149
8.2.1. DNA Analysis
a. Plant materials. Sample used were obtained from fresh dried material kept in Silica Gell
collected both from the field and plant growing at green houese of Bogor Botanic Gardens Table 8.1.. Voucher specimens were deposited in Herbarium
Bogoriense BO and Herbarium of Bogor Botanic GardensBOHB. b. DNA Extraction.
DNA was extracted by a modified CTAB method of Doyle and Doyle 1978 or using the Dneasy Plant Mini Kit Qiagen, Inc., Tokyo following the
manufacturer’s intruction. 1 500 um CTAB was poured in the 1.5 ml tube and it was incubated on 60ºC. 2 A piece of lamina ± 4 cm2 was ground on the bowl
by using liquit nitrogen until forming smooth powder . 3 The smooth powder was poured into the tube containing 500 um CTAB and shaked for 1 minute and
then incubated in 60ºC for 30-60 minutes. c. Separating DNA from Protein.
1 500 um of cloroform and isoamil alcohol mixture was poured into the tube containing sample and 500 um CTAB and shaked by hand for 10 minutes. 2
The tube was centrifuged on 20ºC for 20 minutes at 15000 rpm. 3 The top layer containing water with DNA was poured into the 1.5 um tube. Step no.1 – no.3
were repeated once more. d. DNA Purification.
1 400 ul Isoamilalcohol was added into the tube containing DNA liquit and than kept in the freezer for15 minutes or longer. 2 The tubes were
centrifuged at 0ºC for 15 minutes at 15000rpm. 3 The liquid was disposed of the residu was DNA. 4 300 ul 70 Ethanol was added into the tube and
shaked by using vortex and centrifuged at 20ºC for 10 minutes 15000rpm. 5 The ethanol was evaporated by using aspirator. 6 Tubes containing DNA was
dried in the desicator for10 minutes. 7 The DNA was dissolved in 100um TE and than shaked well.
150 e. rbcL Multiplication by Using PCR.
PCR was performed using a DNA thermal cycler Perkin-Elmer 9700, Applied Bosystems, CA with Ex Taq DNA polymerase TaKaRa Biomedical,
Tokyo. Some samples were amplified with Amp direct Shimazu, Kyoto, whike most others were amplified with Ex buffer. 1 10xPCR Buffer, dNTPmix, 10 pM
primer x 2, MgCl2, DNA template, Taq polymerase and DW Destilate Water were poured into 0.2 ml tubes. Taq must be kept at 0ºC in the ice box before
PCR was begun to run. 2 PCR was runned at 94ºC for 3 minutes and turned on 35 cycles at 94ºC for 30 seconds, at 48ºC for 40 second, at 72ºC for 90 seconds,
and at 72ºC for 7 minutes and than the tubes were kept at 4ºC. f. Checking PCR Product by Using Electrophoretic
1 making gel agarose LE 1. 2 3.5 ul PCR product was mixed with dye in the parafilm and than poured into sample holes 3 Elektroforesi was
runned 4 When blue colour reaching the forth line electrophoretic was stopped. Gel was moved and pu t into etidiumbromid for 20 minutes. 5 Gel was
illuminated by using UV beam; if bars pictures with proportion sizes were seen it was concluded that PCR product have been multiplied well.
g. PCR Product Purification PCR products were purified with GFX DNA and GEL purification Kit
Amarsham Pharmacia Biotech, Piscataway, NJ or with ExoSAP-IT USB corporation, Ohio following the manufacture’s intruction. a. Autocycle. 1 3
ul premix, 0.5 ul sequence buffer, 0.5 ul MgCl2, 1.6 ul 2pm primer, and 4.4 ul DNA were put into the 0.2 ml tubes. The premix was containing of dNTP,
ddNTP, buffer and taq polymerase. Taq polymerase must be kept at 0ºC before autocyle. 2 PCR was begun at 96ºC for 90 second and than runned at 30 cycles
96ºC for 10 second, at 50ºC for 15 second and at 60ºC for 4 minutes and than the tubes were kept at 4ºC. b. Purifying Autocycle Product. 1 12.5ul 100 Etanol
and 0.5um 3M sodium asetat were put into 1.5 ml tubes 2 Autocycle product were added into the tubes and shaked by using vortex. 3 The tubes were kept in
the ice box for 20 minutes. 4 The tubes were centrifuged for 20 minutes at 20ºC 15000rpm and than their liquit were run off. 5 250ul etanol 70 was added into
151 the tubes and than shaked by using vortex. 6 The tubes were centrifuged at
20ºC for 10 minutes at 15000rpm speed and than ethanol was evaporated by using aspirator. 7 Autocycle product in the tubes were dried in the desiccator
for 15 minutes. h. Gel Squencing Preparation
1 Glass plate for gel was washed off with water and rinsed off with miliQ and isoprophanol, and than dried at room temperature. 2 preparing gel.
18g urea was mixed with 5 ml 10x TBE buffer and amount of water and than stirred by using magnetic stirrer for 10 minutes 3 The mixture was added with
water till 48 ml volume. 4 The mixture was evaporated by using aspirator and than kept in the refrigerator 5 The mixture was evaporated by using dessicator
for 5 minutes. 6 10 APS was made in the tube. 7 Glass plate was lay out on the flat tabel, tweezers were tightened 8 TEMED 30ul and 270ul APS 10
were poured into the mixture and shaked manually 9 The Gel was poured into the glass plate and than chomb was installed. 10 After 2 hours, manicure was
smeared for preventing buffer spilled out. i. Preparing Samples for Squencing
1 Formamide and blue dextran 5:1 mixtured was made. 3ul DNA sample for every coll. number were also prpepared. All samples and blue dextran
must alwasy be kept in the ice box and blue dextran. 2 The tubes containing samples were shaked by using shaker for 5 minutes. 3 The tubes cantaining
were incubated at 98ºC for 2 minutes and than kept in the ice box.. j. Run Sequencer
1 Chomb was removed from gel and than changed with the chomb with 36 holes. 2 Glass plate gel was washed and rinsed off with isopropanol and
mili-Q till the white line not seen. 3 Glass plate gel was installed on the chamber sequencer
and than cassette recorder was also installed on the Sequencer.
4 Checking glass plate gell if the noise voice was heared from the machine we must clean again the plate. 5 Chamber was installed on the
sequencer and than 1x TBE buffer was poured into the chamber. 6 All of the
bubbles attaching the holes chomb must be removed by using injector.
152 Table 8.1. List of Taxa Used in This Study
Species Locality
Collector and Number
Herbarium Holding
Voucher Genebank
Accession No.
References
Outgroup
Athyrium distentifolium Unknown
AB059577 Yatabe and
Murakami2001 Athyrium filix-femina L. Roth ex
Meretens AY818676
Skog et al 2004 Athyrium
niponicum Mett.
Hance Tokyo,
Japan CT1005
TI AB232413
Tsutsumi and
Kato 2006
Athyrium vidalii Miq. Koidz. Chiba, Japan
Sano 25 CBM
D43894 Sano et al 2000b Athyrium sheareri
Aichi, Japan Sano 41
CBM D43892 Sano et al 2000b
Athyrium yokoscense Fr. Et Sav. Christ
Chiba, Japan Sano 22
CBM D43893 Sano et al 2000b
Ingroup
Diplazium angustipinna Holttum Near Sungai Kobet, Track to Batu
Ayau, Muller Range, Central Kalimantan, Borneo. 440 m.
T.Ng. Praptosuwiryo 1905
BO Present Study
Diplazium asymmetricum Praptosuwiryo Sp. Nov.
Petak 4 Desa Kemutuk Lor, Converted forest-Natural forest boundary,
Wanawisata Baturraden, Mt. Slamet, Cetral Java. 970-1000 m.
T.Ng. praptosuwiryo 1094
BO Present Study
Diplazium asymmetricum Praptosuwiryo Sp. Nov. 2=1
Loop Trail, Cikaniki Forest Research, Mt. Halimun, West Java. Ca. 1000 m
T.Ng. praptosuwiryo 1728
BO Present Study
Diplazium cordifolium Blume ‘simple fronds’
Cangkuang Forest, Southern Slopes of Mt. Salak, West Java
T.Ng. Praptosuwiryo 1202
BO Present Study
153 Table 8.1. Continued
Species Locality
Collector and Number
Herbarium Holding
Voucher Genebank
Accession No.
References Diplazium cordifolium Blume
‘Pinnate fronds’ Cangkuang Forest, Southern Slopes of
Mt. Salak, West Java T.Ng. Praptosuwiryo
1237 BO
Present Study Diplazium cordifolium Blume
‘Pinnate fronds’ Cangkuang Forest, Southern Slopes of
Mt. Salak, West Java T.Ng. Praptosuwiryo
1238 BO
Present Study Diplazium cf cordifolium Blume
Primary forest between S. Anak Kobet- S. Kobet, track to Batu Ayau, Central
Kalimantan, Borneo. T.Ng. Praptosuwiryo
1912 BO
Present Study Diplazium accedens Blume
Cibodas Forest, Track I of Mt. Gede, behind Cibodas Botanic Gardens Guest
House, Gede-Pangrango National Park T.Ng. Praptosuwiryo
1001 BO
Present Study Diplazium accedens Blume
Cibodas Forest, Track I of Mt. Gede, behind Cibodas Botanic Gardens Guest
House, Gede-Pangrango National Park T.Ng. Praptosuwiryo
1161 BO
Present Study Diplazium accedens Blume
Cangkuang Forest, Southern Slopes of Mt. Salak, West Java.
T.Ng. Praptosuwiryo 1211
BO Present Study
Diplazium bantamense Blume Cibodas Forest, Track I of Mt. Gede,
behind Cibodas Botanic Gardens Guest House, Gede-Pangrango National Park,
West Java T.Ng. Praptosuwiryo
1160 BO
Present Study
Diplazium batuayanense Praptosuwiryo Above Sungai Kobet, Track to Batu
Ayau, Muller Range, Central Kalimantan, Borneo. 440 m.
T.Ng. Praptosuwiryo 1909
BO Present Study
D_cavalerianum Christ. C.Chr. Chiba, Japan
Sano 11 CBM
D43909 Sano et al 2000b D. chinense Bak. C.Chr.
Kumamoto, Japan Ohta
Takamiya 739 KUMA
AB021718 Sano et al 2000b
154 Table 8.1. Continued
Species Locality
Collector and Number
Herbarium Holding
Voucher Genebank
Accession No.
References Diplazium dilatatum Blume
Cibodas Forest, Track I of Mt. Gede, behind Cibodas Botanic Gardens Guest
House, Gede-Pangrango National Park T.Ng. Praptosuwiryo
1011 BO
Present Study Diplazium simplicivenium Holttum
Cibodas Forest, Track I of Mt. Gede, behind Cibodas Botanic Gardens Guest
House, Gede-Pangrango National Park T.Ng. Praptosuwiryo
1025 BO
Present Study Diplazium
simplicivenium Holtum
Converted Forest, Petak
55, Desa
Karang Mangu, Wana Wisata Baturraden, G. Slamet, Baturraden,
Central Java. 860 m. T.Ng. Praptosuwiryo
1073 BO
Present Study
Diplazium dilatatum Blume Kagoshima, Japan
Ohta Takamiya 602
KUMA AB021719 Sano et al 2000b
Diplazium donianum
Mett. Tard.
Kagoshima, Japan
Sano 29 CBM
D43911 Sano et al 2000b Diplazium esculentum Retz. Sw.
Situ Patengan, Mt. Patuha, Bandung, West Java.
T.Ng. Praptosuwiryo 730
BO Present Study
Diplazium esculentum
Retz. Sw.
Gede-Pangrango National Park,
West Java
T.Ng. Praptosuwiryo 1227
BO Present Study
Diplazium esculentum
Retz. Sw.
Kagoshima, Japan
Hasebe 276001
TI U05619 Hasebe et al 1994
Diplazium hottae Tagawa Near Sungai Anak Kobet, Track to
Batu Ayau, Muller Range, Central Kalimantan, Borneo. 450 m.
T.Ng. Praptosuwiryo 1911
BO Present Study
Diplazium lobbianum Moore Cibodas Forest, Track I of Mt. Gede,
behind Cibodas Botanic Gardens Guest House, Gede-Pangrango National Park
T.Ng. Praptosuwiryo 1007
BO Present Study
155 Table 8.1. Continued
Species Locality
Collector and Number
Herbarium Holding
Voucher Genebank
Accession No.
References Diplazium lobbianum Moore
Cibodas Forest, Track I of Mt. Gede, behind Cibodas Botanic Gardens Guest
House, Gede-Pangrango National Park T.Ng. Praptosuwiryo
1031 BO
Present Study Diplazium lobbianum Moore
Cibodas Forest, Behind Cibodas Botanic Gardens, Track I Mt. Gede,
Gede-Pangrango National Park, West Java. 1500 m
T.Ng. Praptosuwiryo 1181
BO Present Study
Diplazium lobbianum Moore Cibodas Forest, Track I of Mt. Gede,
behind Cibodas Botanic Gardens Guest House, Gede-Pangrango National Park,
West Java T.Ng. Praptosuwiryo
1008 BO
Present Study
Diplazium lonchophyllum Kunze Unknown
U05920 Wolf et al 1994 Diplazium megasegmentum
Praptosuwiryo Sp.Nov. Cangkuang Forest, Southern Slope, Mt.
Salak, West Java. T.Ng. Praptosuwiryo
1450 BO
Present Study Diplazium mesosorum
Tochigi, Japan Sano 44
CBM D43910 Sano et al 2000
Diplazium okudairaekami Diplazium pallidum Blume Moore
Near Telaga Warna, Gede-Pangrango National Park, West Java
T.Ng. Praptosuwiryo 1172
BO Present Study
Diplazium pallidum Blume Moore Mt. Payung, Ujung Kulon National
Park, West Java T.Ng. Praptosuwiryo
1406 BO
Present Study Diplazium poiense C.Chr. in C.Chr.
Holttum Unknown
TML1 Diplazium polypodioides Blume
Cangar Nature Reserve, Mt. Welirang, Batu, East Java. 1370-1400 m.
T.Ng. Praptosuwiryo 667
BO Present Study
Diplazium polypodioides Blume Cibodas Forest, Mt. Gede, Gede-
Pangrango National Park, West Java T.Ng. Praptosuwiryo
1185 BO
Present Study
156 Table 8.1. Continued
Species Locality
Collector and Number
Herbarium Holding
Voucher Genebank
Accession No.
References Diplazium porphyrorachis
Unknown TML2
Diplazium procumbens Holttum Cibodas Forest, Track I of Mt. Gede,
behind Cibodas Botanic Gardens Guest House, Gede-Pangrango National Park
T.Ng. Praptosuwiryo 1015
BO Present Study
Diplazium procumbens Holttum Cibodas Forest, Track I of Mt. Gede,
Behind Cibodas Botanic Gardens Guest House, Gede-Pangrango National Park
T.Ng. Praptosuwiryo 1047
BO Present Study
Diplazium procumbens Holttum Cibodas Forest, Behind Cibodas
Botanic Gardens, Track I Mt. Gede, Gede-Pangrango National Park, West
Java T.Ng. Praptosuwiryo
1163 BO
Present Study
Diplazium procumbens Holttum Converveted Forest-Natural Forest
Boundary, Petak 4 Desa Kemutuk Lor Wana Wisata Baturraden, Mt. Slamet,
Central Java. 970-1000 m. T.Ng. Praptosuwiryo
1094 BO
Present Study
Diplazium procumbens Holttum Cimisblung, Mt. Masigit, Mt.
Pangrango, Gede-Pangrango National Park. 1300 m.
T.Ng. Praptosuwiryo 1281
BO Present Study
Diplazium procumbens Holttum Cangkuang Forest, Souther Slopes of
Mt. Salak, West Java. T.Ng. Praptosuwiryo
1216 BO
Present Study Diplazium rhachidosorus
Unknown TML3
Diplazium riparium Holttum Unknown
TML4
157 Table 8.1. Continued
Species Locality
Collector and Number
Herbarium Holding
Voucher Genebank
Accession No.
References Diplazium
sibiricum var.
sibiricum Akita,
Japan Ohta Takamiya
695 KUMA AB021720
Sano et al 2000b Diplazium silvaticum Bory Sw.
Wild fern of Bogor Botanic Gardens, Java
T.Ng. Praptosuwiryo 1300
BO Present Study
Diplazium silvaticum Bory Sw. Wild fern of Bogor Botanic Gardens,
Java T.Ng. Praptosuwiryo
1302 BO
Present Study Diplazium silvaticum Bory Sw.
Wild fern of Bogor Botanic Gardens, Java
T.Ng. Praptosuwiryo 1303
BO Present Study
Diplazium simplicivenium Holttum Track to Cibeureum, Mt. Gede, Gede-
Pangrango National Park, West Java T.Ng. Praptosuwiryo
1141 BO
Present Study Diplazium
simplicivenium Holttum
Rawa Denok
I, Gede-Pangrango National Park, West Java
T.Ng. Praptosuwiryo 1171
BO Present Study
Diplazium simplicivenium Holttum Near Batu Kukusan I, Gede-Pangrango
National Park, West Java T.Ng. Praptosuwiryo
1175 BO
Present Study Diplazium simplicivenium Holttum
Cibodas Forest, Mt. Gede, Gede- Pangrango National Park, West Java
T.Ng. Praptosuwiryo 1179
BO Present Study
Diplazium sorzogonense C. Presl. Loop Trail , Cikaniki Research Center,
Mt. Halimun, West Java. Ca. 1000 m. T.Ng. Praptosuwiryo
1720 BO
Present Study Diplazium sorzogonense C. Presl.
Loop Trail , Cikaniki Research Center, Mt. Halimun, Halimun National Park,
West Java. Ca. 1000 m. T.Ng. Praptosuwiryo
1725 BO
Present Study Diplazium sorzogonense C. Presl.
Loop Trail, Cikaniki Forest Research Center, Mt. Halimun, Halimun
National Park, West Java. Ca. 950 m. T.Ng. Praptosuwiryo
1731 BO
Present Study Diplazium sorzogonense C. Presl.
Jalur Owa, Cikaniki Reseacrh Center, Mt. Halimun, West Java. Ca. 975 m.
T.Ng. Praptosuwiryo 1744
BO Present Study
158 Table 8.1. Continued
Species Locality
Collector and Number
Herbarium Holding
Voucher Genebank
Accession No.
References Diplazium speciosum Blume
Geger Bentang, Mt. Pangrango, Gede- Pangrango National Park, West Java.
1960 m. T.Ng. Praptosuwiryo
1243 BO
Present Study Diplazium squamigerum Mett.
Matsum. Kumamoto, Japan
Ohta Takamiya 893
KUMA Sano et al 2000b
Diplazium subpolypodioides Alderw. Alderw.
Cibodas Forest, Mt. Gede, Gede- Pangrango National Park, West Java.
T.Ng. Praptosuwiryo 1184
BO Present Study
Diplazium subserratum Blume Moore. Converted Forest, Petak 55, Desa
Karang Mangu, Wana Wisata Baturraden, G. Slamet, Baturraden,
Central Java. 860 m. T.Ng. Praptosuwiryo
1070 BO
Present Study
Diplazium subserratum Blume Moore. Converted Forest, Petak 55, Desa
Karang Mangu, Wana Wisata Baturraden, G. Slamet, Baturraden,
Central Java. 860 m. T.Ng. Praptosuwiryo
1072 BO
Present Study
Diplazium subvirescens Praptosuwiryo Cibodas Forest, Track I of Mt. Gede,
behind Cibodas Botanic Gardens Guest House, Gede-Pangrango National Park
1500 m. T.Ng. Praptosuwiryo
1178 BO
Present Study
Diplazium subvirescens Praptosuwiryo Cibodas Forest, Track I of Mt. Gede,
behind Cibodas Botanic Gardens Guest House, Gede-Pangrango National
T.Ng. Praptosuwiryo 1012
BO Present Study
Diplazium tomentosum Blume Loop Trail, Cikaniki Forest Research,
Mt. Halimun, West Java. Ca. 1000 m T.Ng. Praptosuwiryo
1722 BO
Present Study Diplazium umbrosum Smith Bedd.
Cibodas Forest, Track I of Mt. Gede, behind Cibodas Botanic Gardens Guest
House, Gede-Pangrango National Park T.Ng. Praptosuwiryo
1002 BO
Present Study
159 Table 8.1. Continued
Species Locality
Collector and Number
Herbarium Holding
Voucher Genebank
Accession No.
References Diplazium umbrosum Smith Bedd.
Cibodas Forest, Track I of Mt. Gede, behind Cibodas Botanic Gardens Guest
House, Gede-Pangrango National Park T.Ng. Praptosuwiryo
1050 BO
Present Study Diplazium wichurae Mett. Diels
Shizuoka, Japan Sano 13
CBM D43915 Sano et al 2000b
Diplazium xiphophyllum Baker C.Chr. Eas Kalimantan, Borneo TD 902
Living Coll. at Nuserry
of BBG Present Study
Diplazium xiphophyllum Baker C.Chr. Loop Trail, Cikaniki Forest Research, Mt. Halimun, West Java. Ca. 950 m.
T.Ng. Praptosuwiryo 1717
BO Present Study
Diplazium xiphophyllum Baker C.Chr. Loop Trail, Cikaniki Forest Research, Mt. Halimun, West Java. Ca. 950 m.
T.Ng. Praptosuwiryo 1719
BO Present Study
Diplazium xiphophyllum Baker C.Chr. HM 39 Cikuda Paeh, Cikaniki Forest Research, Mt. Halimun, West Java.
T.Ng. Praptosuwiryo 1791
BO Present Study
160 7 Prerun for 5 minutes. 8 Stopping for a moment and than samples with odd
number collectons were injected into the odd holes. 9 Resume for 5 minutes. 10 Stop prerun and than the sample with the even collentions number were
injected into the even holes and than the chambercover was installed 11 Running.
k. Gene rbcL sequence alignment. The PCR product were sequenced with the Big Dye Terminator Cycle
Squencing Kit Ver. II or Ver. III Applied Biosystems, CA following manufacturer’s intructions with amplification primers of Hasebe et al Tabel 1..
l. Homology searching on the data base by internet using a reprsentative database of nucleotide sequence, DNA DataBase of Japan DDBJ,
http:www.ddbj.nig.ac.jp to compare predicted gene sequence with the registered sequence in the database.
Table 8.2. Primers Used for Amplifying and Sequencing DNA from Diplazium Hasebe et al, 1994
Primer Sequence 5’ to 3’
Position rbcL
-aF rbcL-bF
rbcL-sR rbcL
-aR rbcL
-cF rbcL-sF
rbcL -cR
rbcL-bR ATGTCACCACAAACAGAGACTAAAGC
TATCCCCTGGATTTATTTGAGGAAGGTTC GAACCTTCCTCAAATAAATCCAGGGGATA
CTTCTGCTACAAATAAGAATCGATCTCTCCA TGAAAACGTCGTGAATTCCCAACCGTTTATGCG
ACTGTAGTGGGCAAATTGGAAGGCGAACG GCAGCAGCTAGTTCCGGGCTCCA
CGTTCGCCTTCCAATTTGCCCACTACAGT 1-26
307-335 335-307
670-640 609-638
988-1016 1373-1351
1016-988
161
8.2.2. Phylogenetic analysis