Implikasi REPLIKASI DNA DAN PCR (Polymerase Chain
Implikasi REPLIKASI DNA DAN PCR (
Polymerase Chain Reaction) Utut Widyastuti
What is PCR? What is PCR?
It was invented in 1983 by Dr. Kary
Mullis, for which he received the Nobel
Prize in Chemistry in 1993.PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro .
What is PCR? : What is PCR? :
Why “ Polymerase ” ? Why “ Polymerase ” ?
It is called “polymerase” because the
only enzyme used in this reaction is DNA polymerase.What is PCR? : What is PCR? :
Why “ Chain ” ? Why “ Chain ” ?
It is called “chain” because the
products of the first reaction become
substrates of the following one, and so on.History
- The Polymerase Chain Reaction (PCR) was not a discovery, but rather an invention
- A special DNA polymerase (Taq) is used to make many copies of a short length of DNA (100-10,000 bp) defined by primers
What PCR Can Do
- PCR can be used to make many copies of any DNA that is supplied as a template
- Starting with one original copy an almost infinite number of copies can be made using PCR
- “Amplified” fragments of DNA can be sequenced, cloned, probed or sized using electrophoresis
• Defective genes can be amplified to diagnose any number of
illnesses• Genes from pathogens can be amplified to identify them (ie.
HIV)
- Amplified fragments can act as genetic fingerprints
How PCR Works
• PCR is an artificial way of doing DNA
replication- Instead of replicating all the DNA present, only a small segment is
replicated, but this small segment is
replicated many times - As in replication, PCR involves:
- –Melting DNA
- –Priming
- –Polymerization
3’ 5’ 3’ 5’ 5’ 5’ 3’ 3’
Origin of Replication 5’ 3’ 3’ 5’
5’ 3’ 5’ 5’ 5’ 3’ 3’ 3’
Leading Strand Leading Strand Laging Strand Laging Strand 3’
5’ 3’ 5’
Extension - The Replication Fork
5’ 5’ 5’ 3’ 3’ 5’ 3’ 3’
5’ Single strand binding proteins DNA Polymerase Okazaki fragment RNA Primers Primase 5’ 3’ 5’ Helicase
Functions And Their Associated Enzymes Function Enzyme
- Melting DNA è Helicase
è SSB Proteins è Topisomerase
- Polymerizing è DNA DNA
Polymerase
- Providing primer è Primase • Joining nicks è Ligase
Components of a PCR Reaction
- Buffer (containing Mg )
- Template DNA
• 2 Primers that flank the fragment of
DNA to be amplified- dNTPs
- Taq DNA Polymerase (or another
thermally stable DNA polymerase)
PCR The cycling react ions : There are t hree m aj or st eps in a PCR, w hich are repeat ed for 20 t o 40 cycles. This is done on an aut om at ed Th e r m o Cycle r , w hich can heat and cool t he react ion t ubes in a very short t im e.
Denat urat ion at around 94°C :
During t he denat urat ion, t he double st rand m elt s open
t o single st randed DNA, all enzym at ic react ions st op ( for exam ple t he ext ension from a previous cycle) .Annealing at around 54°C :
Hydrogen bonds are const ant ly form ed and broken
bet w een t he single st randed prim er and t he single st randed t em plat e. I f t he prim ers exact ly fit t he t em plat e, t he hydrogenbonds are so st rong t hat t he prim er st ays at t ached
Ext ension at around 72°C : The bases ( com plem ent ary t o t he t em plat e) are coupled t o t he prim er on t he 3' side ( t he polym erase adds dNTP's from 5' t o 3', reading t he t em plat e from 3' t o 5' side, bases are added com plem ent ary t o t he t em plat e)PCR Exponent ial increase of t he
num ber of copies during PCR PCR
Melting
94 o
C
Temperature 100
5’ 3’
3’ 5’
50 T i m e
PCR
Melting
94 o
C
Temperature 100
3’ 5’
5’ 3’
Heat
50 T i m e
PCR
Temperature 100
C
94 o
Melting
5’ 5’
5’ 3’
3’ 5’
C
Melting
72 o
C Extension
50 o
Primers
C Annealing
94 o
50 T i m e
PCR
C
5’
5’ 5’
Heat Heat
5’ 3’
3’ 5’
30x
Temperature 100
72 o
Melting
C Extension
50 o
Primers
C Annealing
94 o
C Melting
94 o
50 T i m e
PCR
C
5’
5’ 5’ 5’
5’ 5’
5’ 3’
3’ 5’
30x
Temperature 100
72 o
Melting
C Extension
50 o
Primers
C Annealing
94 o
C Melting
94 o
50 T i m e
PCR
72 o
Heat Heat
5’
5’ 5’ 5’
30x 3’ 5’ 5’ 5’
Temperature 100
C
C Extension
Melting
50 o
Primers
C Annealing
94 o
C Melting
94 o
50 T i m e
PCR
72 o
5’ 5’ 5’
5’ 5’
5’ 5’ 5’
30x 3’ 5’ 5’ 5’
Temperature 100
C
C Extension
Melting
50 o
Primers
C Annealing
94 o
C Melting
94 o
50 T i m e
Fragments of defined length PCR
C
5’
5’ 5’ 5’
5’ 5’
5’ 5’
30x 3’ 5’ 5’ 3’ 5’ 5’
Temperature 100
72 o
Melting
C Extension
50 o
Primers
C Annealing
94 o
C Melting
94 o
50 T i m e
Theoretical Yield Of PCR n Theoretical yield = 2 x y
Where y = the starting number of copies and n = the number of thermal cycles
If you start with 100 copies, how many copies are
made in 30 cycles? n 2 x y30 = 2 x 100 = 1,073,741,824 x 100 = 107,374,182,400
Verification of PCR product
How The Functions Of Replication
Are Achieved During PCR
Function PCR- Melting DNA è Heat • Polymerizing è Taq DNA DNA
Polymerase
- Providing primer è Primers are
added to the reaction mix
- Joining nicks è N/A as fragments
are short
PCR and Contamination The m ost im port ant considerat ion in PCR is cont am inat ion
Even t he sm allest cont am inat ion wit h DNA could affect am plificat ion
For exam ple, if a t echnician in a crim e lab set up a t est react ion( wit h blood from t he crim e scene) aft er set t ing up a posit ive cont rol
react ion ( wit h blood from t he suspect ) cross cont am inat ion bet ween
t he sam ples could result in an erroneous incrim inat ion, even if t he t echnician changed pipet t e t ips bet ween sam ples. A few blood cells could volit ilize in t he pipet t e, st ick t o t he plast ic of t he pipet t e, and t hen get ej ect ed int o t he t est sam pleModern labs t ake account of t his fact and devot e t rem endous effort
t o avoiding cross- cont am inat ionOptimizing PCR protocols PCR ca n be ve r y t r ick y While PCR is a very pow erful t echnique, oft en
enough it is not possible t o achieve opt im um
result s w it hout opt im izing t he prot ocol Crit ical PCR param et ers:- Concent rat ion of DNA t em plat e, nucleot ides,
divalent cat ions
2+ ( especially Mg ) and polym erase
- Error rat e of t he polym erase ( Taq, Vent exo,
Pfu)
- Prim er design
DNA Sequencing Sequencing methods
- The process of determining the order of the nucleotide bases along a DNA strand is called DNA sequencing
- In 1977 two separate methods for sequencing DNA were developed: the chain termination method or cycle sequencing (Sanger et al.) and the chemical degradation method or Maxam-Gilbert sequencing
(Maxam and Gilbert)
- Both methods were equally popular to begin with, but, for many
reasons, the cycle sequencing method is the method more commonly
used today - This method is based on the principle that single-stranded DNA molecules that differ in length by just a single nucleotide can be separated from one another using polyacrylamide gel electrophoresis
Cycle Sequencing Concept: If we know the distance of each type of base from a known origin, then it is possible to deduce the sequence of the DNA.
Obt aining t his inform at ion is concept ually quit e sim ple. The idea is t o cause a t erm inat ion of a grow ing DNA chain at a know n base ( A,G,C or T) and at a know n locat ion in t he DNA I n pract ice, chain t erm inat ion is caused by t he inclusion of a sm all am ount of a single dideoxynucleot ide base in t he m ixt ure of all four norm al bases ( e.g. dATP, dTTP, dCTP, dGTP and ddATP) . The sm all am ount of ddATP w ould cause chain t erm inat ion w henever it w ould be incorporat ed int o t he DNA. The incorporat ion of ddATP w ould be random and t hus all possible chains t hat end in 'A' w ill exist .
Deoxy versus dideoxy
Pelatihan
Teknik Dasar Pengklonan Gen, Bogor 13-24 Nov 2006 DNA synthesis
Pelatihan
Teknik Dasar Pengklonan Gen, Bogor 13-24 Nov 2006 Metode dalam sekuensing:
1. Metode Sanger (1977): prinsip dasar: dideoksi OHÆH
- P O O
CH2
H H H H O
O
A : T H H H H H
- P O O CH2 H
O
H
G: C Diseoksinukleotida Sintesa berhenti
Pelatihan
Teknik Dasar Pengklonan Gen, Bogor 13-24 Nov 2006
DNA Sequencing
The different st eps in cycle sequencing
DNA Sequencing
Cycle sequencing chain t erm inat ion lect ure/ lect ure04/ lect ure04.ht m l ht t p: / / w w w .m bio.ncsu.edu/ JWB/ MB409/ Taken from :
DNA Sequencing The separat ion of t he sequencing fragm ent s
To measure the sizes of the fragments, each of the four reactions would be loaded into a separate well on a gel, and the fragments would be separated by gel electrophoresis DNA sequencing
DNA Sequencing
Sequencing syst em s
LI COR DNA 4300 ABI 3100
utomated DNA sequencing
A
DNA Sequencing
Snapshot s of t he det ect ion of t he fragm ent s on t he sequencer four- dye syst em single- dye syst em e il f m ra g to a
DNA Sequencing
m ro h C
DNA Sequencing
The linear am plificat ion of t he gene in sequencing Maxam dan Gilbert (1977):
Prinsip: degradasi struktur kimia DNA 3‘
5‘
32 P
G (A+G) C (C+T) A>C Tambahkan senyawa pendegradasi
32 P ACACTGAACGTTCATGTCGA………….. me
32 P ACACTGAACGTTCATGTCGA………….. me
32 P ACACTGAACGTTCATGTCGA………….. me
32 P Penghilangann senyawa modifikasi
ACACT
32 dan hidrolisa ikatan fosfat dengan
P ACACTGAAC piperidine
32 P ACACTGAACGTTCAT pisahkan fragmen dengan elektroforesis
Gambar 1. Sekuensing dengan metodeMaxam-Gilbert