The postulated exclusive glyoxysomalperoxiso- mal location of the glyoxylate cycle [14] has been
challenged by the experimental evidence that gly- oxysomes are devoid of aconitase activity [15,16],
and that a cytosolic aconitase form might partici- pate in the pathway [17]. A strict organellar com-
partmentation has also been assumed to be dispensable in various unicellular green algae [18 –
20] and in Saccharomyces cere6isiae [21]. In addi- tion, it has been postulated that the in vivo
occurrence of a glyoxylate cycle stricto sensu might be questioned in plant glyoxysomes, in view
of the possible role of the glyoxysomal malate dehydrogenase in the NAD
+
regeneration system sustaining b-oxidation [12]. However, this has no
bearing on the intrinsic involvement of the five considered enzymes in the reactional intricacies
linking lipid catabolism to gluconeogenesis.
The assessment of aconitase isoforms in soybean now indicates that it possesses two mitochondrial
and three cytosolic such molecular species. This distribution pattern is displayed under the physio-
logical conditions of germination and senescence, where in both cases the same aconitase isoform
appears to participate in the glyoxylate cycle. In addition, evidence is also presented that an identi-
cal situation prevails under conditions of patho- genic attack.
2. Materials and methods
2
.
1
. Biological material and growth conditions Soybean seeds Glycine max. L., cv. Maple ar-
row were obtained from Schweizer Samen AG, CH-3600 Thun, Switzerland. Seed imbibition oc-
curred without prior surface sterilisation on soaked vermiculite. The details of germination and
growth conditions are given in the Results and discussion section. Foliar senescence was induced
by placing plants first grown for 20 days in phy- totron 16 h light8 h darkness in total darkness
for up to 12 days.
2
.
2
. Organelle preparation The organelles were isolated essentially as de-
scribed by Courtois-Verniquet and Douce [15], and all steps were carried out at 4°C. Cotyledons
were minced and homogenised with razor blades Petri dish in a medium containing 400 mM su-
crose, 10 mM KCl, 2 mM DTT, 1 mM MgCl
2
, 1 mM citric acid, 1 mM PMSF, 5 BSA, 5 PVP
40 and 150 mM Tricine pH 7.8 2 ml medium per g cotyledons. After filtration through 2 layers of
cheesecloth, the homogenate was first cleared by centrifugation at 280 g for 5 min, and the or-
ganelles were then sedimented by centrifugation at 10 800 × g for 30 min. After recovery of the super-
natant cytosol, the pellet organelles was resus- pended in the homogenisation medium and
layered onto a discontinuous sucrose gradient 33 – 60. Fractions of 1.5 ml were collected after
centrifugation for 3 h 30 at 24 000 rpm Centrikon T-2080 centrifuge using a TST 28.38 swing-out
rotor.
2
.
3
. Crude extract preparation Fresh plant material was frozen in liquid nitro-
gen, pulverised in a mortar and homogenised at 4°C in the above described medium 2 ml per g
material. After filtration through two layers of cheesecloth, the homogenates were cleared by cen-
trifugation at 30 000 × g for 30 min at 4°C. Pellets were discarded and the floating lipid layers were
removed by filtration through cheesecloth.
2
.
4
. Enzymatic assays All assays were performed in triplicate at 25°C
and monitored with Ultrospec III spectrophoto- meters Pharmacia-LKB. Aconitase EC 4.2.1.3
activity was measured by following the disappear- ance of cis-aconitate essentially as described by
Fansler and Lowenstein [22]. Isocitrate lyase ICL, EC 4.1.3.1, and malate synthase MS, EC 4.1.3.2
were assayed according to Ruchti and Widmer [23] and Miernyk et al. [24], respectively. The methods
of Gerhardt [25] and of Pontremoli [26] were used for
3-hydroxyacyl-CoA dehydrogenase
EC 1.1.1.35
and fructose-1,6-bisphosphatase
EC 3.1.3.11, respectively.
2
.
5
. Zymograms The aconitase isoforms were analysed using
nondenaturing 1.2 agarose gels. After elec- trophoretic migration, the aconitase activity in the
gels was detected by soaking at 37°C with the reactive solution described by Cardy and Bevers-
dorf [27]. The evolution of activity staining was carefully observed, and photographs were taken at
the appropriate times before extensive diffusion into the gels.
2
.
6
. Polyacrylamide gel electrophoresis and Western blotting
SDS-PAGE was performed as described by Laemmli [28], using a 4 stacking gel and a 12.5
resolving gel. Proteins were denatured prior to electrophoresis by boiling the samples for 2 min in
an medium containing 1 2-mercaptoethanol, 1 SDS, 0.125 mM bromophenol blue, 5 glycerol,
10 mM EDTA and 10 mM Tris – HCl pH 8.0. After electrophoresis, proteins were electrically
transferred to Trans-Blot
®
nitrocellulose mem- branes Bio-Rad mini trans-blot cell. ICL and MS
detection was performed with specific anti-soybean ICL or MS antibodies.
2
.
7
. Nucleotide probe labelling DIG-labelled probes were synthesised by PCR
from ICL and MS cDNA clones Genbank access numbers L02329 and L01629. The reaction
medium contained Taq buffer 1X Pharmacia, 1 ng DNA, 1 mM primers, 1.5 mM MgCl
2
, 2 mM DIG-labelling mix Boehringer Mannheim and 1
U Taq polymerase Pharmacia. Primers
41 + tgagaggttcaggctaacaaa
and 333 − ctcaaccttgtttgggacagt were used for ICL
probe synthesis. Primers 51 + tatgatgtggcca-
gagggagtg and 675 − cttgggaagataaaagaaagg were used for MS probe synthesis.
2
.
8
. Northern blot analysis Total RNA from mature and senescent leaves
harvested at 0 to 9 days and at 12 days after initiation of dark treatment was extracted using a
modification of the single-step method [29]. The isolated RNA was electrophoresed on a 1.2
agarose gel containing formaldehyde and then transferred capillarity to a Hybond-N
+
nylon membrane Amersham. The blots were hybridised
at 50°C with each probe in a buffer containing 50 formamide, 7 SDS, 5 X SSC, 2 blocking
reagent Boehringer and 0.1 lauroylsarcosine, washed twice in 2 X SSC0.1 SDS, and then
twice in 0.5 X SSC0.1 SDS.
2
.
9
. Miscellaneous Sucrose
concentration was
determined by
refractometry. Polyclonal antibodies against soybean ICL and
MS were obtained as described by Guex et al. [30]. The prestained SDS-PAGE standards low
range from Bio-Rad were used for Western blot analysis.
The leaf chlorophyll content was determined as described by Borrell [31].
3. Results and discussion
