and klenow fragment was subjected to this fragment to obtain blunt ended fragment. pBin19 fragment and 35S promoter-multiple cloning site from PUC19
was then ligated to create pBIN1935S plasmid. TfTreS
that was available in pGemT easy vector system I was digested using EcoRI and was eluted from gel using QIAEX II Qiagen. At the same time,
pBIN1935S was digested using EcoRI and then was treated with alkaline phosphatase for 30 minutes. The gene fragment and the vector was ligated for
overnight, followed by transformation to CaCl
2
E.coli competent cells using heat shock transformation method as the same method mentioned before. The cell
suspension then was plated on agar solidified LB supplemented with 50 mgL kanamycin. Colonies obtained was observed after over night culture and 20
colonies were chosen to be re-analyzed whether they have the right plasmid with the right gene at the right orientation. Plasmid isolated from over night liquid
culture then was digested using EcoRI to see the size of the gene, and using Bam
HI to see the orientation of every clone. Plasmids that produced about 2000 bp fragment when digested with EcoRI and about 1100 bp fragment when
digested using BamHI were the expected one. MtTreS
was exciced from plasmid PCR Product Blunt II TOPO using Xba
ISacI. The digestion mixture was verified on 0.8 gel electrophoresis. Fragment DNA about 2000 bp was eluted from gel, and ligated with pBIN1935S
that has been digested with XbaISacI and treated with alkaline phasphatase for 30 minutes. The ligation mixture was transformed into E.coli, and the clones
obtained were reanalyzed using BamHI.
3.3 Result and Discussion
3.3.1 Cloning trehalose synthase gene TreS from Thrmobifida fusca This research was started by growing Thermobifida fusca that was purchased
from DSMZ Germany. The lyophilized material was dissolved in water and spread at solidified 65 medium at 55
o
C. DNA was isolated from mycelium and PCR was done in various annealing temperature to obtain the optimal annealing
temperature, the result is presented at Figure 5. The figure shows that there is no amplification resulted from control no
DNA and bands in different thickness resulted from different annealing temperature. The length of the original gene is 1830 bp. However, the primers
were designed outside the gene to get the whole gene. Band about 2000 bp in
size shown in the figure should be the TreS gene. It is shown that TreS can be amplified at 43
o
C up to 58
o
C annealing temperature, however, the temperature ranged from 49-56
o
C seems to be the optimal annealing temperature. Further PCR works were done at 53
o
C annealing temperature. This PCR product then was eluted using QiaexII Qiagen, the result is presented in figure 4B. The
purified DNA 6 ng µ
l of the mixture was ligated with pGemT Easy Vector System I 1 µL followed by transformation to E. coli DH5
α competent cells with
reaction mixture DNA : competent cells = 1.5 : 100 µL. It was obtained 100 colonies of putative transformed cells from 100 µL transformation mixture and
uncountable colonies were found from 900 µL the remaining transformation mixture. While from the control cell, 11 and 50 colonies
Figure 5: PCR Product at various annealing temperature and its eluted DNA. Optimum annealing temperature box is high lighted A. First raw is control water
template second row is PCR product of DNA sample. Eluted PCR product at 53
o
C annealing temperature B. M = molecular marker, ET= the eluted TreS.
Control no DNA
DNA template TreS
band 2000 bp
Eluted TreS 2000 bp
B M ET
M
A
805 517
1159 1700
1988 2838
4502 5977
11497 11497
1159
11497 1159
1988
were obtained from a 100 µL and 900µ reaction mixture respectively. From the results, we can see that the efficiency transformationligation was approximately
100 Colonies ng DNA, and, each colony has 90 probability to contain TreS. The plasmid with the insert then was annotated as pGemTreS with schematic
diagram shown in Figure 6. The non-transformed colonies ˜ 10 possibly resulted from T overhang of the vector that has been broken and self ligation
occurred.
Figure 6: Schematic diagram of pGemTreS pGemT with TreS gene as the
insert. Cloning sites of pGemT are indicated. Restriction sites of TfTreS are also indicated. T7 and SP6 are the promoters and arrows indicate
the direction of promoters.
T7 Apa
I Aat
II Sph
I BstZ
I Nco
I BstZ
I Not
I Sac
II EcoR
I Spe
I Eco
R I Not
I Bst
Z I Pst
I Sal
I Nde
I Sac
I Bst
X I Nsi
I SP6
1 Start
14 20
26 31
37 43
43 49
64 70
77 77
88 90
97 109
118 127
141
119 Sac II 200 Pst I
766 Sac I 829 Sac I
1103 BamH I 1136 Sma I
1680 Sma I 1830
pGemT
Cloning sites
Figure 7. Restriction analysis of plasmid isolated from E. coli colonies expected to bear TreS
gene. Plasmid isolated digested with EcoRI A, using PstI B and using Bam
HI C. Number of each well is an annotation for the clone used. Blue arrows indicated the fragments that were expected to be the right size when cut
using the corresponding enzymes .
From the putative transformed colonies, six colonies were analyzed to verify the presence of TfTreS The right size of the gene was verified using EcoRI.
In order to have idea of the right sequence and to see their orientation they were digested using BamHI and PstI see analysed Figure 7. These enzymes were
chosen based on the sequence of TfTreS gene analyzed with computer analysis in term of enzymes that may or may not cut as well as those that cut frequently
figure 7. Hence, as it was expected that using EcoRI the original size about a
A
B
C
11497 bp 5077bp
2838 bp 1700 bp
800 bp 440 bp
247 bp
5077 bp
M 1 4 5 6 8 9
1 4 5 6 8 9 M
1700 bp
M 1 4 5 6 8 9
2000 bp would be obtained, while using BamHI, single band of about 5000 bp was produced, since this enzyme cut once only within the gene.
Figure 8. Restriction analysis based on computer simulation of TreSTf sequence. Cutting with PstI, 2 profiles of bands were obtained, 1 bands of about 1800 bp
and of about 3300 bp were shown when the start codon spanned near T7 promoter, and, 2 a band of about 300 bp and of about 5000 bp were obtained if
the start codon spanned near SP6 promoter. From the picture, it can be seen that the resulted bands from any restriction enzyme appeared to be the right size as
expected. Hence, this gene should be the TreS from Thermobifida fusca. This result confirmed with sequence analysis Figure 9. We found, however, there
was a point mutation both clones at base 27
th
the third base of the 9
th
codon from GGC TO GGG and at base 1406 from GCT to GCC, fortunately, those
codons encode for alanine. The clone number 9, however, another point mutation occurred at base of 1257 from GGA to GGG both for glycine, and, hence these
silent mutations should not alter properties of the protein. Regarding to codon usage, there were slight increase of the first point mutation from 6.5 to 8.1,
and the third mutation shift the codon usage from 8.1 to 20.2. While the second mutation, there was dramatic decrease of codon usage from 31.8 to 8.5.
Whether these mutations affect protein activity, it would be discussed in session 6 characterization of transgenic line.
From the analysis conducted, we could conclude that TreS from Thermobifida fusca
has been successfully inserted in pGemT and cloned in E.coli
. This gene, hence, was ready to be inserted to plant expression cassette, in this case pBIN1935S that readily available in the laboratory was used. After
being chopped from pGemT using EcoRI and re-eluted from gel, TfTreS was ligated with pBin1935S that has been digested using the same enzyme and
treated with alkaline phosphatase. This ligation produced a new plasmid called pBin1935STfTreS with schematic diagram as shown in Figure 10. The ligation
mix mixture then was transformed into E .coli. Uncountable colonies were found and 20 of each clone were verified using EcoRI and BamHI Figure 11 to see if
the right gene was inserted and if insertion was in the correct orientation.
ATGACCACACAGCCGGCTCCTGGT GC
G CGCCCGACGCCGACCGGGTCCGTTC
CCGACACGTTCACCCACGCAAAGCCGCGCGACCCCTACTGGTACAAGCACGCG GTGTTCTACGAAGTCCTCGTCCGCGGCTTCTACGACTCCAACGGGGACGGCAC
CGGCGACTTGCGGGGCCTCATCGAAAAACTGGACTACCTGCAGTGGCTCGGCA TCGACTGCCTCTGGCTGCTGCCGATCTACGAGTCCCCGCTCCGCGACGGC
GGCTACGACGTCTCCGACTACATGAAGATCCTGCCCGAGTTCGGCCGGATCTC CGACTTCGTGGAACTCGTCGAAAAAGCCCACCAGCGGGGCATCCGGGTCATCA
CCGACCTGGTCATGAACCACACCAGCGACCAGCACCCGTGGTTCCAAGCCTCC CGGCACGACCCCGACGGACCTACGGCAACTTCTACGTCTGGTCGGACACCACG
GAACGTTACAGCGACGCGCGCATCATCTTCATCGACACCGAGCAGTCC AACTGGACCTACGACGAAGTGCGCGGACAGTACTACTGGCACCGCTTCTTCTC
CCACCAGCCCGACCTCAACTTCGAGAACCCGGACGTCCAGGACGCCATCCTCG AAGTGATGCGGTTCTGGCTGGACCTTGGCATCAGCGTTTCCGCTTGGAGCCCG
TGCCCTACCTGTACGAGCGGGAAGGCACGAACTGCGAGAACCTCAAGGAGACC CACGAGTTCCTCAAACGCATCCGCGCCGAAGTCGACCGGCTCTACCCC
GACCGGGTCCTGCTCAGCGAAGCCAACCAGTGGCCCGCCGACGTCGTCGACT ACTTCGGCGACTACGAATCCGGCGGCGACGAATGCCACATGAACTTCCACTTC
CCGCTGATGCCGCGCATGTTCATGGCGGTCCGGCGCGAACAGCGCTACCCCAT CTCGGAAATCCTCGCGCAGACCCCGCCTATTCCGCGCAACTGCCAGTGGGCGA
TCTTCCTGCGCAACCACGACGAGCTGACCTTGGAGATGGTCAAGCGATG AAGAGCGGGACTACATGTACTCCGAATACGCCAAAGACCCGCGGATGCGCGCC
AACATGGGGATCCGCCGCCGGCTGGCACCCCTCCTGGAAAACGACCTCAACCA GATCAAACTGTTCACCGCGCTGCTGCTGTCGCTGCCCGGCTCCCCGGTGCTCT
TACTACGGCGACGAGATCGGGATGGGCGACAACATCTGGCTGGG
GG A
CCGCG ACAGCGTGCGCACCCCATGCAGTGGACCCCGGACCGCAACGCCGGATTCTC
CCGCTGCGACCCGGGCCGCCTCTACCTGCCGGTGATCATGGACCCGATCTACG GGTACCAGGCGATCAACGTCGAAGCACAGCAGAACAACCCGAACTCTGCT
GC T
GAACTGGACCCGCAACATGATCCAGATCCGCAAGCAGCACCCGGTGTTCGGGA CGGGGGACTTCACCGAACTCCACGCGAGCAACCCCAGCGTGTTCGCGTTCGTG
CGCGAATACGGCGACGACCGGATGCTGTGCGTCAACAACCTGTCCCG GTTTCCCCAACCGGTGGAACTGGACCTCCGCCGCTTCGAAGGGATCACCCCGA
TCGAATGCACGGGGGGAGTGCACTTCCCGCCCATCGGGGAACTGCCCTACCTG CTGACTCTCCCCGGGCACGGCTTCTACTGGTTCCAGCTTCCGCCCGTCGCCGA
AGAGCAGCCGCTCGCCCAGCCCGTCACCACCGTCCCCGCAGCCCCGCAGCCT CCTGCTCCGGCAGACCGTCCCGCGTCCGACCCGACCCAGCGGTCCTGA
Figure 9: Sequence of TreS from Thermobifida fusca cloned in E. coli. The sequence confirmed the original sequence published in Web site Wei et al 2004 but
some silent mutation occurred at sites indicated. Number within boxes annotated the base position in the gene.
GC C
The 1406
th
GC C the 27
th
GG G the 1257
th
Figure 10. Schematic diagram of pBIN1935STfTreS 14400 bp. Restriction site available in the gene and in the vector are shown.
The result showed that using EcoRI, 1 band of the entire gene about 2000 bp and another band of about 13000 bp were obtained. While using BamHI, 2
possible band profiles 816 were shown Figure 11. One band of 1100 bp in size beside a single big band was obtained when the TfTreS start codon spanned just
behind CaMV35S promoter. Otherwise, a band of 750 bp beside a large single band was also obtained when the start codon spanned just before the terminator.
From the figure 10, it can be seen that almost all clones analyzed contained insert with different profile when digested using BamHI, indicating
different orientation of the gene within the vector. Clones that contained the right gene size with the right orientation are shown by blue arrow, such as clone no
918 and 816 Figure 11A. The restriction analysis showed that the TfTreS is successfully inserted in plant expression cassette, pBIN1935S and cloned within
E. coli . Hence, it can be proceeded to be transformed into Agrobacterium as
mediator of gene transfer into plant chromosome. It was used 1 µL plasmid DNA to be transformed into 100 µL Agrobacterium LBA4404 competent cells, and
about 50 and uncountable colonies were found on the plate of 100 µL and 900 µL ligation mixture respectively selected on medium supplemented with kanamycin
and riphamphycin. While from the control plate pBin1935S without insert, no
pBin1935STfTreS
tNOS pNOS
colonie was observed. Six colonies of each clone were reanalyzed using EcoRI and BamHI as done previously. The result Figure 11 B and C shown that the
plasmid within Agrobacterium was still the same plasmid as found in E.coli. Hence, the Agrobacterium with TfTreS gene in plant expression cassette was
ready to be introduced to plant.
Figure 11. Restriction analysis of TfTreS inserted in the plant expression cassette of
pBin1935S after being cloned within E.coli and Agrobacterium. BamHI A or EcoRI B were used to analyze the clones. Those with 2000 bp fragment
when cut using EcoRI and those with 1100 bp fragment when cut using BamHI are the expected clones. Most of the clones contained the pBIN1935STFTreS.
Only 2 among the right clones were choosen to be transformed into Agrobacterium,
blue arrow = clone 18 derivated from clone 9 and annotated as clone 918; red arrow = clone no 16 derivated from clone no 8 and annotated
as clone 816. Restriction analysis of the construct after being transferred into Agrobacterium tumefaciens
of clone number 8 C and of clone number 9 D shiw the identical fragments among the samp les resulted from BamHI and as
well as shown with EcoRI restriction analysis confirmed the right clones. 3.3.2 Cloning trehalose synthase gene from Mycobacterium tuberculosis
TreSMt Based on the sequence of the MtTreS restriction site available within the
gene and within the vector pCR-Blunt II-TOPO, it was decided to verify the
Bam HI
Eco RI
1100 bp
2000 bp
A
1100 bp 1100 bp
2000 bp 2000 bp
M
M 1 2 3 4 5 6 M 1 2 3 4 5
M M
B
C D
recombinant plasmid using NdeIXhoI, EcoRI and BamHI. Beside the vector, some fragments were obtained: the entire gene of about 2000 bp when the
plasmid was cut using NdeIXhoI; 1 fragment of 750 bp; 3 fragments at different length when BamHI and EcoRI were used respectively Figure 12 A. These
results confirmed that the gene within the vector was MtTreS. This gene then was
BamHI
EcoRI
NdeIXhoI
Figure 12. Restriction analysis of MtTreS within pCR Blunt II TOPO A, 1-2 were profile of pCR Blunt II TOPO. Fragments resulted from restriction
enzymes are indicated. Eluted of MtTreS after being Excised from its cloning vector 1-6, plant expression cassette, pBIN1935S cut using
Xba ISacI 7-8 and 9 = pBin1935S uncut B.
re-excised from pCR Blunt II TOPO using XbaISacI in order to fit the cloning site of pBIN1935S with the right orientation before inserted into the plant expression
cassette. Fragment of the gene and the vector after elution from the gel were verified before ligation was made see Figure 12 B. The ligation gave a construct
with diagram presented in Figure 13 A, and annotated as pBIN1935SMtTreS.
A
B M
1 2
M 1 2 3 4 5 6 7 8 9
11497 5077
2838 1700
12402 12402
2000
pBin1935SMtTreS
Figure 13: Schematic diagram of pBin1935SMtbc and its restriction analysis. The
schematic diagram of pBin1935SMtTreS is shown A. Restriction sites within vector and within the gene are also indicated. Restriction analysis of the
plasmid using BamHI after being cloned within E.coli B, 1-8 = clones analyzed. A 750 bp fragment is an indicator of the right orientation of the gene
within the vector. Restriction analysis of the plasmid after being cloned within Agrobacterium tumefaciens
, using both XbaISacI that result a whole gene fragment of about 2000 bp C and using BamHI resulted a 750 bp fragment
D indicates that the plasmid was remained after being cloned within Agrobacterium
. Whell 1-4 = Clone no 1, whell 5-8 = clone no.4 and whell 9 = uncut pBin1935SMtbc.
750 bp
C
2000 bp
Xba ISacI
750 bp
A
B
Bam HI
Bam HI
B
tNOS pNOS
M 1 2 3 4 5 6 7 8 9
M 1 2 3 4 5 6 7 8 9
M 1 2 3 4 5 6 7 8 9
D
After ligation for overnight and transformed into E. coli, uncountable colonies were obtained from both 100 and 900 µL of ligation mixture layered on plates. A
4 colonies of each were analyzed as before Figure 13 B. All clones analyzed 4 colonies each contained the insert, with very light differences in fragment sizes
resulted from BamHI cut, and 4 clones shown the most expected profile 1, 4, 7 and 8. Two clones, clone number 1 and 4 were chosen to be further transformed
into Agrobacterium. Verification both plasmid after Agrobacterium transformation was done using BamHI and XbaISacI as previously. This restriction analysis
showed the right size of the gene about 2000 bp was obtained using XbaIScaI, and fragment of about 750 bp indicated the right orientation obtained from BamHI
cut. This result confirmed that the construct pBin1935SMtTreS was remained after being transformed into Agrobacterium. Hence, construction of MtTreS in
plant expression cassette has been achieved, and was ready to be introduced into plant.
3.4 Conclusion
