs were annealed and cloned insertion sequences discussed later also contain their
downstream of U6 promoter for the expression of own UUUU terminator at the 3' end of the inserted
double-stranded shRNA. Sequence TTTTT was sequences, terminating most transcription before the
introduced at the 3’-end of these oligos, which served cassette-encoded stem/terminator region [17]. as a transcription terminator for RNA polymerase III.
According to SalⅠ/XbaⅠ clone sites on pAVU6+27, The empty vector or its shRNA expression vectors the primers were designed as 21 bp-target sequence. To
were transiently transfected into the mouse MA891 study the function of mouse wnt9a, we targeted four
cells. The total RNA was isolated 48 h sites in mouse wnt9a mRNA. The inserted sequences
post-transfection and reverse-transcription PCR encoded four siRNA duplexes shown in Fig. 1. To
experiments were performed. The results demonstrated make the siRNA duplex as one short transcript, an
that the expressed shRNAs reduced the mouse wnt9a RNA insert was used that contains the 21-nucleotide
RNA level, whereas the empty vector had no effect on sense strand of the target, followed by a CUUG
the reduction of mouse wnt9a RNA level (data not tetraloop sequence, the antisense strand, and a UUUU
shown). Then, we used in situ hybridization to test the transcription terminator, in that order. This terminates a
effect of shRNA on mouse wnt9a. The transiently high percentage of the transcripts exactly at the end of
transfected, the MA891 cells were spit one day the siRNA stem. The 3’-UUUU overhang after the
post-transfection. The cells were digested into siRNA is attacked by 3’ exonucleases, leaving from 1
individual cells as possible, the cells were seeded in the
The Role of Mouse Wnt9a in MA891 Breast Cancer Cell Proliferation
6-well plates at 1×10 3 cells per well. Then, the cells were fixed and examined by in situ hybridization for mouse wnt9a after three days post-transfection. The results demonstrated that the cells showed, when U6+27 cassettes were used with anti-wnt9a hairpin siRNA inserts, dramatic reduction of wnt9a signals whereas as compared to the untransfected cells in the same fields under microscope (Figs. 2C-2F), whereas no elimination of wnt9a mRNA was observed MA891 cells transiently transfected with pAVU6+27 vector (Fig. 2A). Negative control has no hybridization signal (Fig. 2B) shown the hybridization probes having specific for mouse wnt9a.
3.3 The Influence Effect of Mouse Wnt9a on MA891 Cell Cycles
The flow cytometry analyses were applied and demonstrated the promoting proliferation of MA891
Fig. 2 The effect of U6+27-siRNAs transcripts. Mouse MA891 cells were transfected with pAVU6+27. With the U6+27-anti- mouse wnt9a cassette vector, and fixed with and probed with digoxigenin three days after transfection. The specific signals (deep brown in color) were visualized by incubation in DAB buffer. Cells were re-dyed with haematoxylon and photographs were taken. (A) transfections of pAVU6+27 without the anti- mouse wnt9a siRNA, as a control, showed that mouse wnt9a was stained into deep brown in all cells. (B) transfections of with pAVU6+27 the anti- mouse wnt9a siRNA, as a negative control, showed that the mouse wnt9a was stained lightly in all cells. (C)-(F) Transfection with U6+27 promoter cassettes containing the anti- mouse wnt9a siRNA1, siRNA2, siRNA3 and siRNA4, respectively, showed in Fig. 1. Transfected cell cytoplasms are in light color (negative stain), whereas cytoplasms are deep brown (positive stain) in untransfected cells.
cells by RNAi mouse wnt9a. Flow cytometric analysis of the cells transfected with expression vectors pAVU6+27/m9aRNAis (Fig. 3B-3E), for DNA content showed that the number of cells in G1 phase decreased and the number of cells in S, G2/M phases increased as compared with the cells transfected with pAVU6+27 (Fig. 3A), suggesting that lower expression of mouse wnt9a in MA891 cells promotes cell proliferation (Fig. 3).
4. Conclusions
In summary, our results clearly demonstrated that the pAVU6+27/m9aRNA expression vectors were effective in inhibiting transcription of the homologous mouse wnt9a RNA in cultured mammalian cells. Since RNAi technique has evolved as a powerful strategy for reverse functional genomics in various organisms and with tremendous therapeutic potentials in mammals, pAVU6+27 vector should provide a simple and rapid cloning tool for expression of the small interfering RNA transcripts, which can effectively induce RNAi-mediated gene silencing in mammalian cells. It is difficult to examine the efficiency of the transient transfection by RT-PCR, Western blot and RealTime PCR, because of the low transfection efficiency (about 30%). In this study, we used in situ hybridization to observe visually the effect of siRNA for mouse wnt9a. The cells proliferation was promoted after lowering expression of mouse wnt9a in MA891 cells by RNAi.
Fig. 3 Cell cycle distribution of the mouse MA891 cells induced by down-expression mouse wnt9a. (A) MA891 cells transfected with pAVU6+27 as control; (B)-(E) MA891 cells transfected with pAVU6+27/m9aRNAi-1, pAVU6+27/m9aRNAi-2, pAVU6+27/m9aRNAi-3, pAVU6+27/m9aRNAi-4, respectively, for down-expression of wnt9a.
The Role of Mouse Wnt9a in MA891 Breast Cancer Cell Proliferation
All suggest that the expression level of mouse wnt9a in vector-based RNAi systems in mammalian cells, Biochemical and Biophysical Research Communications
breast cancer MA891 cells may play a role in adjusting
330 (2005) 53-59.
the rate of proliferation. [9] C.P. Paul, P.D. Good, I. Winer, Active expression of small interfering RNA in mouse cells, Nat. Biotechnol.
Acknowledgment
20 (2002) 505-508. [10] Y. Xiang, G. Lin, Q.J. Zhang, Knocking down Wnt9a
This work was supported by grants from the mRNA levels increases cellular proliferation, Mol. Biol.
National Nature Science Foundation of China Rep. 35 (2008) 73-79.
(No.31071091; No.30971570; No.31171196) and [11] T. Tuschl, Expanding small RNA interference, Nat. Department of Education Key Project of Hunan
Biotechnol. 20 (2002) 446-448. [12] J. Mazieres, L. You, B. He, Inhibition of Wnt16 in mouse
Province, China (No.09A035; and No.06C370). acute lymphoblastoid leukemia cells containing the
Reference translocation induces apoptosis, Oncogene 24 (2005)
5396-5400.
[1] W.J. Nelson, R. Nusse, Convergence of wnt, catenin, and
G. Kemp, E. Willems, S. Abdo, S. Lambiv, Expression of cadherin pathways, Science 303 (2004) 1483-1487.
all wnt genes and their secreted antagonists during mouse [2] K.M. Cadigan, R. Nusse, Wnt signaling: A common theme
blastocystand postimplantation development, in animal development, Genes Dev. 11 (1997) 3286-3305.
Development Dynamics 233 (2005) 1064-1075. [3] T. Reya1, H. Clevers, Wnt signalling in stem cells and
D. Spater, T.P. Hill, R.J. O'sullivan, Wnt9a signaling is cancer, Nature 434 (2005) 843-850.
required for joint integrity and regulation of Ihh during [4]
A. Fire, S. Xu, M.K. Montgomery, Potent and specific chondrogenesis, Development 133 (2006) 3039-3049. genetic interference by double-stranded RNA in
[15] K. Matsumoto, R. Miki, M. Nakayama, Wnt9a secreted Caenorhabditis elegans, Nature 391 (1998) 806-811.
from the walls of hepatic sinusoids is essential for [5] P.D. Zamore, T. Tuschl, P.A. Sharp, RNAi:
morphogenesis, proliferation, and glycogen accumulation Double-stranded RNA directs the ATP-dependent
of chick hepatic epithelium, Dev. Biol. 319 (2008) 234-247. cleavage of mRNA at 21 to 23 nucleotide intervals, Cell
[16] P.D. Good, A. Krikos, S.X. Li, Expression of small, 101 (2000) 5-33.
therapeutic RNAs in mouse cell nuclei, Gene Ther. 4 [6] N. Tavernarakis, S.L. Wang, M. Dorovkov, Heritable and
(1997) 45-54.
inducible genetic interference by double-stranded RNA [17] P.P. Cynthia, P.D. Good, I. Winer, Effective expression of encoded by transgenes, Nat. Genet. 24 (2000) 180-183.
small interfering RNA in mouse cells, Nature [7]
E. Bernstein, A.A. Caudy, S.M. Hammond, Role for a
Biotechnology 20 (2002) 505-508.
bidentate ribonuclease in the initiation step of RNA [18] M.E. Sayda, J. Harborth, W. Lendeckel, Duplexes of interference, Nature 409 (2001) 363-366.
21-nucleotide RNAs mediate RNA interference in [8] M.T. Wu, R.T. Wu, C.T. Hung, Simple and efficient DNA
cultured mammalian cells, Nature 411 (2001) 494-498.
Journal of Life Sciences 5 (2011) 590-592
A Family of Origin Scale in Mothers of Children with Autistic Spectrum Disorder-Preliminary Report
1 2 3 1 Piotr W. Gorczyca 4 , Agnieszka Kapinos-Gorczyca , Maciej Kapinos , Aleksandra Leksowska , Katarzyna Ziora , Joanna O
4 and Jaros święcimska 1 ław Sobiś 1. Department of Psychiatry, Medical University of Silesia in Katowice, Tarnowskie Góry 42-612, Poland
2. Daily Psychiatric Ward for Children and Adolescents, NZOZ FENIKS, Gliwice 44-100, Poland 3. Psychiatric Hospital, Rybnik 44-200, Poland 4. Department of Pediatrics, Medical University of Silesia in Katowice, Zabrze 41-800, Poland
Received: April 11, 2011 / Accepted: April 26, 2011 / Published: August 30, 2011.
Abstract: The influence of the family of origin is often described in the aetiology of different psychiatric disorders. The majority of papers concerning the families of autistic children concentrate on the quality of their lives. The aim of our study was to compare the experiences from the family of origin of mothers of children with Autistic Spectrum Disorders (ASD) and from mothers of healthy children. In our study a Family of Origin Scale (FOS) was used. This scale consists of 10 constructs: clarity of expression, responsibility, respect for others, openness to others, acceptance of separation/loss, range of feelings, mood and tone, conflict resolution, empathy and trust. It was a pilot study. The examined group consisted of 9 mothers of children with ASD, the control group-7 mothers of healthy children. We found that both groups differed in a statistically significant way as for the construct called responsibility. Our research was a pilot study and it required further investigations.
Key words: Autism Spectrum Disorders, mothers characteristic, Family of Origin Scale.
1. Introduction One of them was a family of Origin Scale (FOS), which was what we used in this study. This scale consists of
The influence of The Family of Origin Scale (FOS)
40 items: ten subscale self-report instruments designed had been described in the some psychiatric problems [1, to assess perceptions of family health and based on the 2]. The majority of the papers concerning the families dimensions of Autonomy and Intimacy [9]. FOS was of autistic children concentrated on the quality of their used among the adolescents psychiatric inpatients. life [3-5].There was a large number of evidences from However, there were not any studies/reports using FOS family and twins studies suggesting the etiology of in Medline database. The aim of this study was to autism was mainly genetic [6]. Also it was accepted compare the experiences from The Family of Origin that there was a need to assess the individual Scale of mothers of children with Autistic Spectrum relationships in families over time. The dimension that Disorders (ASD) and from mothers of healthy children had been the most influential was that of ‘control’ or
as the control group.
‘overprotection’ [7]. Some studies had demonstrated an association among low care and high overprotection
2. Materials and Methods
and a range of adult psychiatric disorders [8]. There In our study a Family of Origin Scale (FOS) was were some scales that measure the problems in families. used by Hovestadt et al. [10]. This scale consists of 10
constructs: clarity of expression, responsibility, respect Corresponding author: Piotr Gorczyca, Ph.D., psychiatrist,
research field: psychology. E-mail: gormasp@o2.pl. of others, openness to others, acceptance of
A Family of Origin Scale in Mothers of Children with Autistic Spectrum Disorder-Preliminary Report
separation/loss, range of feelings, mood and tone, In the past, the theories that connected the cause of conflict resolution, empathy and trust. It was a pilot
autism with mother-child relation were popular study. The examined group consisted of 9 mothers of
although controversial. The “refrigerator mother” children with ASD, the control group-7 mothers of
hypothesis of autism was firstly used [11], and then healthy children.
there was a theory that focused on abnormal mother’s To diagnose ASD we used DSM IV TR.
response to child signals [12]. The item of overprotection Statistical analysis was conducted by the use of
could refer somehow to the Bettelheim’s theory. The Wald-Wolfowitz test, Ko łmogorov-Smirnov test and U
scale, therefore, does not attempt to distinguish Mann Whitney test. A level of P < 0.05 was accepted as
between objective-factual or interpretive-subjective statistically significant. Calculations were conducted by
views of the family of origin [10]. On the other hand, using “Statistica 5.0 Pl” software (StatSoft INC., USA).
mothers of autistic children could develop the feature of overprotection in the relation with the child illness.
3. Results
Other question is discussing an argument in case of Both groups differed in a statistically significant way
statistically significant differences were observed for as for the construct called responsibility (P = 0.04).
the other items. For example, the so-called double-hit According to Tables 1 and 2 there was a significant
hypothesis which is characteristic for the families with difference between two examined groups as for the
schizophrenic member may concern to significant concept of responsibility.
differences in item clarity of expression. In so-called psycho-somatic families with anorexia nervosa
4. Discussion
occurrence the differences in items respect of others The significant differences in the item responsibility
and openness to others may appear. If there was in fact could be in connection with overprotection. And there
such a result of these groups investigation then were no statistically significant differences between the
we could identify the important risk factor for the two examined groups as for the other items.
certain diseases development. That would also mean the
Table 1 Results in Family of Origin Scale in mothers of autistic children (examined group).
Mothers of children with ASD, n = 9
Scale/subscales 123456789
Autonomy concept 1.Clarity of expression 12 10 4 14 18 15 10 5 19
2. Responsibility 10 10 5 12 19 16 14 8 8 3. Respect for others
4. Openness to others 13 13 10 11 19 14 12 6 13 5. Acceptance of separation/loss 10 12 4 14 17 13 14 8 16
Total of subscale 55 53 28 65 89 71 60 31 59 Intimacy concept 6. Range of feelings 11 13 6 12 15 15 12 8 16 7. Mood&tone 10 11 6 13 18 15 13 4 20
8. Conflict resolution 9 9 4 12 15 13 11 4 16 9. Empathy 9 12 5 10 18 14 13 4 8 10. Trust 9 12 9 13 18 14 11 12 8 Total of subscale
30 60 84 71 60 32 68 Total of scale
A Family of Origin Scale in Mothers of Children with Autistic Spectrum Disorder-Preliminary Report
Table 2 Results in Family of Origin Scale in mothers of healthy children (control group).
Scale/subscales p (between examined and 1234567 control group) Autonomy concept 1.Clarity of expression 10 10 16 16 16 13 13 0.32
control group, n = 7
2. Responsibility 10 14 16 16 16 12 12 0.04 3. Respect for others 8 10 20 14 14 14 18 0.55
4. Openness to others 10 12 18 16 14 15 14 0.95 5. Acceptance of separation/loss 10 13 20 16 16 16 18 0.55 Total of subscale
48 59 90 78 76 70 75 0.55 Intimacy concept 6. Range of feelings
11 13 14 17 16 17 11 0.95 7. Mood&tone 9 9 19 17 17 14 18 0.10 8. Conflict resolution 10 13 19 16 16 12 12 0.32 9. Empathy 9 9 16 16 16 13 16 0.64 10. Trust 12 10 15 16 15 9 19 0.32 Total of subscale
51 54 83 82 80 65 76 0.95 Total of scale
forgotten theories restoration to a high degree. of Life Outcomes 27 (2007) 5: 22 (reprint).
H. Allik, J.O. Larsson, H. Smedje, Health-related quality Conclusively, if the mentioned results refered to the of life in parents of school-age children with Asperger
large groups of families with a certain illness, then we syndrome or high-functioning autism, Health and Quality could investigate for the defined connection in genetic
of Life Outcomes 4 (2006) 4: 1 (reprint). [5] J.S. Greenberg, M.M. Seltzer, M.W. Krauss, R.J. Chou, J.
research. Hong, The effect of quality of the relationship between mothers and adult children with schizophrenia, autism, or
5. Conclusions
down syndrome on maternal well-being: The mediating role of optimism, American Journal of Orthopsychiatry 74
The construct called responsibility could have
(1) (2004) 14-25.
certain influence on the development of autistic [6] J. Piven, The broad autism phenotype: A complementary disorder. Our research was a pilot study and it required
strategy for molecular genetic studies of autism, American Journal of Medical Genetics 105 (1) (2001) 34-35.
further investigations. Conducting wider research in [7] J. Hill, E. Mackie, L. Banner, H. Kondryn, Relationship the families of patients with other illnesses could bring
with Family of Origin Scale (REFAMOS), interrater important data on FOS possible application.
reliability and associations with childhood experiences, British Journal of Psychiatry 175 (1999) 565-570.
Referencess
G. Parker, L. Kiloh, L. Hayward, Parental representations of neurotic and endogenous depressives, Journal of [1] P. Yelsma, A.J. Hovestadt, W.T. Anderson, J.E. Nilsson,
Affective Disorders 13 (1987) 75-82. Family of origin expressiveness: Measurement, meaning,
B. Rodgers, Reported parental behaviour and adult and relationship to alexithymia, Journal of Marital and
affective symptoms: I. Associations and moderating Family Therapy 26 (3) (2000) 353-363.
factors, Psychological Medicine 26 (1996) 51-61. [2] C.L. Niedermeier, H.R. Searight, P.J. Handal, C.M.
[10] A.J. Hovestadt, W.T. Anderson, F.P. Piercy, S.W. Manley, N.Y. Brown, Perceived a family functioning
Cochran, M. Fine, A family of origin scale, Journal of among adolescent psychiatric inpatients: Validity of the
Marital and Family Therapy 48 (1986) 813-820. Family-of-Origin Scale, Child Psychiatry and Human
B. Bettelheim, Love is not Enough: The Treatment of Development 25 (4) (1995) 253-265.
Emotionally Disturbed Children, Free Press, Glencoe, 1950. [3]
B. Rimland, Infantile Autism: The Syndrome and Its of quality of life in parents of children and adolescents
D. Mugno, L. Ruta, V.G. D’Arrigo, L. Mazzone, Impairment
Implications for a Neural Theory of Behavior, with pervasive developmental disorders, Health and Quality
Appleton-Century-Crofts, New York, 1964.
Journal of Life Science 5 (2011) 593-597
Modified Multiple Scale/Segment Entropy (MMPE) Analysis of Heart Rate Variability of NHH, CHF & AF Subjects
Chodavarapu Renu Madhavi and Alevoor Gopal Krishnachar Ananth Rastreeya Vidyalaya. College of Engineering, Bangalore, Karnataka 560059, India
Received: August 13, 2010 / Accepted: September 03, 2010 / Published: August 30, 2011.
Abstract: Nonlinear analysis of heart rate variability (HRV) has become important as heart behaves as a complex system. In this work, the approximate entropy (ApEn) has been used as a nonlinear measure. A new concept of estimating the ApEn in different segments of long length of the recorded data called modified multiple scale (segment) entropy (MMPE) is introduced. The idea of estimating the approximate entropy in different segments is useful to detect the nonlinear dynamics of the heart present in the entire length of data. The present work has been carried out for three cases namely the normal healthy heart (NHH) data, congestive heart failure (CHF) data and Atrial fibrillation (AF) data and the data are analyzed using MMPE techniques. It is observed that the mean value of ApEn for NHH data is much higher than the mean values for CHF data and AF data. The ApEn profiles of CHF, AF and NHH data for different segments obtained using MPE profiles measures the heart dynamism for the three different cases. Also the power spectral density is obtained using fast fourier transform (FFT) analysis and the ratio of LF/HF (low frequency/high frequency) power are computed on multiple scales/segments namely MPLH (multiple scale low frequency to high frequency) for the NHH data, CHF data and AF data and analyzed using MPLH techniques. The results are presented and discussed in the paper.
Key words: Multiple scale/segment, heart rate variability, approximate entropy, congestive heart failure, atrial fibrillations.
1. Introduction estimation requires 10-20 m length of data, where ‘m’ is the embedding dimension [4-7]. The SampEn
The heart rate variability (HRV) is defined as the overcomes the limitations of ApEn. Moreover the change of heart rate about its mean value. The heart sampEn is independent of data lengths [8]. The behaves as a complex system and the heart rate can be traditional entropy methods estimate the regularity of modulated over its mean value by the sympathetic and the time series data on a single scale and there exists no parasympathetic branches of autonomous nervous specific relationship between complexity and system (ANS). The HRV exhibits non-regularity and regularity. The interrelationships between entropy and dynamic behaviour for a healthy individual, HRV is scale lead to multistage entropy (MSE) which is a more regular for the diseased subjects [1-3]. Nonlinear combination of Zhang and Pincus’ method which show measurement techniques have been applied for the the complexity of original time series signals is more analysis of heart’s complex behavior. The complexity than surrogate time series [9, 10]. Sum of scale and regularity of physiological time series data is dependent entropies is the Zhang’s complexity measured using approximate entropy (ApEn), a measure. The data of length requires 2×10 4 is required concept introduced by Pincus [4, 5]. The ApEn for MSE method. For scale 20 the minimum length of
data required is 1000. Handling long length of data on Corresponding author: Chodavarapu Renu Madhavi,
associate professor, research field: biomedical engineering. each scale for entropy calculation requires longer E-mail: renumadhavi@yahoo.com.
Modified Multiple Scale/Segment Entropy (MMPE) Analysis of Heart Rate Variability
of NHH, CHF & AF Subjects