reaction were as follows: 95°C, 5 min, {94°C for 30 s, 52°C for 30 s, 72°C for 40 s} 30 times and
final extension at 72°C for 5 min. Preliminary studies showed that 20-cycle PCR amplification of
cyclin transcripts followed by hybridization with radiolabeled probe gave comparable results as 30-
cycle reaction and staining the products with ethidium bromide data not shown. Primers spe-
cific for four cyclins were designed for unique regions at 3 end of respective cDNA clones:
Cyc1: 3aF-AGCTTCATTTTCTTGATGGGT, 3aR-GATTCGCCCAATATCATTCA,
ex- pected PCR product is 148 bp;
Cyc2: 3bF-GGCTCTAGAGTTTGAGGGGA, 3bR-ACAACAATCATCAATAATGCCA 261
bp; Cyc3:
3cF-TCCGGCACTAGAGTTTCAAA, 3cR-CATTGACTTGAGTTGTCCTGG
216 bp;
Cyc4: 3dF- AGGGGGAGGGATTGATTTA, 3dR-ACAAAACAATAACTTCCACACATG
177 bp. Simultaneously, PCR amplification of a consti-
tutively expressed gene: Gln-tRNA synthetase was performed as a control, using primers: syntB-F-
AAAGGAGTATAGGGAGAAGA, syntF-R-
CCGGAGAAGGTTGAGAA 986 bp [20]. For each cyclin, the amplification of respective cDNA
clone in pBluescript vector was used as a positive control and amplification of plant RNA, without
reverse transcription, served as a negative control. All RT-PCRs were repeated twice or more, using
two independent RNA preparations.
2
.
5
. In situ hybridization Uninfected roots and nodules at different stages
of development, were fixed in 50 ethanol, 5 acetic acid, 10 formaldehyde and embedded in
Paraplast Plus Sherwood Medical at 60°C for several days [13]. The 10-mm thick sections were
attached to Superfrost Plus slides Menzel-Glaser. The procedure of in situ hybridization was essen-
tially the same as the method developed by McK- hann
and Hirsch
[21]. Digoxigenin-labeled
antisense and sense negative control RNA probes were synthesised using T7 Boehringer
Mannheim or T3 Stratagene RNA polymerase. The probes corresponding to EcoRI – HindIII
fragment of Cyc4 cDNA were used in all in situ experiments.
After hybridization,
slides were
washed twice for 1 h in 2 × SSC, once for 1 h in 1 × SSC and 30 min in 0.5 × SSC. The digoxi-
genin-labeled probe was detected with anti-digoxi- genin alkaline phosphatase antibody Boehringer
Mannheim diluted 1:200 and using NBTBCIP Boehringer Mannheim as a substrate. The reac-
tion was terminated with TE buffer, then the slides were viewed and photographed with a bright field
microscope. In control in situ hybridization, using the sense probe, the alkaline phosphatase activity
was at the background level.
3. Results
3
.
1
. Expression of cyclin genes in 6arious tissues Cyclin expression in various tissues of 14-day-
old infected plant was analyzed by Northern hy- bridization and using Cyc1 cDNA as a probe Fig.
1. The level of cyclin mRNA was much higher in both root and shoot apical meristems than in
lateral root region. The cyclin transcript was visi- ble in a nodule-forming zone, whereas in expanded
leaf, hypocotyl and root elongation zone, the cy- clin expression was not detected. This confirmed
that cyclin expression was correlated with prolifer- ating tissues.
To follow the cyclin expression during early stages of nodulation, RNA was isolated from root
segments located above lateral root zone, where lupine nodules usually appear. Both infected and
control plants were analyzed on day 1, 2, 4, 8, 12 and 16 after inoculation with Bradyrhizobium sp.
Lupinus Fig. 2. From the 4th day after inocula- tion, the cyclin level was significantly higher in the
inoculated root than in uninfected plants. The highest cyclin expression was observed 12 – 16 days
after infection.
Fig. 1. The expression of B-type cyclins in various organs of lupine plants. Total RNAs were isolated from root meristem
1, root elongation zone 2, lateral root zone 3, nodule- forming zone 4, hypocotyl 5, leaf 6, shoot meristem 7.
Fig. 2. The expression of B-type cyclins during early stages of nodulation of Lupinus luteus. Total RNAs were isolated on day 1, 2, 4, 8, 12 and 16 from root segments of lupine uninoculated A or inoculated B with Bradyrhizobium sp. Lupinus. The blotted
RNA was hybridized to cyclin Cyc1 cDNA probe.
3
.
2
. Differential expression of four cyclin genes in lupine organs and in response to phytohormones
To gain further insight into the regulation of cyclin expression in plants, the pattern of relative
transcript level of four previously identified lupine B1 mitotic cyclin genes: Cyc1, Cyc2, Cyc3 and
Cyc4 [12 – 14] was established by RT-PCR. Re- verse transcription of RNA isolated from lupine
shoot, floral and root meristems, leaf, stem, pods, root fragment located above lateral root zone,
root segments with developing nodules on day 3, 6, 9, 13, 21 and 30 after inoculation with Bradyrhi-
zobium and root treated with auxin indole-3- acetic
acid, IAA,
cytokinin kinetin-K,
gibberellin GA3 or abscisic acid ABA was fol- lowed by PCR amplification of gene-specific se-
quences Fig. 3. Expression of four cyclin genes was monitored relative to transcript level of con-
stitutive Gln-tRNA synthetase gene [20].
The Cyc1 expression appeared to be much higher within the shoot SM and root meristems
RM than in floral meristem FM. The Cyc1 transcript was undetectable in leaf L, stem S
and pod P. During nodule development, the Cyc1 mRNA level increased and the maximum
was observed between the 9th and 21st day after inoculation with symbiotic bacteria. The 3-day-
long treatment of roots with phytohormones re- sulted in highly elevated expression of Cyc1 in the
presence of either auxin IAA or cytokinin K.
The Cyc
2
mRNA level was relatively high in flower and root meristems FM and RM, respec-
tively. The expression of Cyc2 was very low both in leaf L and stem S and undetectable in lupine
pod P. However, infection with Bradyrhizobium sp. Lupinus increased strongly the Cyc2 mRNA
level and was the highest at the 21st day after inoculation. The Cyc2 mRNA level was also stim-
ulated by auxin IAA.
The Cyc3 gene was expressed in all examined tissues at relatively low level, except for nodules,
where a high amount of mRNA was observed. The maximal level of the Cyc3 transcript was
detected already at 3 days after inoculation, then decreased with aging of the nodule. The level of
Cyc3 mRNA is stimulated by phytohormones treatment and increased in the presence of auxin
IAA, cytokinin K and gibberellin GA3.
The Cyc4 gene was mostly expressed in floral meristem and within nodules. Similarly to Cyc3,
the transcript level of Cyc4 was highest during the early stages of nodule development 3rd day after
inoculation, but it was regulated differently by phytohormones. Only auxin IAA and kinetin K
strongly activated the Cyc4 gene expression.
Four closely related genes coding for mitotic cyclins are expressed at various level in different
plant tissues. In every particular tissue more than one cyclin is active. The transcription of all of
them is simulated during nodule development. The Cyc3 and Cyc4 genes are activated during the
initial stages of nodulation, whereas the Cyc1 and Cyc2 genes are activated at the later phases. The
Cyc3 gene may be regarded as nodule-specific one, as in all the other tissues, including apical meris-
tems, the amount of corresponding transcript was much lower than in the nodules. The analysis of
cyclin expression after phytohormone treatment, proved that auxin increased the transcript level of
all examined genes and abscisic acid did not ex- erted perceptible effect. None of the phytohor-
mones decreased cyclin mRNA amount beneath the level observed in control plants treated with
water.
3
.
3
. Localization of cyclin transcripts by in situ hybridization
The expression of lupine mitotic cyclins was studied further by precise localization of tran-
scripts by in situ hybridization and the use of digoxigenin-labeled antisense Cyc4 RNA probe
Fig. 4. The relatively high background, that is
seen in lupine nodules during hybridization, seems to be characteristic to these organs, as it
is not observed in other tissues or other plant species. However, this disadvantage does not in-
terfere with distinguishing the proper hybridiza- tion signals. The in situ hybridization does not
distinguish expression of various cyclin mRNAs, since the long probe, consisting of a sequence
conserved in all lupine cyclins, was used in our study. The signal derived from the short probe is
too weak to be distinguishable from the back- ground data not shown. Moreover, the diffu-
sion of the alkaline phosphatase substrate did not allow the cell-specific detection but could lo-
calize the region where B-type cyclins are ex- pressed.
As expected, high cyclin expression was ob- served in numerous dividing cells Fig. 4. Strong
expression was detected in shoot meristem Fig. 4B, emerging lateral root primordia Fig. 4D,
apical meristematic region of lateral roots Fig. 4F, nodule primordia Fig. 4H. Despite signifi-
cant background observed in symbiotic cells, strongly stimulated expression of cyclin was de-
tected within nodule meristem Fig. 4J.
We particularly wished to visualize the spatial and temporal pattern of cyclin expression in de-
veloping root nodule, as little is known about the activity of nodule meristem in lupine. By
means of in situ hybridization cyclin transcripts were detected 2 – 3 days after inoculation with
Bradyrhizobium sp. Lupinus within dividing cells of root cortex that form nodule primordium
Fig. 4H. Cyclin mRNA was localised in the central, globular part of young, 7-day-old nod-
ules, as well as in their developing vascular bun- dles Fig. 4J. Hybridization pattern showed that
in later stages of nodule development, 12 days after infection, the nodule meristems were lo-
cated distally and surrounded the cortex part of the organ Fig. 4L. In mature nodules, 20 days
after inoculation, the cyclin transcripts were still detected in a lateral meristematic zone, which
enclosed the central bacteroid tissue Fig. 4N. The regions expressing cyclin genes were contin-
ually present even in older nodules, 30 days after infection, however, most meristematic cells lost
their proliferating activity Fig. 4P. The earlier morphological studies have shown that meris-
tems are located in the lateral part of lupine root nodules [22]. In situ hybridization confirmed
the previous microscope observations and proved that meristem regions are active from the first
cell division till the late stages of lupine nodule development.
Fig. 3. Expression of four lupine cyclins, Cyc1, Cyc2, Cyc3 and Cyc4, in different plant organs, during various stages of
nodule formation and in roots treated with phytohormones. Two mg of total RNA from each tissue sample was used in
RT-PCR. First strand cDNAs were used to amplify Cyc1, Cyc2, Cyc3, Cyc4 and Gln-tRNA synthetase gene-specific
sequences as described in Section 2. The amplified products were separated on 2 agarose gel and stained with ethidium
bromide. The products were obtained by RT-PCR from RNA isolated from: shoot meristem SM, floral meristem FM,
root meristem RM, leaf L, stem S, pod P, uninoculated root fragments located above the lateral root region R and
inoculated root fragments or nodules at 3, 6, 9, 13, 21 and 30 days after infection with Bradyrhizobium sp. Lupinus 3, 6,
9, 13, 21 and 30, roots of 5-day-old seedlings with removed meristems, treated for 3 days with: auxin IAA, cytokinin
K, gibberellin GA3, abscisic acid ABA, Bradyrhizobium sp. Lupinus B.l., and water control without phytohor-
mones H
2
O. RNA without reverse transcription was a negative control − and the respective cDNA clones were
applied as positive control + .
Fig. 4.
Fig. 4. Continued
4. Discussion
