phase. Plant cyclins have been recently classified based on their structure and putative function [5].
The nomenclature proposed by Renaudin et al. [5] is used throughout this paper.
Expression of cyclins is restricted to proliferat- ing tissues [6,7] and regulated at multiple levels of
gene expression. Cyclin mRNA and proteins are both unstable molecules and are rapidly degraded
at the end of the respective stages of the cell cycle [8]. Therefore, cyclins are good markers of divid-
ing cells and are used in studies of plant develop- mental processes as well as in search of signaling
pathways leading to the formation of new plant organs.
In our study, we are particularly interested in the regulation of cell-cycle genes during nodule
development in lupine. Symbiotic soil bacteria of the Rhizobiaceae family induce the formation of
nitrogen-fixing nodules on the roots of legume plants. Although many stages of this process were
described in detail reviewed in: [9 – 11], the pre- cise chain of events leading to the appearance of a
new organ still remains to be determined.
We have isolated four clones coding for putative mitotic cyclins of B1 type from Lupinus luteus
nodule cDNA library [12]. Lupine cyclin genes have been named according to the proposed
nomenclature as Luplu;CycB1;1 EMBLGen- Bank accession number U24192, Luplu;CycB
1
;2 U24193,
Luplu;CycB
1
;3 U24194,
Lu- plu;CycB
1
;4 U44857 [12 – 14], but here they are referred as Cyc1, Cyc2, Cyc3 and Cyc4 for sim-
plicity. The presence of a family of closely related cyclins, belonging to the same subgroup, may
suggest their different function during plant devel- opmental processes or their various regulation by
plant-specific factors, such as phytohormones or signals released by symbiotic bacteria. The multi-
ple variants of the same type of plant cell cycle regulators may be necessary to assure flexible reac-
tion to internal signals and variable environment conditions.
In this study we describe a detailed expression pattern of four cyclin genes in various tissues of
lupine, with special emphasis put on developing root nodule and the effect caused by phytohor-
mones. Cyclin expression is analyzed by Northern hybridization, reverse transcription-PCR with the
use of 3-end primers unique to respective cyclin, as well as by in situ hybridization.
2. Materials and methods
2
.
1
. Plant material The seeds of yellow lupine Lupinus luteus cv.
Ventus were surface sterilized and germinated for 2 days as described [15]. Seedlings were transferred
to sterile plastic growth pouches [16] containing mineral
solution [17]
and inoculated
with Bradyrhizobium sp. Lupinus strain USDA 3045
or treated with 1 mM phytohormone solutions: IAA indole-3-acetic acid, kinetin, GA3 gibbere-
llin A3 or ABA abscisic acid. Roots, from which the apical and lateral root meristems had been
removed, were collected 3 days after either hor- mones addition or symbiotic bacteria infection.
For long term experiments, lupine seeds were im- bibed for 24 h, inoculated with Bradyrhizobium sp.
and plants were growing in sterile perlite at 23°C with 16 h day8 h night photoperiod.
2
.
2
. Isolation of RNA Total RNA was isolated using guanidinum thio-
cyanate [18] from various lupine organs, develop- ing nodule and roots treated with phytohormones.
2
.
3
. Northern blot analysis Each RNA preparation 20 mg was fractionated
on 1 agarose gel containing 2.2 M formaldehyde [19]. Relative loading was confirmed by subse-
quent running of the samples and using UV fluorescence of ethidium bromide stain. The RNA
was blotted onto nylon filters Hybond-N, Amer- sham using standard procedures [19] and hy-
bridized to lupine Cyc1 cDNA. The probe was labeled with Random Primed DNA Labelling Kit
Boehringer
Mannheim and
[a
32
P]ATP. Hy-
bridization was carried out in the presence of 50 formamide, at 42°C for 48 h.
2
.
4
. RT-PCR A sample containing 2 mg of total RNA was
used for reverse transcription by M-MuLV reverse transcriptase Boehringer Mannheim with dT
15
primer, according to manufacturer’s procedure. One fiftieth of the first strand cDNA preparation
was amplified with the use of PCR Core Kit Boehringer Mannheim. The conditions of PCR
reaction were as follows: 95°C, 5 min, {94°C for 30 s, 52°C for 30 s, 72°C for 40 s} 30 times and
final extension at 72°C for 5 min. Preliminary studies showed that 20-cycle PCR amplification of
cyclin transcripts followed by hybridization with radiolabeled probe gave comparable results as 30-
cycle reaction and staining the products with ethidium bromide data not shown. Primers spe-
cific for four cyclins were designed for unique regions at 3 end of respective cDNA clones:
Cyc1: 3aF-AGCTTCATTTTCTTGATGGGT, 3aR-GATTCGCCCAATATCATTCA,
ex- pected PCR product is 148 bp;
Cyc2: 3bF-GGCTCTAGAGTTTGAGGGGA, 3bR-ACAACAATCATCAATAATGCCA 261
bp; Cyc3:
3cF-TCCGGCACTAGAGTTTCAAA, 3cR-CATTGACTTGAGTTGTCCTGG
216 bp;
Cyc4: 3dF- AGGGGGAGGGATTGATTTA, 3dR-ACAAAACAATAACTTCCACACATG
177 bp. Simultaneously, PCR amplification of a consti-
tutively expressed gene: Gln-tRNA synthetase was performed as a control, using primers: syntB-F-
AAAGGAGTATAGGGAGAAGA, syntF-R-
CCGGAGAAGGTTGAGAA 986 bp [20]. For each cyclin, the amplification of respective cDNA
clone in pBluescript vector was used as a positive control and amplification of plant RNA, without
reverse transcription, served as a negative control. All RT-PCRs were repeated twice or more, using
two independent RNA preparations.
2
.
5
. In situ hybridization Uninfected roots and nodules at different stages
of development, were fixed in 50 ethanol, 5 acetic acid, 10 formaldehyde and embedded in
Paraplast Plus Sherwood Medical at 60°C for several days [13]. The 10-mm thick sections were
attached to Superfrost Plus slides Menzel-Glaser. The procedure of in situ hybridization was essen-
tially the same as the method developed by McK- hann
and Hirsch
[21]. Digoxigenin-labeled
antisense and sense negative control RNA probes were synthesised using T7 Boehringer
Mannheim or T3 Stratagene RNA polymerase. The probes corresponding to EcoRI – HindIII
fragment of Cyc4 cDNA were used in all in situ experiments.
After hybridization,
slides were
washed twice for 1 h in 2 × SSC, once for 1 h in 1 × SSC and 30 min in 0.5 × SSC. The digoxi-
genin-labeled probe was detected with anti-digoxi- genin alkaline phosphatase antibody Boehringer
Mannheim diluted 1:200 and using NBTBCIP Boehringer Mannheim as a substrate. The reac-
tion was terminated with TE buffer, then the slides were viewed and photographed with a bright field
microscope. In control in situ hybridization, using the sense probe, the alkaline phosphatase activity
was at the background level.
3. Results
