dorf [27]. The evolution of activity staining was carefully observed, and photographs were taken at
the appropriate times before extensive diffusion into the gels.
2
.
6
. Polyacrylamide gel electrophoresis and Western blotting
SDS-PAGE was performed as described by Laemmli [28], using a 4 stacking gel and a 12.5
resolving gel. Proteins were denatured prior to electrophoresis by boiling the samples for 2 min in
an medium containing 1 2-mercaptoethanol, 1 SDS, 0.125 mM bromophenol blue, 5 glycerol,
10 mM EDTA and 10 mM Tris – HCl pH 8.0. After electrophoresis, proteins were electrically
transferred to Trans-Blot
®
nitrocellulose mem- branes Bio-Rad mini trans-blot cell. ICL and MS
detection was performed with specific anti-soybean ICL or MS antibodies.
2
.
7
. Nucleotide probe labelling DIG-labelled probes were synthesised by PCR
from ICL and MS cDNA clones Genbank access numbers L02329 and L01629. The reaction
medium contained Taq buffer 1X Pharmacia, 1 ng DNA, 1 mM primers, 1.5 mM MgCl
2
, 2 mM DIG-labelling mix Boehringer Mannheim and 1
U Taq polymerase Pharmacia. Primers
41 + tgagaggttcaggctaacaaa
and 333 − ctcaaccttgtttgggacagt were used for ICL
probe synthesis. Primers 51 + tatgatgtggcca-
gagggagtg and 675 − cttgggaagataaaagaaagg were used for MS probe synthesis.
2
.
8
. Northern blot analysis Total RNA from mature and senescent leaves
harvested at 0 to 9 days and at 12 days after initiation of dark treatment was extracted using a
modification of the single-step method [29]. The isolated RNA was electrophoresed on a 1.2
agarose gel containing formaldehyde and then transferred capillarity to a Hybond-N
+
nylon membrane Amersham. The blots were hybridised
at 50°C with each probe in a buffer containing 50 formamide, 7 SDS, 5 X SSC, 2 blocking
reagent Boehringer and 0.1 lauroylsarcosine, washed twice in 2 X SSC0.1 SDS, and then
twice in 0.5 X SSC0.1 SDS.
2
.
9
. Miscellaneous Sucrose
concentration was
determined by
refractometry. Polyclonal antibodies against soybean ICL and
MS were obtained as described by Guex et al. [30]. The prestained SDS-PAGE standards low
range from Bio-Rad were used for Western blot analysis.
The leaf chlorophyll content was determined as described by Borrell [31].
3. Results and discussion
3
.
1
. Cotyledons at germination The separation of organelles was monitored us-
ing the marker enzymes cytochrome c oxidase cco, for mitochondria and malate synthase MS,
for glyoxysomes, as well as aconitase, and was carried out in three steps. After homogenisation of
5-day dark-germinated etiolated cotyledons, the pellet resulting from the sedimentation of the or-
ganelles was finally applied onto a discontinuous sucrose gradient. Fig. 1 shows that appropriate
separation of mitochondria and glyoxysomes is obtained, with a low level of cross-contamination.
In addition, the aconitase and cco activity peaks coincide, which demonstrates the absence of
aconitase in glyoxysomal fractions. The fact that most of the MS activity is detected at the density
of 1.25 characterising intact glyoxysomes [32] demonstrates that the lack of aconitase activity in
the corresponding fractions does not result from a putative extensive destruction of these one-mem-
brane organelles during the isolation procedure. In addition, it has to be noted that approximately
80 of the aconitase activity initially observed in the cotyledon extract was subsequently detected in
the cytosolic supernatant fraction of the first cen- trifugation step organelle sedimentation. All
these data are in agreement with the results of Courtois-Verniquet and Douce [15] on castor bean
and potato tuber extracts, as well as with those of De Bellis et al. [33] on pumpkin cotyledon ex-
tracts. The absence of aconitase in glyoxysomes might be a necessity due to its strong sensitivity to
hydrogen peroxide, which is continuously pro- duced in glyoxysomesperoxisomes [34].
Fig. 1. Localisation of mitochondria and glyoxysomes after sedimentation on a discontinuous sucrose gradient 5-day dark-germi- nated cotyledons. The various fractions were tested for the marker enzyme activities cco and MS, as well as for aconitase
activity. The cco and aconitase activity peaks coincide at a 38 sucrose concentration 1.17 density characterising mitochondria, whereas the main MS activity peak corresponds to a 55 sucrose concentration 1.25 density characterising glyoxysomes.
An extraglyoxysomal aconitase may thus partic- ipate in the glyoxylate cycle, and this possibility
was further investigated on etiolated cotyledons using zymograms obtained from cytosolic, mito-
chondrial and glyoxysomal fractions subjected to agarose electrophoresis. Five chromatic bands are
observed on gels stained for aconitase activity Fig. 2. This confirms the results of Cardy and
Beversdorf [27] obtained on the same material using starch zymograms. However, these authors
did not elucidate the intracellular locations of the five isoforms. The present results demonstrate that
three isoforms are cytosolic designated as C1, C2 and C3 isoforms according to their electrophoretic
mobilities, whereas the two others are mitochon- drial M1 and M2. The same zymogram also
shows that glyoxysomes are indeed devoid of aconitase activity. At least one of the detected
cytosolic aconitases might participate in the gly- oxylate cycle, as was proposed for etiolated pump-
kin cotyledons [17,35].
In order to verify this hypothesis, several crude extracts of etiolated cotyledons from plants grown
for various periods were analyzed on agarose zy- mograms to identify which aconitase participates
in the glyoxylate cycle. Glyoxysomal enzyme activ- ities increase in fatty tissues of germinating
seedlings during the first days of growth, and thereafter decline as reserve lipids are consumed.
Subsequent illumination initiates photosynthesis and accordingly accelerates the disappearance of
glyoxysomal enzyme activities [36]. It can now be noted that the C1 isoform is not detected in the
cotyledons of freshly imbibed seeds Fig. 3, whereas the C2 and C3 isoforms are present at low
levels. The increase of C1 aconitase activity during growth in the dark then parallels that of MS and
ICL activities markers of the glyoxylate cycle seen on Fig. 4. It is also observed that the evolu-
Fig. 2. Identification and intracellular localisation of the aconitase isoforms from 5-day dark-germinated cotyledons
zymogram. The samples were loaded on a 1.2 agarose gel, and migration occurred at 60 V for 5 h. Lane 1: cytosolic
supernatant from the organelle sedimentation step; lane 2: glyoxysomal fractions obtained from the discontinuous su-
crose gradient; lane 3: mitochondrial extract obtained after phase partition Triton X-114 on fractions 5 – 7 Fig. 1; lane
4: glyoxysomal extract after phase partition on fractions 19 – 20. C1, C2, C3, M1, M2: see text.
Fig. 3. Evolution of the aconitase isoform activities during germination zymogram. Extracts from dark-germinated
cotyledons were loaded on a 1.2 agarose gels, and migration occurred at 60 V for 5 h. Day 0 corresponds to the initiation
of germination after seed imbibition.
ual cells or specific organs to the entire plant. These events can be considered as a recycling
program, which is particularly active in the case of structural lipid dismantling.
ICL and MS activities have already been de- tected in various senescing tissues of several higher
plant species [37 – 40], and the evolution of aconi- tase activity in leaves subjected to dark-induced
senescence has now been studied. Leaf extracts from soybean plants placed in total darkness for
various periods up to 12 days were subjected to agarose electrophoresis for zymogram analysis.
The M1, M2, C2 and C3 aconitase isoforms are detected in nonsenescing mature leaves day 0 on
Fig. 5. In contrast, the C1 isoform is not observed until 5 – 6 days of dark-induced senescence, and is
thereafter detected at a moderate level until day 12. A parallel can be drawn between the evolution
of this chromatic band and the increase of MS activity during dark-induced leaf senescence Fig.
6, whereas surprisingly no ICL activity could be detected during this process. Such an apparent
inactivity had already been observed during seed maturation for cotton [41] as well as for cucumber
[42], even though the glyoxylate cycle is presumed to be active during embryogenesis. In addition, it
has to be noted that the MS activity observed here during leaf senescence does not exceed 2.5 – 3 of
that characterising cotyledons during germination Fig. 4. The glyoxylate cycle nonetheless appears
to be reinduced in senescing leaves, as this is supported by the results on Fig. 7, which indicate
de novo synthesis for the MS protein under dark
Fig. 4. Evolution of ICL and MS activities in dark-germi- nated cotyledons. The enzymatic activities were monitored in
crude extracts, and are expressed per g fresh weight.
Fig. 5. Separation and detection of the aconitase isoforms in leaves from dark-treated plants zymogram. Plants were put
in the dark after a 20-day growth in phytotron. The various extracts underwent a phase partition Triton X-114 before
application to a 1.2 agarose gel. Migration occurred at 60 V for 5 h.
tion of C1 aconitase activity in cotyledons of seedlings growing in the greenhouse is concomi-
tant with the increases and declines of MS and ICL activities data not shown. In contrast,
aconitase C1 is not detected in mature leaves, roots, or hypocotyls. These results strongly suggest
that a cytosolic aconitase, namely isoform C1 in soybean cotyledons, participates in the glyoxylate
cycle during seedling growth.
3
.
2
. Leaf senescence Senescence may be defined as the series of
events leading to the organised disassembly of biological functions at various levels, from individ-
Fig. 6. MS activities detected in leaves from dark-treated plants. Plants were put in the dark after a 20-day growth in
phytotron.
scription of both genes does not occur in mature leaves, but is initiated after 2 days of darkness and
strongly persists until day 12 Fig. 8. The above noted absence of ICL activity may thus be due to
enzymatic inhibition, as was already observed in spinach, wheat and maize leaves [43], in banana
[44], or in cauliflower cotyledons [45].
The chlorophyll content of dark-stressed leaves is still high until days 5 – 6 data not shown, when
the genes of the two glyoxylate cycle specific en- zymes are strongly expressed. This is at variance
with natural senescence, where ICL and MS syn- thesis occurs late in the process, when the thy-
lakoids
are already
disassembled and
when chlorophyll is almost totally absent [46].
Fig. 9 shows the evolution of 3-hydroxyacyl- CoA dehydrogenase marker enzyme of b-oxida-
tion and fructose-1,6-bisphosphatase activities in the material already described by Figs. 5 – 8. Hy-
drolytic dephosphorylation of fructose-1,6-bispho- sphate
to yield
fructose-6-phosphate is
a by-reaction of the Calvin-Benson cycle as well as
an essential step of gluconeogenesis. Fructose-1,6- bisphosphatase activity is therefore significant in
mature leaves, and subsequently falls off when senescence is initiated. This is confirmed by the
results on Fig. 9, which furthermore indicate that this enzymatic activity is reinduced when all pho-
tosynthetic processes are indeed nonexistent. This might be explained by an active gluconeogenetic
pathway induced by the prolonged dark treatment i.e. by the senescence process.
Mitochondrial b-oxidation is active in mature leaves, and provides short chain fatty acids for
biosynthetic purposes e.g. for chlorophyll synthe- sis, whereas its peroxisomalglyoxysomal counter-
part reaches completion and produces acetyl-CoA. The results pertaining to 3-hydroxyacyl-CoA-de-
hydrogenase seen on Fig. 9 might be explained by an induction of glyoxysomal b-oxidation at the
onset of senescence, as an essential downstream step in the process of structural lipid dismantling.
A similar case has already been observed for senescing pumpkin petals [47].
The results Figs. 5 – 8 pertaining to the C1 aconitase isoform as well as to the glyoxylate cycle
specific enzymes ICL and MS strongly suggested the implication of the pathway in the senescence
process. Bearing in mind that the glyoxylate cycle is intricately connected to b-oxidation and gluco-
neogenesis, the hypothesis is now substantiated by
Fig. 7. Western blot analysis MS protein for leaves from dark-treated plants. Plants were put in the dark after a 20-day
growth in phytotron. Similar results were obtained for the ICL protein.
Fig. 8. Analysis of ms and icl transcripts abundance in leaves from dark-treated plants northern blots. Plants were put in
the dark after a 20-day growth in phytotron. Transfer on Hybond-N
+
was carried out after electrophoresis of each sample 20 mg total RNA, denaturing conditions. DIG-la-
belled probes from partial cDNA clones were used for tran- script detection.
stress conditions. This synthesis parallels the evo- lution of expression for the icl and ms genes
during dark-induced leaf senescence, since tran-
Fig. 9. 3-Hydroxyacyl-CoA dehydrogenase and fructose-1,6-bisphosphatase activities in leaves from dark-treated plants. Plants were put in the dark after a 20-day growth in phytotron.
the evolution of 3-hydroxyacyl-CoA-dehydroge- nase and fructose-1,6-bisphosphatase activities
Fig. 9.
3
.
3
. Pathogenic attack Gradual necroses of hypocotyls unexpectedly
and infrequently occurred for various cultivation sets germination and seedling growth in the dark
up to 5 days, and were identified as due to bacterial developments mostly Bacillus spp and
Erwinia herbicola. In such cases, root regenera- tion was usually observed above the necrotic spots
and evidenced the vital necessity to maintain a functional root system through a ‘bypass’ of the
diseased tissues. This survival strategy may imply a reallocation system feeding on the cellular com-
ponents of the diseased necrotising tissues. In ad- dition, the dismantling of cellular elements in the
affected tissues might hold up the pathogen advance.
The icl and ms genes are considered to belong to the class 6 of senescence enhanced genes [48,49],
which is in agreement with the fact that they are instrumental to the carbon reallocation system
provided by the glyoxylate cycle in senescing tis- sues see Section 3.2. In this connection, it is
worth reminding that the genes coding for the so called pathogenesis related proteins are also ex-
pressed during senescence, but at late stages [49]. The activation of these genes coding for proteins
involved in defense mechanisms might be induced by pathogen attack on senescing tissues whose
mechanical and chemical defenses are irretrievably weakened, and not be senescence stricto sensu.
The survival strategy now observed in the case of necrotising hypocotyls may somehow corre-
spond to the opposite situation, where a pseudo- senescence could be established after a pathogenic
attack to ensure initiation of reallocation mecha-
Fig. 10. Identification of the cytosolic aconitase isoforms from healthy and necrotising hypocotyls zymogram. The samples
were loaded on a 1.2 agarose gel, and migration occurred at 60 V for 5 h. Lane 1: cytosolic extract from healthy
hypocotyls; lane 2: cytosolic extract from cotyledons of 3-day dark-germinated seedlings control; lane 3: cytosolic extract
from necrotising hypocotyls bacterial contamination.
nisms. Indeed, Fig. 10 shows that such might be the case for the glyoxylate cycle, whose signature
the aconitase C1 isoform is present in the by- passed hypocotyls. The possibility of an artifact
bacterial aconitase was ruled out by the fact that the four aconitase forms detected in the contami-
nating microorganisms were characterised by elec- trophoretic mobilities zymograms equivalent or
higher than that of the soybean C3 aconitase.
4. Concluding remarks
