Journal of Life Sciences Volume 5 Number (1)
J LS
Journal of Life Sciences
Volume 5, Number 11, November 2011 (Serial Number 43)
Contents
Molecular Biology and Biochemical Pharmacy
Newly Discovered Virus Associated Enzyme Capable of Alteration of Nucleic Acid Structures through Phosphotriester/-Diester Bonds
David Pan 884
Effects of Estradiol on 5-HT 5A and 5-HT 2C Receptor Immunolabeling in Rat Hippocampus
Laura Cristina Berumen, Marco Antonio Sánchez-Ramos, Martín García-Servín, Ataulfo Martínez-Torres, Angelina Rodríguez and Guadalupe García-Alcocer
Preliminary Functional Study on Wnt9a Cloning from Human Embryonic Stem Cells
Xueqin Zheng, Xiaonian Zhong, Chengneng Mi, Shuangmei Liu, Wenjing Meng, Yang Liu, Biao Xie, Yun Pan, Yuqing Gong, Shiying Yu, Chaobo Cai, Yanan Cui, Dongsong Nie and Yang Xiang
Effect of Therapeutic Ginger on Genotoxic of Taxol Drug (Anti-Cancer) in Bone Marrow Cell of Male Mice
Mona Mohammed Zaid AL-sharif
Genetics
Stability Assessment of Some West African Okra (Abelmoschus caillei) Genotypes in Nigerian Genebank
Aladele Sunday Ezekiel, Omolayo Johnson Ariyo and Olusola Babatunde Kehinde 913
In Vitro Picloram-Induced Somatic Embryogenesis from Leaflets of Cherry (Prunus incisa Thunb.)
Ben Mahmoud Kaouther, Elloumi Nadhra Chakroun Ahlem, Ahmed Jemmali and Philippe Druart
Phenol Composition and Susceptibility to Fusarium oxysporum Dianthi in Carnation
Francesca Clematis, Joseph Tedeschini, Marcello Dolci, Virginia Lanzotti, Benedetta Cangelosi, Salvo Fascella and Paolo Curir
Physiology
Genotype and Environmental Effects on Cadmium Concentration in Maize
Vlado Kovacevic and Antun Vragolovic
933 Effects of Chlorfluazuron Sublethal Doses on Spermatogenesis of Adult Common Cutworm, Spodoptera litura (F.) (Lepidoptera: Noctuidae)
Farzana Perveen 942
Shoot and Root Growth of Jatropha curcas Accessions Prospective for Rootstock on Rocky and Heavy Soil
Hamim Hamim, Andeng Sutrisna, Bambang Heliyanto, Mohammad Cholid and Miftahudin
954 Preliminary Studies and Antimicrobial Evaluation of the Aerial Parts of Genista numidica ssp. numidica
Oumessaad Toubal, Abdelghani Djahoudi and Amel Bouzabata
Biological Engineering
960 Yields of Polyhydroxyalkanoates (PHAs) during Batch Fermentation of Sugar Cane Juice by Alcaligenes latus and Alcaligenes eutrophus
Waranya Suwannasing, Samart Moonamart and Pakawadee Kaewkannetra 967
Bioremoval of Aquatic Environment Lead by Immobilized Cells of Enterobacter spp.
Harith Jabbar Fahad Al-Mathkhury, Adnan Hasan Afaj and Waad Emad Kasid 974
Differences in Browning Index and CIELAB Coordinates of the Two Grape Drying Processes, Traditional Sun-Drying and Chamber-Drying and during the Ageing of Pedro Ximenez Sweet Wine
María P. Serratosa, Ana Marquez, Azahara Lopez-Toledano, Manuel Medina and Julieta Merida
Journal of Life Sciences 5 (2011) 879-883
Newly Discovered Virus Associated Enzyme Capable of Alteration of Nucleic Acid Structures through Phosphotriester/-Diester Bonds
David Pan Laboratory of Animal Resources, Medical School, University of Wisconsin, Madison, Wisconsin 53706, USA
Received: June 24, 2011 / Accepted: July 25, 2011 / Published: November 30, 2011.
Abstract:
A newly discovered enzyme, that can catalyze the formation of phosphotriester/-diester bonds between nucleic acids, was found to be associated with plant and animal viruses (i.e. southern bean mosaic virus, brome mosaic virus, influenza virus, avian virus and mouse retrovirus). A partially purified enzyme from maize developing endosperms was prepared through 15%-35% ammonium sulfate fractionation, DEAE-cellulose anion exchange column chromatography and Sephadex G150 gel filtration. The enzyme preparation was then used to demonstrate its main functional characteristics. The enzyme can use varieties of short and long chain length of nucleotides as substrates. However, the enzyme requires at least a minimum of 3 to 4 units of nucleotide chain length for the reaction to occur. The enzyme activity shows an optimum reaction in 50 mM sodium acetate buffer at pH 5.4 and is significantly inhibited by 6-azauridine as compared to other nucleotide analogs. By analyzing the data documented in literature and the results from the present study of the association of this enzyme with viruses and the distinctive inhibitory effect of 6-azauridine, it is speculated that this enzyme is likely associated with many other plant and animal viruses. The association of this enzyme on the surface of virus particles can be explored as a common antigen for developing a versatile antiviral vaccine.
Key words: Virus associated enzyme, “phosphotriester/-diester bond linkase”, sugar phosphate backbone of DNA, 6-azauridine.
1. Introduction documented in literature [1-4], but the roles of these proteins related to the infectivity of viruses are poorly
Viruses are important because many cause serious understood. Regarding the function of the illness in humans, animals and can damage crop plants. phosphotriester bond, it has been suggested that the During the last century, progress in the control of interaction between RNA-RNA of snRNA in infectious diseases through new vaccines, drugs and spliceosome is due to the phosphotriester bonding [5]. chemicals has reduced the threat to humans and to the Also it has been known for some time that many production of agricultural products. The advance of genotoxic carcinogens can react with the new knowledge and technology relevant to viruses sugar-phosphate backbone in DNA to form provides a better way to control viral diseases. We phosphotriester (PTE) adducts [6, 7]. In a few RNA report here a newly discovered virus associated and DNA viruses, the genome-linked proteins of these enzyme capable of altering nucleic acid structure viruses through phosphodiester bond could be relevant through the formation of phosphotriester/-diester bond. to the mechanisms of DNA and RNA virus replication The unique phenomenon of the association of host cell [8, 9]. Thus, the formation of phosphotriester bond proteins and enzymes with infectious viruses has been between the sugar phosphate backbone of nucleic acids
could be a unique biochemical reaction in biological
Corresponding author: David Pan, Ph.D., scientist,
system.
research field: genetics. E-mail: dpan@wisc.edu.
Newly Discovered Virus Associated Enzyme Capable of Alteration of Nucleic Acid Structures
through Phosphotriester/-Diester Bonds
2. Materials and Methods
5 µL of virus preparations. 5 µL of nucleic acids and
5 µL of other tested chemical compounds in a final
2.1 Materials volume of 0.6 mL of 50 mM of sodium acetic acid
Virus preparations were gifts from following
buffer, pH 5.4 [10].
laboratories, University of Wisconsin-Madison, USA:
3. Results and Discussion
Poliovirus and influenza virus were obtained from Prof. Roland Rueckert’s Lab; Brome mosaic virus was
3.1 Enzyme Associated with Viruses obtained from Prof. Paul Ahlquist’s Lab, Institute of
Fig. 1 shows the enzyme activities were found to be Molecular Virology; Southern Bean mosaic virus was
associated with several of the tested viruses including obtained from Prof. Thormas German’s Lab, influenza virus, avian virus, brome mosaic virus, Department of Entomology; Avian virus was obtained southern bean mosaic virus and mouse retrovirus. The from Prof. Virginia Hindshaw’s Lab, Veterinary school;
data indicate the nature and reality of the association of Mouse retroviruses were obtained from the late Prof.
this enzyme with the listed viruses, but not as a Howard Temin’s Lab, McArdle Cancer Research
comparative study on enzyme activities. The Laboratory–UW and the University of Laval, Quebec,
association of host cell enzymes/proteins with viruses Canada. All chemicals were obtained from Sigma
and their possible functions has been documented in Biochem Company, St Louis, Missouri, USA.
literature [1-4]. This is the first time we are able to
2.2 Partial Enzyme Purification report a new enzyme associated with the viruses that can carry out the unique function of linking either short
A partial purification of this enzyme was prepared or long chain lengths of nucleic acids together through
from maize developing endosperm of W64A line after phosphotriester/-diester bonds with or without the
22 days of post pollination according to the procedures
intercalation of virus particles.
of 15%-35% ammonium sulfate fractionation, DEAE-cellulose anion exchange column
3.2 The Formation of Complex through chromatography and Sephadex G150 gel filtration as
Phosphotriester/-Diester Bonds
described by Pan [10]. The 50 mM NaCl fraction eluted Fig. 2 demonstrates that the end product complex from DEAE column in 50 mM Tris-HCl, pH 7.0 was
was hydrolyzed by phosphodiesterase, but not by trypsin used for all enzyme assays to characterize the enzyme
activities. The enzyme reactions were assayed in 50 mM sodium acetate buffer at pH 5.4.
2.3 Enzyme Assays All enzyme essays were performed in Beckman
DU-6 spectrophotometer at room temperature. The scale and speed of recorder were adjusted each time to provide optimum conditions for conducting the essays. The reactions and the spectrum of reactions were
automatically recorded on chart paper by following the
Fig. 1 Enzyme activities with yeast RNA as substrate
change of OD at 260 nm after either the addition of catalyzed by virus associated enzyme for the formation of
phosphotriester/-disester bonds as complex.
enzyme or the virus preparations to the reaction 1: Southern bean mosaic virus; 2: Influenza virus; 3: Avian mixture. Routinely, the reaction mixture contained
virus; 4: Mouse retrovirus; 5: Control minus RNA.
Newly Discovered Virus Associated Enzyme Capable of Alteration of Nucleic Acid Structures
through Phosphotriester/-Diester Bonds
and pepsin. Phosphodiesterase can hydrolyze both N-methyl-N-nitrosourea reagent as substrates, were phosphotriester and -diester bonds [11], although the
reduced to about 50% due to the alkylation of the sugar endonucleolytic is much slower than the phosphate backbone of nucleotides. In addition, the exonucleolytic action [12, 13]. The results support the
complexes were consistently stayed at the origin of contention that the increase of OD at 260 nm during
loading well of 1% agarose electrophoresis gel without enzyme reaction is a result of the formation of
migration due to its larger molecular weight regardless phosphotriester/-diester bonding complex but not
of whether short or long chain length of nucleotides used as substrate (data not shown).
related to peptide bonds. Furthermore, the end product complexes, that were derived from the reactions using
3.3 6-Azauridine Is Specific Inhibitor alkalated short chain length poly(A) or poly(dT) with
Table 1 shows that 6-azauridine is specific inhibitor on the enzyme activity. It has been known that 6-azauridine is the most important inhibitor on many viral infections (Table 2). Also, 6-azaurdine has been commonly used for the treatment of many viral infections [14-18]. However, the detailed mechanism of the inhibitory effect of 6-azauridine on viral infectivity is not completely understood. It has been suggested that 6-azauridine may act on some other site(s) of action in the inhibition of virus multiplication
Fig. 2 Formation of RNA polymer complex which is sensitive to phosphodiesterase I (Crotalus atrox venom), but
besides blocking orotidylic acid decarboxylase activity.
insensitive to pepsin or trypsin digestions.
The finding of this new enzyme to be associated with The arrows indicate when the digestion enzymes were added: 1:
viruses and its activity is selectively inhibited by Pepsin; 2: Trypsin; 3: Phosphodiesterase. The 50 mM NaCl
6-azauridine can lead to further study for eluted enzyme fractions from DEAE cellulose anion exchange
column were used for enzyme assays with yeast RNA as understanding the mechanism of its inhibitory effect.
substrate. By analyzing the results of this study together with the
Table 1 Effect of nucleotide analogs on enzyme activity.
% of activity Control 100.0 Control 100.0 UMP 52.3 6-Methyluracil 98.1 UDP 50.1 5-Bromo-2-deoxyuridine 97.2 UTP 48.3 Sulferuridine 86.4 UDPG 74.8 Propanyl thiouracil 71.6 Adenosine 68.4
Nucleotide analogs
% of activity
Nucleotide analogs
Amino uracil 62.5 Guanosine 50.5
Pseudouridin 62.1 Cytidine 48.6 1,3-Dimethyl uracil
95.2 Uracil carboxylic acid
Xanthosine 47.8 2-Azido-2-deoxyuridine 47.3 Uric acid
97.2 6-Aza-2,3,5-acetouridine
Uracil 60.2 Uracil 20.6 8-Azahypoxanthin
82.3 6-Azauridine 0.02 µMol
6-Azauridine 0.04 µMol
All nucleotide analogs added are 0.02 µM. The 50 mM NaCl eluted enzyme fraction from DEAE cellulose anion exchange column was used for assays with yeast RNA as substrate.
Newly Discovered Virus Associated Enzyme Capable of Alteration of Nucleic Acid Structures
through Phosphotriester/-Diester Bonds
Table 2 Virus infectivity inhibited by 6-azauridine [16, 17].
during investigation of this enzyme over the past 20 Names of viral infectivity inhibited by 6-azauridine
plus years.
Dengue 2
Lymphotic chorimeningitis
Adeno 5
Reo 3
4. Conclusion
Parainfluenza 3
Polyoma
Fowl plague
This study demonstrates the presence of a new virus Vaccinia Japanese encephalitis associated enzyme that can catalyze the formation of Rous sarcoma
Venezuelanequine encephalitis
polymeric form of nucleic acid through linking of Herpes hominis
Encephalmyocarditis
Cytomegalo
phosphotriester/-diester bond between the phosphate Measles Rhino virus
Herpes Simplex virus
Influenza virus
backbones of nucleic acid. The fact of the enzyme can Simian rotovirus
use variety of short and long chain length of Vesicular stomatitis
Simian foamy
nucleotides as substrates suggests that the reaction
products could be a result of different polymeric forms of nucleic acid depending on the type of substrates being used. The enzyme is selectively inhibited by 6-azauridine. Based on the result of the enzyme is not only associated with plant and animal viruses, but is also widely distributed in nature ranging from microbial, plant to animal tissues (data not shown) which indicates this enzyme is an evolutionary significant protein.
Acknowledgments
Fig. 3 Effect of nucleotide chain length on enzyme
reaction.
This investigation was carried out in the laboratory The 50 mM NaCl eluted enzyme fraction from DEAE-cellulose
anion exchange column was used for enzyme assays with of the late Prof. Oliver E. Nelson (member of National d(T)2 →d(T)8 as substrates.
Academy of Science) in the Department of Genetics, University of Wisconsin-Madison since 1982. The
data documented in literature about the unique author would like to dedicate this finding to remember inhibitory effect of 6-azauridine on the viral infectivity him for his continued support and encouragement. The of a variety of viruses, this new enzyme could be author is grateful to the laboratories for providing the considered likely to be associated with most, if not all,
viral preparations as gifts.
plant and animal viral particles.
References
3.4 Requirement of Minimum Chain Length of Nucleotides for Reaction
[1] L.O. Arthur, J.W. Bess jr., R.C. Sowder(II), R.E. Benveniste, D.L. Mann, J.C Chermann, et al., Cellular
Fig. 3 shows that the enzyme requires at least a proteins bound to immunodeficiency viruses: Implications minimum of 3 to 4 units of nucleotide chain length for for pathogenesis and vaccines, Science 258 (1992)
1935-1937.
initiating reaction. Both short and longer chain length [2] M.L. Shaw, K.L. Stone, C.M. Colangelo, E.E. Gulcicek, P. of nucleotides can be used as substrates for enzyme
Palese, Cellulars proteins in influenza virus particles, reaction. Calf thymus DNA and yeast RNA, including
PLoS Pathog 4 (6) (2008) e1000085. polyC, polyG, polyCG, polyGU, polydA, polydT and doi:10.1371/Journal.ppat.1000085. [3] D. Pan, A newly discovered viral enzyme capable of
polydAdT etc. had been used for all enzyme assays alteration of nucleic acid structure via phosphotriester and
Newly Discovered Virus Associated Enzyme Capable of Alteration of Nucleic Acid Structures
through Phosphotriester/-Diester Bonds
phosphodiester bonding complex: An event leading to a Phosphotriesters in rat liver deoxyribonucleic acid after new frontier of research and development for viral
the administration of the carcinogen diseases, in: Abstract in 14th International Congress for
NN-dimethylnitrosamine in vivo, Biochem. J. 145 (1975) Infectious Diseases, Miami, USA, March, 2010.
475-482.
[4] M. Hammarstedt, J. Ahlqvist, S. Jacobson, H. Garoff, A. [12] W.E. Razzel, H.G. Khorana, Studies on polynucleotides. Fogdell-Hahn, Purification of infectious human
IV. Enzymic degradation; the stepwise action of venom herpesvirus 6A virions and association of host cell
phosphodiesterase on deoxyribo-oligonucleotides, J. Biol. proteins, Virology J. 4 (2007) 101-112.
Chem. 234 (8) (1959) 2114-2117.
[5] S. Valadkhan, J.L. Manley, Characterization of the [13] P. Bannon, W. Verly, Alkylation of phosphates and catalytic activity of U2 and U6 snRNAs, RNA (Cold
stability of phosphate triesters in DNA, Eur. J. Biochem. Spring Harbor Lab. Press) 9 (2003) 892-904.
31 (1972) 193-111.
[6] K.V. Shooter, DNA phosphotriesters as indicators of [14] R.J. Klein, A.E. Friedman-Kien, E. Brady, Herpes simplex cumulative carcinogen-induced damages, Nature 274
virus skin infection in hairless mice: Treatment with (1978) 612-614.
antiviral compounds, Antimicrobial, Agents & Chemother [7] J. Haglund, W.V. Dongen, F. Lemiere, E.L. Esmans,
5 (3) (1974) 318-322
Analysis of DNA-phosphate adducts in vitro using [15] B. Rada, M. Dragun, Antiviral action and selectivity of miniaturized LC-ESI-MS/MS and column switching:
6-azauridine, Annals. N.Y. Sci. 284 (1977) 410-417. Phosphotriesters and alkyl cobalamins, J. Am. Soc. Mass
[16] D.F. Smee, P.A. MeKernan, L.D. Nord, R.C. Willis, C.R. Spectrum 15 (2004) 593-606.
Petrie, T.M. Riley, et al., Novel pyrazolo [3,4-d] [8] E. Wimmer, Genome-linked proteins of viruses, Cell 28
pyridimidine nucleoside analog with broad-spectrum (1982) 199-201.
antiviral activity, Antimicrob. Agents Chemother. 31 (10) [9] Y.F. Drygin, Natural covalent complexes of nucleic acids
(1987) 1535-1541.
and proteins: Some comments on practice and theory on [17] J.D. Morrey, D.F. Smee, R.W. Sidwell, C. Tseng, the path from well-known complexes to new ones, Nucleic
Identification of active antiviral compounds against a New Acids Res. 26 (21) (1988) 4791-4796.
York isolate of West Nile virus, Antiviral Res. 55 (2002) [10] D. Pan, An endosperm enzyme catalyzes the formation of
107-116.
phosphotriester and phospdiester bonding complex [18] J.M. Crance, N. Scaramozzino, A. Jouan, D. Garin, between nucleic acids with altering their structure, in: 53rd
Interferon, ribavirin, 6-azauridine and glycyrrhizin: Annual Maize Genetic Meeting, Abstract 22, 2011.
Antiviral compounds active against pathogenic [11] P.J. O’Connor, G.P. Margison, A.W. Craig,
flaviviruses, Antiviral Res. 58 (2003) 73-79.
Journal of Life Sciences 5 (2011) 884-889
Effects of Estradiol on 5-HT 5A and 5-HT 2C Receptor Immunolabeling in Rat Hippocampus
1 2 3 Laura Cristina Berumen 3 , Marco Antonio Sánchez-Ramos , Martín García-Servín , Ataulfo Martínez-Torres ,
Angelina Rodríguez 1 and Guadalupe García-Alcocer 1
1. Facultad de Química, Universidad Autónoma de Querétaro, Centro Universitario, Querétaro 76010, México 2. Facultad de Ciencias Naturales, Universidad Autónoma de Querétaro, Campus Juriquilla, Juriquilla Querétaro 76230, México 3. Department of Cellular and Molecular Neurobiology, Instituto de Neurobiología, Universidad Nacional Autónoma de México,
Campus Juriquilla, Juriquilla Querétaro 76230, México
Received: April 05, 2011 / Accepted: June 07, 2011 / Published: November 30, 2011.
Abstract: Steroid hormones participate in the modulation of serotonergic transmission, including the regulation of synthetic and metabolic enzyme production, as well as receptor and transporter activity. The changes of 5-HT 5A and 5-HT 2C immunolabeling induced by steroids in the hippocampus of ovariectomized rats were studied in this work. Densitometric analysis in rat hippocampi were carried out for adjacent brain coronal immunolabeled sections after treatment with subcutaneous injections of vehicle, estradiol, progesterone or the combination of both steroids in ovariectomized rats. Exposure to estradiol and the combination of estradiol and progesterone
significantly reduced the 5-HT 5A –like immunosignal in the CA1 region while progesterone did not induce changes. On the other hand, exposure to the combination of estradiol and progesterone or estradiol alone increased the 5-HT 2C immunosignal in the same region. These results indicate that estradiol is involved in the discrete regulation of serotonin receptors 5-HT 5A and 5-HT 2C in rat hippocampus.
Key words: Serotonin receptor, 5-HT 5A , 5-HT 2C , hippocampus, estradiol, progesterone.
1. Introduction receptor, a G protein-coupled metabotropic receptor, is involved in the modulation of exploratory behavior and
Steroid hormones, which include estrogens, progestins, in certain LSD-psychoactive effects; it is expressed in androgens, glucocorticoids and mineralocorticoids, the brain, with the highest concentrations found in the have ligand-inducible transcription factors-mediated hippocampus [9-11]. Activation of 5-HT 5A receptors actions; they also have several non-genomic effects inhibits the production of cAMP but its precise that modify the trascriptional activity of different genes. metabolic cascade has not been fully elucidated [12-14]. These effects include essential roles played by steroid On the other hand, 5-HT 2C receptors are hormones in: brain differentiation, neural plasticity and heterogeneously distributed in the brain with the neurotransmission [1-3]. highest levels in the choroid plexus [15, 16]; they are Steroid hormones have modulatory effects on the involved in the control of appetite and tonic inhibition synthesis and release of several neurotransmitters such of neuronal network excitability [17, 18]. The 5-HT 2C as serotonin [4, 5] and affect serotonergic transmission receptor regulates a number of effectors through PLC-, in some extent by regulating the density of receptors in Ca 2+ -, or PKC-dependent mechanisms [14].
neuronal plasma membranes [6-8]. The 5-HT 5A
Serotonergic pathways innervate the hippocampus and other limbic regions where they play an essential
Corresponding author: Laura Cristina Berumen, Ph.D., role in mood control and memory [17, 19]. Taking into professor, research fields: neurobiology, neuroendocrinology.
E-mail: berumen@uaq.mx. consideration the known serotonergic activation in the
Effects of Estradiol on 5-HT 5A and 5-HT 2C Receptor Immunolabeling in Rat Hippocampus
hippocampus and the modulation of a number of Immunohistochemistry was performed with specific serotonin receptors by steroids, tests were conducted to
antibodies used to determine the distribution of the ascertain if estradiol and progesterone alter the
receptors: 1) an anti 5-HT 5A receptor (Sigma; 1:500);
expression and location of 5-HT 5A receptors in the rat
and 2) an anti 5-HT 2C (Santa Cruz Biotechnologies;
hippocampus compared to 5-HT 2C .
1:500). The slices were incubated overnight at room temperature with the primary antibody; after rinsing,
2. Materials and Methods
they were incubated with the biotin-conjugated goat Adult female Sprague-Dawley rats (200-250 g) were
anti-rabbit antibody (Chemicon) for two hours at room maintained with food and water ad libitum in 12 h/12 h
temperature and then with Vector ABC system. Finally, light-dark cycles. Each experimental group consisted
3,3’-diaminobenzidine (DAB) and hydrogen peroxide of five rats ovariectomized under anesthesia (80 mg/kg
were used for color development. Digitized images of ketamine + 6 mg/kg xylazine) between 9-12 h in the
nine sections for each rat were analyzed using morning of diestrus. Administration of all treatments
densitometry (Axiovision, Zeiss). One-way ANOVA was carried out between 9-10 h in the morning of days
and Tukey tests were used for statistical analysis of
1 through 5 after surgery using a single daily differences between group means. All experiments subcutaneous injection. The control group of rats was
were conducted according to the international administered only vehicle (100 μL corn oil guidelines of the care and use of experimental animals. subcutaneous injection). A group of ovariectomized
rats was treated with 50 μg/kg body weight of estradiol benzoate (EB). Another group was treated with 7.5
3. Results
Immunodetection of 5-HT 5A receptor in the mg/kg of progesterone (P) and a last group was injected
hippocampus of untreated rats revealed that it is with the combination of EB and P. After treatments rats
distributed in all regions. Rats treated with EB or EB + P were anesthesized with sodium pentobarbital (40
showed an overall reduced staining for 5-HT 5A (Fig. 1) mg/kg) and decapitated between 9-12 h the next day
in CA1 region. In contrast, P did not elicit significant following the treatment. Brains were fixed in 4%
changes compared to controls.
paraformaldehyde-PBS and coronal sections of 12 μm Densitometric analysis of the samples (Fig. 2) confirmed were made in a Leica CM 1850 cryostat, then thaw
the observations made under the microscope, with a mounted on superfrost slides [20].
11.4% reduction of intensity for 5-HT
5A receptor-like
Fig. 1 Coronal sections of rat brains stained by immunohistochemistry (DAB, H 2 O 2 ) with an antibody against the 5-HT 5A or 5-HT 2C serotonin receptors.
A, E: Ovariectomized rat control; B, F: Treated with 17 β-estradiol; C, G: Treated with 17β-estradiol and progesterone; D, H: Treated with progesterone. Densitometry was performed for hippocampus. Scale bar: 1,000 μm.
Effects of Estradiol on 5-HT 5A and 5-HT 2C Receptor Immunolabeling in Rat Hippocampus
immunosignal for EB treatment and 10.2% for EB + P units normalized against negative controls (no primary treatment (P < 0.01). No-statistical difference for the
antibody). Estradiol (EB) and Estradiol + 3.9% reduction of intensity in P treatment compared to
Progresterone (EB + P) decreased receptor expression control, and no-statistical differences between EB and
with statistical significance ( ¶ ) compared to controls EB + P were noted.
(P < 0.01).
The effects of EB and EB + P on 5-HT 2C receptors
4. Discussion
(Fig. 3) were the opposite to those on 5-HT 5A receptors;
consistently, both treatments gave rise to higher levels The activity of different neurotransmitter systems of 5-HT 2C immunolabeling in CA1 (Fig. 1) compared
can be modulated by steroid hormones. The effect of to controls that showed 2.5% and 2% respectively, P <
steroids over the serotonergic pathway has been widely
0.01 for EB + P. In contrast, rats treated with P alone studied by different means, although the partial did not differ from the control samples in that less than
agonism of classical drugs and ligands for the various 1% reduction with no significant difference noted.
serotonin receptors sometimes overlapping, makes it The densitometry values are arbitrary optical density
complex to analyze [21, 22]. In this work we found that estradiol changed the expression of 5-HT
5A and 5-HT 2C
serotonin receptor subtypes. It has been reported that the administration of estrogen sharply reduced
[ 3 H]5-HT binding-sites in the hypothalamus and preoptic nucleus [7, 8, 23]; however the response is
different for subtypes of serotonin receptor and brain areas. The effects of steroids have been studied in
different areas of rat brain for several receptor subtypes, especially 5-HT 1A and 5-HT 2A , but 5-HT 5A has
received less attention. For example, estradiol reduced
the 5-HT 1A receptor mRNA in the piriform cortex and
Fig. 2 Densitometry of 5-HT 5A serotonin receptors in CA1
of rat hippocampus after treatment with steroids.
the anterodorsal medial amygdale whereas it remained unaltered in the hippocampus and the prefrontal and
cingulate cortex as well as in the dorsal nucleus of
raphe [24, 25]. Furthermore, estradiol increased 5-HT 2A mRNA in several limbic regions of
gonadectomized rats treated with estradiol or testosterone [26, 27] although no changes or reduced
levels for 5-HT 2C mRNA were found for discrete areas
of hippocampus [28].
It has been previously reported that the 5-HT 5A
receptor undergoes developmental modifications and is
a suitable candidate for fine-tuning regulation of the
2C
Fig. 3 Densitometry of 5-HT (arbitrary optic density
units) serotonin receptors in CA1 of rat hippocampus after
serotonergic system [20]. Changing conditions such as
treatment with steroids.
steroid levels may also exert different modulatory Estradiol (EB) and Estradiol + Progresterone (EB + P)
effects on the number and class of serotonin receptors increased receptor expression with statistical significance ( ¶ )
compared to controls (P < 0.01). present in the plasma membrane. In this project it was
Effects of Estradiol on 5-HT 5A and 5-HT 2C Receptor Immunolabeling in Rat Hippocampus
interaction needs to be tested, although it has been The results herein regarding this receptor were
found that estradiol down-regulated 5-HT 5A receptors.
reported the estradiol induced expression for this consistent with the down-regulation expected for the
receptor in rat anterior pituitary cell aggregates [34]. negative cAMP G-protein coupled receptor 5-HT 1A Moreover, the steroids may regulate receptor although differences were found particularly in
expression via other transcription factors, including hippocampus [25]. On the other hand, progesterone
cyclic AMP response element binding proteins. action requires estrogen-priming in order to be
Estradiol causes phosphorilation of CREB in the CA1 effective [29]. No-changes were found with the
region as well as in the CA3, which might be involved subcutaneous high dosis administration of in the tissue-specific modification of serotonin progesterone alone in these experiments. However,
receptors and differences found in in vitro experiments administering both estradiol and progesterone showed
[1, 28, 35]; furthermore, pCREB immunolabeling is no statistical differences versus estradiol alone increased in hippocampus after estradiol therefore it can be inferred that progesterone does not
administration as well as BDNF expression [36], which have a differential effect at this high acute dosis.
are involved in the expression of some serotonin For the 5-HT 2C receptor-like immunodetection there
receptors.
were found significant increases of signal noted after
5. Conclusion
treatment with estradiol and estradiol plus progesterone which support the idea for specific cellular
Administration of acute dosis of estradiol in modifications in the serotonergic transmission. These
ovariectomized rats down-regulates 5-HT 5A and results also correspond with the changes in PLC
up-regulates 5-HT 2C receptors in CA1 region of
hippocampus, whereas progesterone alone does not 5-HT 2C [30]. Nonetheless, it was found found that there
G-protein coupled serotonin receptor 5-HT 2A [26] and
induce significant changes in the expression of these were differences in receptor expression in receptors. hippocampus using subcoutaneously implanted pellets
Acknowledgments
[28] that might reflect differences in the dosages used and way of administration.
The authors appreciate the efficient work and help of The different effects of estrogen and progesterone on
Aaron Tecozautla, Jesica Escobar, Berenice Flores and Karina Hernández. They would also like to
the expression of serotonin receptors need to be further investigated in order to determine whether the effects
acknowledge Silvia C. Stroet of Universidad Autónoma de Querétaro and Nancy Arent for editing
are directly on the transcriptional regulation of the receptor protein, or reflect the contribution of the
the English content of this document. This work was serotonin itself and its pathways. Although there are no
supported (funds) by ProMeP for Berumen, CONACYT and DGAPA-PAPIIT for Martínez-Torres.
recognizable canonical ERE in 5-HT 5A sequence
(ratCHR4:2707261-2716944) [31] and its 5 ′ and 3′
References
flanking regions (5 kbp), there are ERE-like motifs [1] J.L. Spencer, E.M. Waters, T.A. Milner, B.S. McEwen, with different spacing regions between palindromic Estrous cycle regulates activation of hippocampal Akt,
and direct repeats [32, 33], particularly one pentameric LIM kinase, and neurotrophin receptors in C57BL/6 mice, modified palindrome sequence with a four-bp spacer
Neuroscience 155 (4) (2008) 1106-1119. (CHR4:2717587-2717574) and the glucocorticoid [2] M. Beato, J. Klug, Steroid hormone receptors: an update, Hum Reprod. Update 6 (2000) 225-236.
receptor recognized sequence 3-bp spaced from an [3] G. Fink, B.E. Sumner, J.K. McQueen, H. Wilson, R. Rosie, ERE-like motif (CHR4:2702313-2702299). This direct
Sex steroid control of mood, mental state and memory,
Effects of Estradiol on 5-HT 5A and 5-HT 2C Receptor Immunolabeling in Rat Hippocampus
Clin. Exp. Pharmacol. Physiol. 25 (1998) 764-775. Comparison with receptor binding distribution, [4] T. Inagaki, C. Gautreaux, V. Luine, Acute estrogen
Neuroscience 35 (1990) 577-591.
treatment facilitates recognition memory consolidation [17] A. Kimura, P.L. Stevenson, R.N. Carter, G. Maccoll, K.L. and alters monoamine levels in memory-related brain
French, J. Paul Simons, et al., Overexpression of 5-HT2C areas, Horm. Behav. 58 (3) (2010) 415-426.
receptors in forebrain leads to elevated anxiety and [5] P.J. Schmidt, D.R. Rubinow, Sex hormones and mood in
hypoactivity, Eur. J. Neurosci. 30 (2) (2009) 299-306. the perimenopause, Ann N Y Acad. Sci. 1179 (2009)
[18] L.H. Tecott, L.M. Sun, S.F. Akana, A.M. Strack, D.H. 70-85.
Lowenstein, M.F. Dallman, et al., Eating disorder and [6] P. Zheng, Neuroactive steroid regulation of
epilepsy in mice lacking 5-HT2c serotonin receptors, neurotransmitter release in the CNS: action, mechanism
Nature 374 (1995) 542-546.
and possible significance, Prog. Neurobiol. 89 (2) (2009) [19] S. Campbell, G. Macqueen, The role of the hippocampus 134-152.
in the pathophysiology of major depression, J. Psychiatry [7] A. Biegon, B.S. McEwen, Modulation by estradiol of
Neurosci. 29 (2004) 417-426.
serotonin receptors in brain, J. Neurosci. 2 (1982) [20] G. García-Alcocer, L.C. Berumen Segura, M. García-Peña, 199-205.
A. Martinez Torres, R. Miledi, Ontogenic distribution of [8] A. Biegon, H. Bercovitz, D. Samuel, Serotonin receptor
5-HT2C, 5-HT5A, and 5-HT7 receptors in the rat concentration during the estrous cycle of the rat, Brain Res
hippocampus, Gene Expression 13 (2006) 53-57. 187 (1980) 221-225.
[21] L.C. Berumen, A. Tecozautla, M.A. Sánchez-Ramos, M. [9] R.A. Glennon, Higher-end serotonin receptors: 5-HT(5),
García-Servín, G. García-Alcocer, Steroid hormone 5-HT(6), and 5-HT(7), J. Med. Chem. 46 (14) (2003)
effects on 5-HT5A serotonin receptor-like 2795-2812.
immunolabelling in the rat hippocampus, 4th International [10] R. Grailhe, C. Waeber, S.C. Dulawa, J.P. Hornung, X.
Meeting Steroids and Nervous System Abstract Book, Zhuang, D. Brunner, et al., Increased exploratory activity
2007, p. 163.
and altered response to LSD in mice lacking the 5-HT(5A) [22] S. Mouillet-Richard, M. Pietri, B. Schneider, C. Vidal, V. receptor, Neuron. 22 (1999) 581-591.
Mutel, J.M. Launay, et al., Modulation of serotonergic [11] M.G. Erlander, T.W. Lovenberg, B.M. Baron, L. Lecea,
receptor signaling and cross-talk by prion protein, J. Biol. P.E. Danielson, M. Racke, et al., Two members of a
Chem. 280 (6) (2005) 4592-4601.
distinct subfamily of 5-hydroxytryptamine receptors [23] A. Biegon, A. Reches, L. Snyder, B.S. McEwen, differentially expressed in rat brain, Proc. Nat. Acad. Sci.
Serotonergic and noradrenergic receptors in the rat brain: USA 90 (1993) 3452-3456.
modulation by chronic exposure to ovarian hormones, Life [12] J. Bockaert, S. Claeysen, C. Bécamel, A. Dumuis, P.
Sci. 32 (1983) 2015-2021.
Marin, Neuronal 5-HT metabotropic receptors: fine-tuning [24] M. Landry, T. Di Paolo, Effect of chronic estradiol, of their structure, signaling, and roles in synaptic
tamoxifen or raloxifene treatment on serotonin 5-HT1A modulation, Cell Tissue Res. 326 (2006) 553-572.
receptor, Mol. Brain Res. 12 (2003) 82-89. [13] W.K. Kroeze, B.L. Roth, Molecular biology and genomic
[25] M.K. Osterlund, D.H. Overstreet, Y.L. Hurd, The flinders organization of G protein-coupled serotonin receptors, in:
sensitive line rats, a genetic model of depression, show B.L. Roth (Ed.), The Serotonin Receptors: from Molecular
abnormal serotonin receptor mRNA expression in the Pharmacology to Human Therapeutics, Humana Press,
brain that is reversed by 17beta-estradiol, Brain Res Mol New Jersey, 2006, pp. 1-38.
Brain Res. 74 (1999) 158-166.
[14] J.R. Raymond, J.H. Turner, A.K. Gelasco, H.B. Ayiku, [26] B.E. Sumner, G. Fink, Testosterone as well as estrogen S.D. Coaxum, J.M. Arthur, et al., 5-HT receptor signal
increases serotonin2A receptor mRNA and binding site transduction pathways, in: B.L. Roth (Ed.), The Serotonin
densities in the male rat brain, Mol. Brain Res. 59 (1998) Receptors: From Molecular Pharmacology to Human
205-214.
Therapeutics, Humana Press, New Jersey, 2006, pp. [27] B.E. Sumner, G. Fink, Estrogen increases the density of 143-206.
5-hydroxytryptamine(2A) receptors in cerebral cortex and [15] D. Hoyer, J.P. Hannon, G.R. Martin, Molecular,
nucleus accumbens in the female rat, J. Steroid Biochem. pharmacological and functional diversity of 5-HT
Mol. Biol. 54 (1995) 15-20.
receptors, Pharm. Biochem. Beh. 71 (2002) 533-554. [28] V. Birzniece, T. Backstrom, I.M. Johansson, C. Lindblad, [16] G. Mengod, H. Nguyen, H. Le, C. Waeber, H. Lübbert,
P. Lundgren, M. Lofgren, et al., Neuroactive steroid J.M. Palacios, The distribution and cellular localization of
effects on cognitive functions with a focus on the serotonin the serotonin 1C receptor mRNA in the rodent brain
and GABA systems, Brain Res. Rev. 51 (2006) 212-239. examined by in situ hybridization histochemistry.
[29] R.W. Gereau IV, K.A. Kedzie, K.J. Renner, Effect of
Effects of Estradiol on 5-HT 5A and 5-HT 2C Receptor Immunolabeling in Rat Hippocampus
889
progesterone on serotonin turnover in rats primed with Mol. Endocrinol. 11 (10) (1997) 1486-1496. estrogen implants into the ventromedial hypothalamus,
[34] A. Papageorgiou, C. Denef, Estradiol induces expression Brain Res. Bull. 32 (3) (1993) 293-300.
of 5-hydroxytryptamine (5-HT) 4,5-HT5, and 5-HT6 [30] W. Zhou, K.A. Cunningham, M.L. Thomas, Estrogen
receptor messenger ribonucleic acid in rat anterior regulation of gene expression in the brain: a possible
pituitary cell aggregates and allows prolactin release via mechanism altering the response to psychostimulants in
the 5-HT4 receptor, Endocrinology 148 (3) (2007) female rats, Mol. Brain Res. 100 (2002) 75-83.
1384-1395
[31] Ensembl, 2010, http://www.ensembl.org/Rattus_novergicus. [35] M.A. Mahgoub, Y. Sara, E.T. Kavalali, L.M. Monteggia, [32] F.J. Shu, N. Sidell, D. Yang, C.B. Kallen, The
Reciprocal interaction of serotonin and neuronal activity tri-nucleotide spacer sequence between estrogen response
in regulation of camp-responsive element-dependent gene element half-sites is conserved and modulates
expression, J. Pharmacol. Exp. Ther. 317 (2006) 88-96. ER-mediated transcriptional responses, J. Steroid
J. Zhou, H. Zhang, R.S. Cohen, S.C. Pandey, Effects of Biochem Mol Biol 20 (2010) 172-179.
estrogen treatment on expression of BDNF and CREB [33] K. Pettersson, K. Grandien, G.G. Kuiper, J.A. Gustafsson,
expression and phosphorylation in rat amygdaloid and Mouse estrogen receptor β forms estrogen response
hippocampal structures, Neuroendocrinology 81 (5) (2005) element-binding heterodimers with estrogen receptor α,
294-310.
Journal of Life Sciences 5 (2011) 890-896
Preliminary Functional Study on Wnt9a Cloning from Human Embryonic Stem Cells
Xueqin Zheng, Xiaonian Zhong, Chengneng Mi, Shuangmei Liu, Wenjing Meng, Yang Liu, Biao Xie, Yun Pan, Yuqing Gong, Shiying Yu, Chaobo Cai, Yanan Cui, Dongsong Nie and Yang Xiang Department of Chemistry and Chemical Engineering, Hunan Institute of Science and Technology, YueYang 414000, China
Received: March 08, 2011 / Accepted: May 04, 2011 / Published: November 30, 2011.
Abstract: Wnts are secreted lipid-modified signaling proteins that influence multiple processes ranging from cell proliferation and differentiation, fate decisions, apoptosis, axial polarity and axonal guidance to stem cell loss, kidney and reproductive tract defects. Activation of Wnt signalling in many tissues has also been associated with cancer. In many eukaryotes, expression of nuclear-encoded mRNA can be strongly inhibited by the presence of a small double-stranded RNA corresponding to exon sequences in the mRNA. In this study, human Wnt9a was cloned from undifferentiated hES cells. The results of immunohistochemistry showed that Wnt9a protein was expressed in undifferentiated hES cells. pAVU6+27 vectors were used to construct the siRNA expression vectors for human Wnt9a. One kind of small interfering RNA inserts was designed, synthesized and tested for human Wnt9a. The results of in situ hybridization demonstrated that Wnt9a signal was dramatically reduced in the cells transfected with U6+27/siWnt9a compared to the untransfected cells. The results of flow cytometry analysis showed that the human breast cancer MCF-7 cells proliferation was promoted after lowering the expression of human Wnt9a by RNAi, but inhibited after over-expression of human Wnt9a. All those suggest the expression level of human Wnt9a may play a role in adjusting the rate of cell proliferation of hES and MCF-7 cells.
Key words: Wnt9a, cloning, hES cells (human embryonic stem cells), function.
1. Introduction their signaling pathway involves proteins that directly participate in both gene transcription and cell adhesion
Human embryonic stem cells (hES cells) will be the [7] that can be developed into important reagents for unlimited cell source for future cell therapy, cell fate control, including stem cells [5], influence contributing to their characteristics of pluripotency, multiple processes ranging from stem cell loss to capability of differentiation to almost any type of cells kidney and reproductive tract defects, cell proliferation [1]. At present a lot of inactive mouse embryonic and differentiation, cell fate decisions, apoptosis, axial fibroblasts (mEFs) are required to maintain and polarity and axonal guidance [8], and their signaling support the hES cell growth in an undifferentiated pathway involves proteins that directly participate in state [2-4]. The Wnt family of signaling molecules both gene transcription and cell adhesion [7]. The regulates numerous processes in animal development central player is β-catenin, which is a transcription and has increasingly been implicated in tissue cofactor with T cell factor/lymphoid enhancer factor homeostasis in adult organisms [5]. Wnts are secreted TCF/LEF in the Wnt pathway [8] and a structural lipid-modified signaling proteins [6] and powerful adaptor protein linking cadherins to the actin regulators of cell proliferation and differentiation, and cytoskeleton in cell-cell adhesion [9]. Wnts influence
Corresponding author: Yang Xiang, Ph.D., professor, multiple processes in animal development [7]. The research fields: molecular and cell biology. E-mail:
finished genomes of mammals have led to catalogues xiangyangbio@126.com.
Dongsong Nie, Ph.D., research fields: molecular and cell of 19 Wnt genes in the human and the mouse [5]. In biology. E-mail: ndz1997@126.com.
Preliminary Functional Study on Wnt9a Cloning from Human Embryonic Stem Cells 891
many tissues, activation of Wnt signalling has also change was performed every 2-3 days. For subsequent been associated with cancer [10]. Unchecked Wnt
analyses, the hES cells were either fixed for signaling [11] and/or the loss of cell-cell adhesion [12]
immunohistochemical evaluation or rapidly harvested are involved in cancer induction and progression. Loss
by mechanical dissociation and frozen at −80°C for of cadherin expression can also promote tumorigenesis
RNA extraction.
[13]. RNA interference (RNAi) is a process of
2.2 RNA Extraction and RT-PCR Analysis posttranscriptional gene silencing, by which
double-stranded RNA (dsRNA) induces Extraction of total RNA from undifferentiated hES sequence-specific degradation of homologous gene
cells maintained on mEFs; human three month transcripts [14, 15]. Efficient RNA interference
abortion fetus testis, cerebra, cerebellum, kidney, technologies are used to antagonize gene function [16].
adrenal gland, skeletal muscle, heart, liver, small Wnt9a predominantly expressed in the mural
intestine, thymus, stomach and lung; and human breast trophoblast and inner cell mass cells surrounding [17].
cancer MCF-7 cells (was given friendly by cancer Wnt9a has been implicated as being a player in joint
research institute of central south university) were induction, based on gain-of function experiments in
performed using the Gentra system RNA isolation chicken and mouse. Wnt9a is a temporal and spatial
(Gentra reagents, USA) according to the protocol regulator of Indian hedgehog (Ihh), a central player of
provided. DNase treatment was performed on-column skeletogenesis. Wnt9a signaling is required for joint
using RNase-free DNase Kit (Qiagen). Reverse integrity and regulation of Ihh during chondrogenesis [18].
transcription was performed using 1-2 μg of total In this study, human Wnt9a was cloned from hES
RNA in a final volume of 20 μL, using iScript First cells. The preliminary function of human Wnt9a was
Strand Synthesis Kit (Bio-Rad Laboratories, Hercules, studied by RT-PCR, immunohistochemistry, in situ
CA,). PCR primer pair for human Wnt9a was: hybridization, RNAi, over expression Wnt9a and analyses
′-tcaaggagactgccttcctctat-3′, R: 5′-actccacatagcagc F: 5 of flow cytometry. The results showed that the expression
accaac-3 ′. Semiquantitative RT-PCR was performed level of human Wnt9a adjust the rate of cell proliferation.
by the following procedure: denaturation (94°C for
2. Materials and Methods
90 s); 35 cycles of amplification (94°C for 40 s, 62°C for 40 s, 72°C for 90 s), and extension (72°C for 5 min)
2.1 hES Cells Culture
for human Wnt9a.
The hES cell line chESC-3, one of the several
2.3 Construction pEGFP-C3/Wnt9a Recombinant human ES cell lines was established as described [1]
Plasmid
and cultured on mEFs in a culture medium consisting of 85% Knock-out Dulbecco’s modified Eagle’s
To allow a directional insertion of the whole ORF of medium (KO-DMEM), 15% Knock-out serum human Wnt9a into the pEGFP-C3 vector (Clontech), replacement, 1 mmol/L L-glutamine, 0.1 mmol/L
primers 5'-gaagcttatgctggatgggtccccg-3' (HindⅢ) and β-mercaptoethanol, 1% non-essential amino acids, and
5'-aggatccgcaatgcctgcaccctgt-3' (BamHⅠ) were used
4 ng/mL human basic fibroblast growth factor (hbFGF) to amplify the target gene. After PCR amplification, the (all Gibco Invitrogen products, USA). Undifferentiated
hunman Wnt9a encoding sequences were subcloned in hES cells were passaged every 5 days with fresh
the pMD18-T vector. Subsequently, the recombinant medium and mEFs by mechanical dissociation using a
pMD18-T/Wnt9a and pEGFP-C3 vectors were “Stem Cell Tool” (Swemed Lab International AB,
digested with the restriction endonucleases HindⅢ and Billdal, Sweden, http://www.swemed.com). Medium
Bam H Ⅰ (MBI). Both digestion reactions were
892 Preliminary Functional Study on Wnt9a Cloning from Human Embryonic Stem Cells
checked by using 2.0% agarose gel electrophoresis, siRNA for human Wnt9a was designed by using the and then the pEGFP-C3 vector and the gene fragments
Ambion web-based criteria. Their primer pairs for digested using HindⅢ and BamHⅠ were purified.
RT-PCR were synthesized by Invitrogen Co. as follows: Then, a ligation reaction was done according to the
siWnt9a F1: 5 ′-tcgaaaccttaagtacagcagcaagcttgcttgctg manufacturer’s instructions (TaKaRa Co., Japan).
ctgtacttaaggtt tttt-3 ′ (SalⅠ), siWnt9a R1: 5′-ctagaaaa DH5 α cells were transformed with 10 μL of the
aaccttaagtacagcagcaag caagcttgctgctgtacttaaggtt-3 ′ ligation reaction products and spread on an LB agar
(XbaⅠ); The pairs of primers were incubated at 95°C plate containing 100 μg/mL ampicillin. Finally,
for 5 min with 1×annealing buffer (10 mmol/L individual clones were checked using Tris-HCL and 100 mmol/L NaCl), and then gradually DNA-sequencing to ensure that the fusion plasmids
cooled to room temperature. The annealed shDNAs were correctly constructed.
were inserted into the digested pAVU6+27 vectors with SalⅠ and XbaⅠ clone sites. The shRNA
2.4 Immunohistochemistry expression vectors, pAVU6+27/siWnt9a was
Human embryonic stem cells were cultured by our transformed into E. coli DH5 α and identified by stem cell centre. Undifferentiated hES cells maintained
RT-PCR using sense primer, 5 ′-ctaactgacacacattccac-3′ on mouse embryonic fibroblasts were fixed in 4%
and antisense primer, 5 ′-gcaataaacaagttactagtcc-3′. The paraformaldehyde. Immunohistochemistry was resulting products were analyzed by electrophoresis on performed according to the procedure described by
a 2.0% agarose gel and sequenced. themanufacturer (SABC kit, Boster Co. Wuhan, China).
2.6 Cell Culture and Transfection